ID: 1151668298

View in Genome Browser
Species Human (GRCh38)
Location 17:75558016-75558038
Sequence TGCATGGGTCCTGCTGCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 252}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151668290_1151668298 -7 Left 1151668290 17:75558000-75558022 CCCACCCTAGGCTCCATGCATGG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1151668298 17:75558016-75558038 TGCATGGGTCCTGCTGCCTCGGG 0: 1
1: 0
2: 0
3: 35
4: 252
1151668288_1151668298 -3 Left 1151668288 17:75557996-75558018 CCTCCCCACCCTAGGCTCCATGC 0: 1
1: 0
2: 4
3: 43
4: 357
Right 1151668298 17:75558016-75558038 TGCATGGGTCCTGCTGCCTCGGG 0: 1
1: 0
2: 0
3: 35
4: 252
1151668283_1151668298 22 Left 1151668283 17:75557971-75557993 CCCCAGGGCCAGGGCTGCTGTGT 0: 1
1: 0
2: 1
3: 54
4: 531
Right 1151668298 17:75558016-75558038 TGCATGGGTCCTGCTGCCTCGGG 0: 1
1: 0
2: 0
3: 35
4: 252
1151668282_1151668298 29 Left 1151668282 17:75557964-75557986 CCTGGTGCCCCAGGGCCAGGGCT 0: 1
1: 1
2: 6
3: 67
4: 636
Right 1151668298 17:75558016-75558038 TGCATGGGTCCTGCTGCCTCGGG 0: 1
1: 0
2: 0
3: 35
4: 252
1151668285_1151668298 20 Left 1151668285 17:75557973-75557995 CCAGGGCCAGGGCTGCTGTGTCT 0: 1
1: 0
2: 9
3: 57
4: 468
Right 1151668298 17:75558016-75558038 TGCATGGGTCCTGCTGCCTCGGG 0: 1
1: 0
2: 0
3: 35
4: 252
1151668284_1151668298 21 Left 1151668284 17:75557972-75557994 CCCAGGGCCAGGGCTGCTGTGTC 0: 1
1: 0
2: 7
3: 53
4: 406
Right 1151668298 17:75558016-75558038 TGCATGGGTCCTGCTGCCTCGGG 0: 1
1: 0
2: 0
3: 35
4: 252
1151668286_1151668298 14 Left 1151668286 17:75557979-75558001 CCAGGGCTGCTGTGTCTCCTCCC 0: 1
1: 0
2: 3
3: 64
4: 558
Right 1151668298 17:75558016-75558038 TGCATGGGTCCTGCTGCCTCGGG 0: 1
1: 0
2: 0
3: 35
4: 252
1151668289_1151668298 -6 Left 1151668289 17:75557999-75558021 CCCCACCCTAGGCTCCATGCATG 0: 1
1: 0
2: 1
3: 14
4: 203
Right 1151668298 17:75558016-75558038 TGCATGGGTCCTGCTGCCTCGGG 0: 1
1: 0
2: 0
3: 35
4: 252
1151668292_1151668298 -8 Left 1151668292 17:75558001-75558023 CCACCCTAGGCTCCATGCATGGG 0: 1
1: 0
2: 2
3: 4
4: 129
Right 1151668298 17:75558016-75558038 TGCATGGGTCCTGCTGCCTCGGG 0: 1
1: 0
2: 0
3: 35
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151668298 Original CRISPR TGCATGGGTCCTGCTGCCTC GGG Intronic