ID: 1151675007

View in Genome Browser
Species Human (GRCh38)
Location 17:75592733-75592755
Sequence CTGAAGGCACTGCAGGGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 354}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151674993_1151675007 29 Left 1151674993 17:75592681-75592703 CCAGGCCTGCAGGCTGCAAGGCA 0: 1
1: 0
2: 5
3: 44
4: 362
Right 1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG 0: 1
1: 0
2: 3
3: 32
4: 354
1151674995_1151675007 24 Left 1151674995 17:75592686-75592708 CCTGCAGGCTGCAAGGCAAGGAG 0: 1
1: 0
2: 2
3: 31
4: 403
Right 1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG 0: 1
1: 0
2: 3
3: 32
4: 354
1151675002_1151675007 -4 Left 1151675002 17:75592714-75592736 CCAGGACTTTGAGGGGCTGCTGA 0: 1
1: 1
2: 3
3: 43
4: 871
Right 1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG 0: 1
1: 0
2: 3
3: 32
4: 354
1151675001_1151675007 -3 Left 1151675001 17:75592713-75592735 CCCAGGACTTTGAGGGGCTGCTG 0: 1
1: 1
2: 11
3: 347
4: 8492
Right 1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG 0: 1
1: 0
2: 3
3: 32
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151675007 Original CRISPR CTGAAGGCACTGCAGGGGCT CGG Intergenic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
900963252 1:5939449-5939471 ATGTGGGCACTGCAGGGCCTGGG + Intronic
901028220 1:6290473-6290495 CTGAGGGCACAGCAGGGCCATGG - Intronic
901057853 1:6457142-6457164 CTTCAGGGCCTGCAGGGGCTGGG - Intronic
901703470 1:11057730-11057752 ATGAAGGCAAGACAGGGGCTGGG - Intronic
902138855 1:14334669-14334691 CTGAAGGCTGGGCTGGGGCTGGG + Intergenic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
902758047 1:18562264-18562286 CTGGATGGACTGGAGGGGCTGGG - Intergenic
903141881 1:21344202-21344224 CTCTGGGCACAGCAGGGGCTGGG + Intronic
903755677 1:25658845-25658867 TTGATGGAACTGCACGGGCTGGG - Intronic
904254658 1:29247241-29247263 CTAAATGCACTGCAGTGGCGCGG + Intronic
904431760 1:30468869-30468891 CAGAAGGCAGGGCAGGGGCTGGG + Intergenic
905188325 1:36213103-36213125 CTGATGGCAATGGAGGGCCTTGG + Intergenic
905277497 1:36828025-36828047 CTGAAAGGACTCCAGGAGCTGGG - Intronic
905500709 1:38434116-38434138 CATTAGGCAGTGCAGGGGCTGGG - Intergenic
905772962 1:40650068-40650090 CTCATGGCAGTGCAGGGGATGGG + Intronic
905885128 1:41487658-41487680 CTCAAGACACTGATGGGGCTGGG + Intergenic
906676077 1:47694466-47694488 CTGTGGGGGCTGCAGGGGCTGGG + Intergenic
910162371 1:84287626-84287648 CTGAGGGCACTGCAGGAGACCGG - Intergenic
910818197 1:91314903-91314925 CTGAAGGGACTGCAGTGACCAGG - Intronic
911192575 1:94962504-94962526 CTGAAGGTACTGCAGGAGCCAGG - Intergenic
914779699 1:150773999-150774021 CTGAGGCCAGTGCAGTGGCTTGG - Intergenic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
915488496 1:156238717-156238739 CTGAAGGCCCTGCTGCAGCTTGG + Intronic
915920938 1:159974619-159974641 CTGAAGCCCCTGCTGGGGATCGG - Intergenic
916456428 1:164975468-164975490 CTGAAAGCACCGCAAGGGCAGGG - Intergenic
