ID: 1151668287

View in Genome Browser
Species Human (GRCh38)
Location 17:75557988-75558010
Sequence CTGTGTCTCCTCCCCACCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 7, 3: 46, 4: 451}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151668275_1151668287 21 Left 1151668275 17:75557944-75557966 CCCAGGGATCAGGTCACTGGCCT 0: 1
1: 0
2: 2
3: 11
4: 161
Right 1151668287 17:75557988-75558010 CTGTGTCTCCTCCCCACCCTAGG 0: 1
1: 0
2: 7
3: 46
4: 451
1151668284_1151668287 -7 Left 1151668284 17:75557972-75557994 CCCAGGGCCAGGGCTGCTGTGTC 0: 1
1: 0
2: 7
3: 53
4: 406
Right 1151668287 17:75557988-75558010 CTGTGTCTCCTCCCCACCCTAGG 0: 1
1: 0
2: 7
3: 46
4: 451
1151668276_1151668287 20 Left 1151668276 17:75557945-75557967 CCAGGGATCAGGTCACTGGCCTG 0: 1
1: 0
2: 2
3: 23
4: 408
Right 1151668287 17:75557988-75558010 CTGTGTCTCCTCCCCACCCTAGG 0: 1
1: 0
2: 7
3: 46
4: 451
1151668285_1151668287 -8 Left 1151668285 17:75557973-75557995 CCAGGGCCAGGGCTGCTGTGTCT 0: 1
1: 0
2: 9
3: 57
4: 468
Right 1151668287 17:75557988-75558010 CTGTGTCTCCTCCCCACCCTAGG 0: 1
1: 0
2: 7
3: 46
4: 451
1151668283_1151668287 -6 Left 1151668283 17:75557971-75557993 CCCCAGGGCCAGGGCTGCTGTGT 0: 1
1: 0
2: 1
3: 54
4: 531
Right 1151668287 17:75557988-75558010 CTGTGTCTCCTCCCCACCCTAGG 0: 1
1: 0
2: 7
3: 46
4: 451
1151668282_1151668287 1 Left 1151668282 17:75557964-75557986 CCTGGTGCCCCAGGGCCAGGGCT 0: 1
1: 1
2: 6
3: 67
4: 636
Right 1151668287 17:75557988-75558010 CTGTGTCTCCTCCCCACCCTAGG 0: 1
1: 0
2: 7
3: 46
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151668287 Original CRISPR CTGTGTCTCCTCCCCACCCT AGG Intronic