ID: 1151668282

View in Genome Browser
Species Human (GRCh38)
Location 17:75557964-75557986
Sequence AGCCCTGGCCCTGGGGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 1, 1: 1, 2: 6, 3: 67, 4: 636}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151668282_1151668299 30 Left 1151668282 17:75557964-75557986 CCTGGTGCCCCAGGGCCAGGGCT 0: 1
1: 1
2: 6
3: 67
4: 636
Right 1151668299 17:75558017-75558039 GCATGGGTCCTGCTGCCTCGGGG 0: 1
1: 0
2: 0
3: 17
4: 158
1151668282_1151668297 28 Left 1151668282 17:75557964-75557986 CCTGGTGCCCCAGGGCCAGGGCT 0: 1
1: 1
2: 6
3: 67
4: 636
Right 1151668297 17:75558015-75558037 ATGCATGGGTCCTGCTGCCTCGG 0: 1
1: 0
2: 1
3: 21
4: 193
1151668282_1151668298 29 Left 1151668282 17:75557964-75557986 CCTGGTGCCCCAGGGCCAGGGCT 0: 1
1: 1
2: 6
3: 67
4: 636
Right 1151668298 17:75558016-75558038 TGCATGGGTCCTGCTGCCTCGGG 0: 1
1: 0
2: 0
3: 35
4: 252
1151668282_1151668287 1 Left 1151668282 17:75557964-75557986 CCTGGTGCCCCAGGGCCAGGGCT 0: 1
1: 1
2: 6
3: 67
4: 636
Right 1151668287 17:75557988-75558010 CTGTGTCTCCTCCCCACCCTAGG 0: 1
1: 0
2: 7
3: 46
4: 451
1151668282_1151668291 13 Left 1151668282 17:75557964-75557986 CCTGGTGCCCCAGGGCCAGGGCT 0: 1
1: 1
2: 6
3: 67
4: 636
Right 1151668291 17:75558000-75558022 CCCACCCTAGGCTCCATGCATGG 0: 1
1: 0
2: 0
3: 18
4: 164
1151668282_1151668293 14 Left 1151668282 17:75557964-75557986 CCTGGTGCCCCAGGGCCAGGGCT 0: 1
1: 1
2: 6
3: 67
4: 636
Right 1151668293 17:75558001-75558023 CCACCCTAGGCTCCATGCATGGG 0: 1
1: 0
2: 1
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151668282 Original CRISPR AGCCCTGGCCCTGGGGCACC AGG (reversed) Intronic