917540041 1:175903131-175903153 CTATAGGAACTACAGGGGCTTGG + Intergenic
917792097 1:178505559-178505581 CTGAATCCACTGCAGGAGCCAGG - Intergenic
919895295 1:202005952-202005974 CTGCAGGCACTGCAGGGCAGCGG + Exonic
920125340 1:203689850-203689872 CTGAAGGCATTGCAGGGGAGGGG + Intronic
920199671 1:204251839-204251861 CTGGAGGCACTGCAGAGGCTGGG + Intronic
920682898 1:208086060-208086082 CTGAAGCCAGTGCAGGGGCAGGG - Intronic
920869629 1:209783405-209783427 CTGGAGGAGCTGAAGGGGCTTGG - Exonic
922766071 1:228157302-228157324 CTGATGGGGCTGCAGGGGCTTGG + Intronic
923107277 1:230864499-230864521 ATGAAGGCACTGGAGGGACACGG + Intronic
924553223 1:245097772-245097794 CTGAAGGAAATGAAGGGGCATGG + Intronic
924945836 1:248846495-248846517 CTGAAGTTACTGAAGGGGCTGGG - Intronic
1062918132 10:1257544-1257566 ATGAAGCTGCTGCAGGGGCTGGG + Intronic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1063885737 10:10576677-10576699 CTGAAGGAGGTGAAGGGGCTAGG - Intergenic
1064784956 10:18884179-18884201 CTGCAGGCATTGCAGAAGCTTGG - Intergenic
1067296392 10:44977432-44977454 CTGAGGACACTGCTGGGGCGGGG + Exonic
1067513949 10:46920700-46920722 CTGAGGCCACTGTGGGGGCTGGG + Intronic
1067648305 10:48131132-48131154 CTGAGGCCACTGTGGGGGCTGGG - Intergenic
1067713705 10:48671249-48671271 CTGAGGGCAGGGCAGGGGCAGGG + Intergenic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1069622450 10:69846264-69846286 CTGGTGGCACTGGAGGGGCTGGG + Intronic
1069957322 10:72060049-72060071 GAGAGGGCACTGGAGGGGCTGGG + Exonic
1072719436 10:97771669-97771691 GTCAAGGCACTGCGGCGGCTTGG + Exonic
1072766458 10:98098492-98098514 CTGACCGCACAGCAGGAGCTGGG - Intergenic
1072839074 10:98750458-98750480 CTGAAGAGACTGAAGGGGATGGG + Intronic
1073089694 10:100924699-100924721 CTGAAGGTGCTGCAGGGCTTGGG - Exonic
1073575053 10:104615789-104615811 CTGAAGGTAGTGCATGGGCTGGG - Intergenic
1073867340 10:107819948-107819970 ATGAAGGTACTTCAGGGGCAAGG - Intergenic
1074129297 10:110559088-110559110 CTGAAGGCACTGAAGTGAGTAGG - Intergenic
1074917606 10:117972348-117972370 CTGCAGGGACTGCAGGCCCTGGG + Intergenic
1076632321 10:131858483-131858505 CTGAAGTCACTCCAGGCCCTTGG - Intergenic
1077250533 11:1558768-1558790 CTGAAGGCAGTGGATGAGCTGGG - Intronic
1077478655 11:2802883-2802905 CTGTAGGGTCTGCTGGGGCTGGG - Intronic
1077564167 11:3285918-3285940 CTGAAGGCTCAGCAGGGGAAGGG - Intergenic
1077570057 11:3331735-3331757 CTGAAGGCTCAGCAGGGGAAGGG - Intergenic
1077661135 11:4069541-4069563 CTGAAGTCACTGTAGGAACTAGG - Intronic
1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG + Intronic
1078201255 11:9185520-9185542 AAGAAAACACTGCAGGGGCTAGG + Intronic
1078436850 11:11332501-11332523 CTCAAGGGACTGGAGGGGTTTGG + Intronic
1080489973 11:32751638-32751660 ATGTGGCCACTGCAGGGGCTGGG + Intronic
1081659077 11:44876981-44877003 CTGCAGGCTCTGCAGGGGCCTGG - Intronic
1082068025 11:47916577-47916599 CTGAAGGCACTGCAGGCTGCAGG + Intergenic
1082115954 11:48328330-48328352 CTGAGGGCACTGCAGGAGACCGG + Intronic
