ID: 1151668289

View in Genome Browser
Species Human (GRCh38)
Location 17:75557999-75558021
Sequence CATGCATGGAGCCTAGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151668289_1151668298 -6 Left 1151668289 17:75557999-75558021 CCCCACCCTAGGCTCCATGCATG 0: 1
1: 0
2: 1
3: 14
4: 203
Right 1151668298 17:75558016-75558038 TGCATGGGTCCTGCTGCCTCGGG 0: 1
1: 0
2: 0
3: 35
4: 252
1151668289_1151668300 -4 Left 1151668289 17:75557999-75558021 CCCCACCCTAGGCTCCATGCATG 0: 1
1: 0
2: 1
3: 14
4: 203
Right 1151668300 17:75558018-75558040 CATGGGTCCTGCTGCCTCGGGGG 0: 1
1: 0
2: 0
3: 24
4: 179
1151668289_1151668299 -5 Left 1151668289 17:75557999-75558021 CCCCACCCTAGGCTCCATGCATG 0: 1
1: 0
2: 1
3: 14
4: 203
Right 1151668299 17:75558017-75558039 GCATGGGTCCTGCTGCCTCGGGG 0: 1
1: 0
2: 0
3: 17
4: 158
1151668289_1151668302 0 Left 1151668289 17:75557999-75558021 CCCCACCCTAGGCTCCATGCATG 0: 1
1: 0
2: 1
3: 14
4: 203
Right 1151668302 17:75558022-75558044 GGTCCTGCTGCCTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 251
1151668289_1151668297 -7 Left 1151668289 17:75557999-75558021 CCCCACCCTAGGCTCCATGCATG 0: 1
1: 0
2: 1
3: 14
4: 203
Right 1151668297 17:75558015-75558037 ATGCATGGGTCCTGCTGCCTCGG 0: 1
1: 0
2: 1
3: 21
4: 193
1151668289_1151668301 -1 Left 1151668289 17:75557999-75558021 CCCCACCCTAGGCTCCATGCATG 0: 1
1: 0
2: 1
3: 14
4: 203
Right 1151668301 17:75558021-75558043 GGGTCCTGCTGCCTCGGGGGAGG 0: 1
1: 0
2: 4
3: 48
4: 557

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151668289 Original CRISPR CATGCATGGAGCCTAGGGTG GGG (reversed) Intronic