ID: 1151668293

View in Genome Browser
Species Human (GRCh38)
Location 17:75558001-75558023
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151668282_1151668293 14 Left 1151668282 17:75557964-75557986 CCTGGTGCCCCAGGGCCAGGGCT 0: 1
1: 1
2: 6
3: 67
4: 636
Right 1151668293 17:75558001-75558023 CCACCCTAGGCTCCATGCATGGG 0: 1
1: 0
2: 1
3: 6
4: 97
1151668283_1151668293 7 Left 1151668283 17:75557971-75557993 CCCCAGGGCCAGGGCTGCTGTGT 0: 1
1: 0
2: 1
3: 54
4: 531
Right 1151668293 17:75558001-75558023 CCACCCTAGGCTCCATGCATGGG 0: 1
1: 0
2: 1
3: 6
4: 97
1151668286_1151668293 -1 Left 1151668286 17:75557979-75558001 CCAGGGCTGCTGTGTCTCCTCCC 0: 1
1: 0
2: 3
3: 64
4: 558
Right 1151668293 17:75558001-75558023 CCACCCTAGGCTCCATGCATGGG 0: 1
1: 0
2: 1
3: 6
4: 97
1151668285_1151668293 5 Left 1151668285 17:75557973-75557995 CCAGGGCCAGGGCTGCTGTGTCT 0: 1
1: 0
2: 9
3: 57
4: 468
Right 1151668293 17:75558001-75558023 CCACCCTAGGCTCCATGCATGGG 0: 1
1: 0
2: 1
3: 6
4: 97
1151668284_1151668293 6 Left 1151668284 17:75557972-75557994 CCCAGGGCCAGGGCTGCTGTGTC 0: 1
1: 0
2: 7
3: 53
4: 406
Right 1151668293 17:75558001-75558023 CCACCCTAGGCTCCATGCATGGG 0: 1
1: 0
2: 1
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type