1083501829 11:63115882-63115904 CTGAAGTCTTTGTAGGGGCTTGG + Intronic
1083633927 11:64109866-64109888 CGGAAGGCACAGCAGGAGCAGGG + Intronic
1084605482 11:70169475-70169497 CTGGAGGCGCTGCCAGGGCTGGG - Intronic
1088013482 11:105032477-105032499 CTGAAAGCAATGTAGAGGCTAGG - Intronic
1089146748 11:116335038-116335060 CTGTAGGCTCTGCTGGGGCGAGG - Intergenic
1089955149 11:122563780-122563802 GTGATGGGACTGCAGAGGCTGGG - Intergenic
1090398622 11:126434814-126434836 CACAAGCCACAGCAGGGGCTGGG + Intronic
1090609972 11:128462342-128462364 GTGATGGCACTGAAGGGGCTGGG - Exonic
1091310886 11:134574487-134574509 CTGAAGGCACAGCACTGGCTGGG + Intergenic
1091817997 12:3454135-3454157 GTGAAGAGACAGCAGGGGCTAGG - Intronic
1091843826 12:3639316-3639338 CTGTAGGCAGTGCAGGGAATCGG + Intronic
1097040505 12:56153407-56153429 CAGAAGGGAGTGGAGGGGCTGGG + Intronic
1097188985 12:57210562-57210584 CTGGAGGCGAGGCAGGGGCTGGG - Intronic
1099038361 12:77618143-77618165 CTGAAGGCTCAACTGGGGCTGGG - Intergenic
1099268015 12:80472192-80472214 CTGAAACCAGTGCAGGGACTGGG + Exonic
1101598998 12:106192312-106192334 CTGAAGGGAGTTGAGGGGCTTGG + Intergenic
1103732547 12:123037411-123037433 AGGAAGGCACAGCAGGTGCTTGG + Intronic
1103806298 12:123576120-123576142 CTGAAGGCTCGACTGGGGCTGGG + Intergenic
1104013867 12:124949836-124949858 CTGAAGGCTCTGCAGAGCCACGG - Intronic
1104206803 12:126646919-126646941 CTCCAGGCATTGCAGGGACTTGG - Intergenic
1104474882 12:129063174-129063196 CTGAAGACACTGCAGGTGCCAGG + Intergenic
1104664923 12:130641240-130641262 CTGACCGCACTGCAAGGGCCAGG + Intronic
1104947627 12:132423623-132423645 CTGCAGGCGGAGCAGGGGCTGGG + Intergenic
1106192614 13:27466847-27466869 CTGAAAGCACAGCAAAGGCTGGG - Intergenic
1106758172 13:32842943-32842965 CTGAAGGCTCAGCTGGGGTTGGG - Intergenic
1109914226 13:68959483-68959505 CTCCAGGCAATGCAGGGGCAGGG - Intergenic
1110089614 13:71429590-71429612 ATGAAGGCATTTCAGGGGCCTGG + Intergenic
1112671433 13:101643720-101643742 CTGGATCCACTGTAGGGGCTGGG + Intronic
1113729151 13:112627209-112627231 GTGATGGCACAGCAGGGGTTGGG + Intergenic
1113920406 13:113905049-113905071 CTGAAGGGCCTGCTGGGGCTCGG - Intergenic
1114266986 14:21078424-21078446 CTGACGGCACTGCAGAGGGATGG + Exonic
1118763719 14:68896150-68896172 CTGAAGGTAATGTAGGAGCTGGG - Intronic
1119777689 14:77258793-77258815 CGGCAGGGGCTGCAGGGGCTGGG - Exonic
1121183519 14:91947401-91947423 CTGAGGGCTCTGCAGTGGCTGGG - Exonic
1121786081 14:96662166-96662188 CAGAAGGCCCTTCTGGGGCTGGG + Intergenic
1122012335 14:98760510-98760532 CAGAAAGGAATGCAGGGGCTGGG - Intergenic
1122454336 14:101838549-101838571 CTGAAGGTAAAGGAGGGGCTGGG - Intronic
1122781856 14:104147117-104147139 CTCAGTGCACTGCAGGGGCCTGG - Intronic
1122812829 14:104297462-104297484 CTGAAGGCAAAGCAGGGGTGGGG - Intergenic
1122842126 14:104471118-104471140 GGGCAAGCACTGCAGGGGCTGGG - Intergenic
1122882778 14:104697464-104697486 CTGTCTGCACCGCAGGGGCTAGG + Intronic
1123661897 15:22571880-22571902 CTTCCTGCACTGCAGGGGCTGGG - Intergenic
