ID: 1151668284

View in Genome Browser
Species Human (GRCh38)
Location 17:75557972-75557994
Sequence GACACAGCAGCCCTGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 7, 3: 53, 4: 406}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151668284_1151668302 27 Left 1151668284 17:75557972-75557994 CCCAGGGCCAGGGCTGCTGTGTC 0: 1
1: 0
2: 7
3: 53
4: 406
Right 1151668302 17:75558022-75558044 GGTCCTGCTGCCTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 251
1151668284_1151668299 22 Left 1151668284 17:75557972-75557994 CCCAGGGCCAGGGCTGCTGTGTC 0: 1
1: 0
2: 7
3: 53
4: 406
Right 1151668299 17:75558017-75558039 GCATGGGTCCTGCTGCCTCGGGG 0: 1
1: 0
2: 0
3: 17
4: 158
1151668284_1151668293 6 Left 1151668284 17:75557972-75557994 CCCAGGGCCAGGGCTGCTGTGTC 0: 1
1: 0
2: 7
3: 53
4: 406
Right 1151668293 17:75558001-75558023 CCACCCTAGGCTCCATGCATGGG 0: 1
1: 0
2: 1
3: 6
4: 97
1151668284_1151668301 26 Left 1151668284 17:75557972-75557994 CCCAGGGCCAGGGCTGCTGTGTC 0: 1
1: 0
2: 7
3: 53
4: 406
Right 1151668301 17:75558021-75558043 GGGTCCTGCTGCCTCGGGGGAGG 0: 1
1: 0
2: 4
3: 48
4: 557
1151668284_1151668291 5 Left 1151668284 17:75557972-75557994 CCCAGGGCCAGGGCTGCTGTGTC 0: 1
1: 0
2: 7
3: 53
4: 406
Right 1151668291 17:75558000-75558022 CCCACCCTAGGCTCCATGCATGG 0: 1
1: 0
2: 0
3: 18
4: 164
1151668284_1151668287 -7 Left 1151668284 17:75557972-75557994 CCCAGGGCCAGGGCTGCTGTGTC 0: 1
1: 0
2: 7
3: 53
4: 406
Right 1151668287 17:75557988-75558010 CTGTGTCTCCTCCCCACCCTAGG 0: 1
1: 0
2: 7
3: 46
4: 451
1151668284_1151668298 21 Left 1151668284 17:75557972-75557994 CCCAGGGCCAGGGCTGCTGTGTC 0: 1
1: 0
2: 7
3: 53
4: 406
Right 1151668298 17:75558016-75558038 TGCATGGGTCCTGCTGCCTCGGG 0: 1
1: 0
2: 0
3: 35
4: 252
1151668284_1151668300 23 Left 1151668284 17:75557972-75557994 CCCAGGGCCAGGGCTGCTGTGTC 0: 1
1: 0
2: 7
3: 53
4: 406
Right 1151668300 17:75558018-75558040 CATGGGTCCTGCTGCCTCGGGGG 0: 1
1: 0
2: 0
3: 24
4: 179
1151668284_1151668297 20 Left 1151668284 17:75557972-75557994 CCCAGGGCCAGGGCTGCTGTGTC 0: 1
1: 0
2: 7
3: 53
4: 406
Right 1151668297 17:75558015-75558037 ATGCATGGGTCCTGCTGCCTCGG 0: 1
1: 0
2: 1
3: 21
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151668284 Original CRISPR GACACAGCAGCCCTGGCCCT GGG (reversed) Intronic