ID: 1151668295

View in Genome Browser
Species Human (GRCh38)
Location 17:75558005-75558027
Sequence AGGACCCATGCATGGAGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151668295_1151668302 -6 Left 1151668295 17:75558005-75558027 CCTAGGCTCCATGCATGGGTCCT 0: 1
1: 0
2: 0
3: 25
4: 183
Right 1151668302 17:75558022-75558044 GGTCCTGCTGCCTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 251
1151668295_1151668300 -10 Left 1151668295 17:75558005-75558027 CCTAGGCTCCATGCATGGGTCCT 0: 1
1: 0
2: 0
3: 25
4: 183
Right 1151668300 17:75558018-75558040 CATGGGTCCTGCTGCCTCGGGGG 0: 1
1: 0
2: 0
3: 24
4: 179
1151668295_1151668309 29 Left 1151668295 17:75558005-75558027 CCTAGGCTCCATGCATGGGTCCT 0: 1
1: 0
2: 0
3: 25
4: 183
Right 1151668309 17:75558057-75558079 GTGTTTGCATCATTGCACATGGG 0: 1
1: 0
2: 1
3: 13
4: 162
1151668295_1151668301 -7 Left 1151668295 17:75558005-75558027 CCTAGGCTCCATGCATGGGTCCT 0: 1
1: 0
2: 0
3: 25
4: 183
Right 1151668301 17:75558021-75558043 GGGTCCTGCTGCCTCGGGGGAGG 0: 1
1: 0
2: 4
3: 48
4: 557
1151668295_1151668308 28 Left 1151668295 17:75558005-75558027 CCTAGGCTCCATGCATGGGTCCT 0: 1
1: 0
2: 0
3: 25
4: 183
Right 1151668308 17:75558056-75558078 TGTGTTTGCATCATTGCACATGG 0: 1
1: 0
2: 2
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151668295 Original CRISPR AGGACCCATGCATGGAGCCT AGG (reversed) Intronic