1123884684 15:24713977-24713999 CTGAGGGTTCTGCAGGGGCAAGG + Intergenic
1124092650 15:26620971-26620993 CTGAAGCCACTGCAGTGTCAGGG + Intronic
1124262313 15:28203665-28203687 CTTCCTGCACTGCAGGGGCTGGG + Intronic
1124315696 15:28666123-28666145 CTTCCTGCACTGCAGGGGCTGGG - Intergenic
1125341247 15:38677692-38677714 ATCAAGACACTGAAGGGGCTGGG - Intergenic
1125726351 15:41870193-41870215 CTGAGGGGGCTGCAGGGGCCTGG + Intronic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1128731663 15:70025539-70025561 CTGGAGGCACCGAAGGGACTGGG + Intergenic
1129571022 15:76683734-76683756 CAGAAGACACTGTAGGGGGTGGG + Intronic
1129787855 15:78321180-78321202 CTGAGACCACTGCAGGAGCTGGG - Intergenic
1131252177 15:90838066-90838088 CCCAAGGCTCTGCAGGGGCAGGG - Intergenic
1132573807 16:655769-655791 CTGATGGCAATGCCGGGGCCTGG - Exonic
1132904132 16:2273543-2273565 GTGATGGCAGTGGAGGGGCTTGG + Intergenic
1132914772 16:2338016-2338038 CTGAAGCCACGGCAAGGGTTAGG - Intronic
1133025153 16:2985964-2985986 GTGGCGGCATTGCAGGGGCTGGG + Intergenic
1133820383 16:9231175-9231197 CTGACAGCCCTTCAGGGGCTTGG + Intergenic
1135085875 16:19474111-19474133 CTTCAGGAACTGCAGGGGATGGG - Exonic
1136361450 16:29782626-29782648 CTGAAGTCACTGGATAGGCTGGG - Exonic
1136405884 16:30046632-30046654 CTGAGGGCACAGCAGGTGATTGG + Intronic
1136429080 16:30186575-30186597 CTAAAGGCACAGCAGGGCCTTGG - Intronic
1136461087 16:30410546-30410568 TTGAAGGCTTTGCAGGGGTTTGG + Intronic
1137269457 16:46893873-46893895 CTGAGGGCAGGGCAGGGGCGAGG + Intronic
1137426456 16:48385005-48385027 CTGAAGGCAGGGGAGGGGCGGGG + Intronic
1138550201 16:57743691-57743713 CTGGAGGCACTGCGAGGCCTGGG - Intronic
1139923869 16:70475129-70475151 CTGAAGGGAAGGAAGGGGCTGGG + Intronic
1140214382 16:72995616-72995638 CTTAAGCCTCTGCAGGAGCTTGG - Intronic
1140503820 16:75457196-75457218 CTCAAGGCACTGCTGGAGCCTGG + Intronic
1140676458 16:77336812-77336834 ATCAAAGCACTGCAGGGGTTGGG - Intronic
1141618855 16:85225915-85225937 CTGAAGGCTCTGCTGGGGCTGGG + Intergenic
1142103802 16:88291272-88291294 CAGCAGGGACTCCAGGGGCTCGG + Intergenic
1142155871 16:88532708-88532730 CGGTAGGCACCGCAGGGGCCGGG + Exonic
1143033953 17:3983822-3983844 CTGAAGTCACTGCAGGAGGTCGG + Intergenic
1143903393 17:10191272-10191294 CAGAAGGCAGTGAAGAGGCTGGG + Intronic
1144886848 17:18468967-18468989 GAGCAGGAACTGCAGGGGCTGGG - Intergenic
1145145367 17:20475329-20475351 GAGCAGGAACTGCAGGGGCTGGG + Intergenic
1145269678 17:21398040-21398062 CTGCAGCCACTGCCAGGGCTGGG + Intronic
1145776107 17:27530163-27530185 CTAAAGACCCAGCAGGGGCTGGG + Intronic
1145994631 17:29098286-29098308 CTGGGGGACCTGCAGGGGCTGGG + Intronic
1146353583 17:32116064-32116086 GAGCAGGAACTGCAGGGGCTGGG - Intergenic
1146638835 17:34525427-34525449 CTAAAGGCAGGGCAGAGGCTGGG + Intergenic
1147191550 17:38740851-38740873 CTGAAGGCAGAGAAGGGTCTTGG - Intronic
1147343570 17:39771174-39771196 CTGAAGTCACTGCTGGTGGTGGG - Intronic
