ID: 1151668302

View in Genome Browser
Species Human (GRCh38)
Location 17:75558022-75558044
Sequence GGTCCTGCTGCCTCGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 251}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151668295_1151668302 -6 Left 1151668295 17:75558005-75558027 CCTAGGCTCCATGCATGGGTCCT 0: 1
1: 0
2: 0
3: 25
4: 183
Right 1151668302 17:75558022-75558044 GGTCCTGCTGCCTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 251
1151668284_1151668302 27 Left 1151668284 17:75557972-75557994 CCCAGGGCCAGGGCTGCTGTGTC 0: 1
1: 0
2: 7
3: 53
4: 406
Right 1151668302 17:75558022-75558044 GGTCCTGCTGCCTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 251
1151668286_1151668302 20 Left 1151668286 17:75557979-75558001 CCAGGGCTGCTGTGTCTCCTCCC 0: 1
1: 0
2: 3
3: 64
4: 558
Right 1151668302 17:75558022-75558044 GGTCCTGCTGCCTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 251
1151668290_1151668302 -1 Left 1151668290 17:75558000-75558022 CCCACCCTAGGCTCCATGCATGG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1151668302 17:75558022-75558044 GGTCCTGCTGCCTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 251
1151668283_1151668302 28 Left 1151668283 17:75557971-75557993 CCCCAGGGCCAGGGCTGCTGTGT 0: 1
1: 0
2: 1
3: 54
4: 531
Right 1151668302 17:75558022-75558044 GGTCCTGCTGCCTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 251
1151668289_1151668302 0 Left 1151668289 17:75557999-75558021 CCCCACCCTAGGCTCCATGCATG 0: 1
1: 0
2: 1
3: 14
4: 203
Right 1151668302 17:75558022-75558044 GGTCCTGCTGCCTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 251
1151668285_1151668302 26 Left 1151668285 17:75557973-75557995 CCAGGGCCAGGGCTGCTGTGTCT 0: 1
1: 0
2: 9
3: 57
4: 468
Right 1151668302 17:75558022-75558044 GGTCCTGCTGCCTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 251
1151668288_1151668302 3 Left 1151668288 17:75557996-75558018 CCTCCCCACCCTAGGCTCCATGC 0: 1
1: 0
2: 4
3: 43
4: 357
Right 1151668302 17:75558022-75558044 GGTCCTGCTGCCTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 251
1151668294_1151668302 -5 Left 1151668294 17:75558004-75558026 CCCTAGGCTCCATGCATGGGTCC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1151668302 17:75558022-75558044 GGTCCTGCTGCCTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 251
1151668292_1151668302 -2 Left 1151668292 17:75558001-75558023 CCACCCTAGGCTCCATGCATGGG 0: 1
1: 0
2: 2
3: 4
4: 129
Right 1151668302 17:75558022-75558044 GGTCCTGCTGCCTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151668302 Original CRISPR GGTCCTGCTGCCTCGGGGGA GGG Intronic