1147880390 17:43649797-43649819 GTGAGGGCTATGCAGGGGCTGGG - Intronic
1149568983 17:57658926-57658948 GTGGGGGCACTGCAGGGTCTAGG + Intronic
1150287481 17:63962209-63962231 GGGAGGCCACTGCAGGGGCTTGG + Intronic
1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG + Intergenic
1152316376 17:79583014-79583036 TTGAGGGCACTGCAGGGGACAGG + Intergenic
1152392913 17:80013381-80013403 CCGGAGGGGCTGCAGGGGCTGGG - Exonic
1152423547 17:80206852-80206874 CTGAGGGCAGGGCAGGAGCTGGG - Intronic
1152552747 17:81038042-81038064 CTGGGGGCACTGCGTGGGCTGGG + Intronic
1152587653 17:81196195-81196217 CTGACATCACTGCAGGGGGTGGG - Intronic
1152727628 17:81955622-81955644 GTGGGGGCACTGCAGGGGCCTGG - Intronic
1153771875 18:8423222-8423244 CGGAGGGCCCTGCAGGGGCAAGG - Intergenic
1153953782 18:10078801-10078823 CCAAAGGCACTGCTGTGGCTAGG - Intergenic
1154983053 18:21520234-21520256 CTTAAGACAGTGCATGGGCTGGG - Intronic
1157342492 18:46791789-46791811 CTGGAGGTTCTGCAGGGGTTGGG - Intergenic
1157905225 18:51563698-51563720 CAGGAGGCACTGGAGAGGCTGGG - Intergenic
1158572940 18:58612113-58612135 CTGCAGACACTGCAGGGGAATGG + Intronic
1160372950 18:78389919-78389941 CTGCAGGCACAGCAGGTGCAGGG - Intergenic
1160544183 18:79641927-79641949 CTGGAGGCCCTGCAGGGTCTCGG - Intergenic
1160764462 19:801246-801268 GTGAAGGCAGTGGAGGCGCTAGG + Intronic
1160803776 19:982621-982643 CTGGAGGCACAGCAGGTCCTTGG + Intergenic
1160855543 19:1215552-1215574 CTGCAGGCTGTGCTGGGGCTGGG - Intronic
1163125271 19:15241068-15241090 CAGAAGACACTGCAGCTGCTTGG + Intronic
1163432669 19:17277573-17277595 GTGAAGGCCCAGCAGGGCCTGGG - Intronic
1163633262 19:18427538-18427560 CTGAGGGCTCTGCAGGGTCCAGG + Intronic
1164090531 19:21947858-21947880 CTCAAGGTACTCCAGTGGCTGGG - Intronic
1164109680 19:22144473-22144495 CTCAAGGTACTCCAGTGGCTGGG - Intergenic
1164972916 19:32547797-32547819 CTGAAGGCCCATCTGGGGCTGGG - Intergenic
1165049857 19:33134553-33134575 CTGCAGGGGCGGCAGGGGCTGGG + Intronic
1165121390 19:33561109-33561131 CTGAAGGAGCTGGAGGGGCCTGG + Intergenic
1165327997 19:35125323-35125345 CTGGAGCCACTGCAGGAGCTGGG - Exonic
1165508892 19:36254609-36254631 CTGAAGGAAGTGCTTGGGCTAGG - Intergenic
1165588245 19:36941214-36941236 CTGATGGAACTCCAGGGGCGTGG + Intronic
1165936728 19:39393792-39393814 CTGAAAGCTCTGCAAGGGCAAGG - Intronic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1166531299 19:43545106-43545128 CTGATGCCACTTTAGGGGCTTGG + Intronic
1166732715 19:45067929-45067951 CTGAGGGCAGTGCTGAGGCTGGG + Intronic
1167125472 19:47545634-47545656 CTGAAGCCCCCGCCGGGGCTGGG + Exonic
1167276551 19:48543562-48543584 CTGAAGCCACTGCAGGGAAGGGG + Intergenic
1168240270 19:55085725-55085747 CTGGGGGCACAGCAGGGGCCGGG - Intronic
1168567205 19:57435239-57435261 CAGAAGACACTGCGGGGGCAGGG + Intronic
927249549 2:20985304-20985326 CTAGGGGAACTGCAGGGGCTCGG + Intergenic
927491909 2:23526431-23526453 CAGAGGGCTCTGCAGGGGCCGGG + Intronic
928403250 2:30994355-30994377 CAGACAGCAGTGCAGGGGCTTGG + Intronic
928614633 2:33024913-33024935 CTGAAGGCTCGACTGGGGCTGGG + Intronic
930065202 2:47322591-47322613 GTGAAGGCACTGACGGGGTTTGG + Intergenic
930216044 2:48698633-48698655 CTAAAAGCACAGCAGTGGCTGGG + Exonic
932375633 2:71233233-71233255 CTGAAGGCACTGCAGTAGACCGG + Intergenic
933687957 2:85158129-85158151 CAGAAGGCGGGGCAGGGGCTAGG + Intronic
935308899 2:101763085-101763107 CCGAGGTCACAGCAGGGGCTAGG - Intronic
935445272 2:103149725-103149747 CAGAAGGCACTGCCTGGGCAAGG - Intergenic
937252419 2:120533362-120533384 ATGAAGGCCCTGTGGGGGCTGGG + Intergenic
938548880 2:132361291-132361313 AGGAAGGCACTGCAGGATCTGGG + Intergenic
939839082 2:147165210-147165232 TATAAGGCACTGCATGGGCTTGG + Intergenic
946292465 2:218755615-218755637 GTAAAGGGACTACAGGGGCTGGG - Intergenic
1168855361 20:1003944-1003966 TTGAAGGCATGGCAGGGGCAGGG + Intergenic
1169275022 20:4227900-4227922 AGAAAGGCACTGCAGGGGCCAGG - Intronic
1170558028 20:17531187-17531209 CTGGCGGCGCTGCAGGGGCTCGG - Exonic
1170614560 20:17938310-17938332 CTGAAGGCAGGGAAGAGGCTGGG + Intergenic
1170945190 20:20885212-20885234 CTTAGGGCACCCCAGGGGCTGGG - Intergenic
1171142845 20:22758060-22758082 GTTAAGGCCCTGCAGGGGTTTGG + Intergenic
1171327701 20:24310300-24310322 CTCAAGGCACTGCAGATGGTTGG - Intergenic
1172227811 20:33316929-33316951 CTGAAGGCAGAGTAGGTGCTGGG - Intergenic
1172696803 20:36828564-36828586 GTGAAGTCAGTGCAGGGGCTGGG - Intronic
1172838180 20:37886396-37886418 CTGAGGGCACTGCAGGGCAGGGG - Intergenic
1172846945 20:37935235-37935257 CTGCAGGAATTGCAGGGGCTGGG - Intronic
1173670583 20:44796090-44796112 GTGAAGGCACGGCAGGGGAGGGG - Intronic
1173805936 20:45925433-45925455 CTGGAGGGATGGCAGGGGCTGGG - Intergenic
1173833775 20:46111589-46111611 CTGGAGACAGTGCAGGGGGTGGG + Intergenic
1176064489 20:63187607-63187629 CTGGAGAGACTGCAGAGGCTGGG - Intergenic
1176209712 20:63913167-63913189 GGGAAGACACAGCAGGGGCTGGG - Intronic
1176247328 20:64103654-64103676 CTGAAGGCTGGGCAGGGGCTGGG - Intergenic
1177651927 21:23968761-23968783 GTGCAGGTACTCCAGGGGCTGGG - Intergenic
1177854681 21:26387466-26387488 CTGTAGCCACTGCAGAGGATGGG + Intergenic
1177971801 21:27799159-27799181 ATAAGGGCACTGCTGGGGCTAGG + Intergenic
1178367962 21:32003182-32003204 CTGAAGTTCCTGCAGGGACTAGG + Exonic
1179251532 21:39675013-39675035 CTGACGGGGCTGAAGGGGCTGGG - Intergenic
1180013029 21:45063976-45063998 CTCAAGCTACTGCAGAGGCTGGG + Intergenic
1180099462 21:45577806-45577828 CTGAAGGACCTGGAGGAGCTTGG + Intergenic
1180180529 21:46116862-46116884 CTGGGGGCCCTGCAGAGGCTGGG - Intronic
1180181664 21:46120968-46120990 CTGTGGACACTGCAGGGCCTCGG - Intronic
1181629897 22:24145255-24145277 CTGAATGCACTGGAGGGGCTGGG + Intronic
1182325747 22:29511389-29511411 CTGATGCCTCTGCAGGGGCTGGG + Intronic
1182854504 22:33505269-33505291 CTGTAGCCTCTGCAGAGGCTGGG + Intronic
1183172820 22:36200484-36200506 CGGCAGCCACAGCAGGGGCTAGG - Intronic
1183177375 22:36234008-36234030 CGGCAGCCACAGCAGGGGCTGGG - Intronic
1183235135 22:36611168-36611190 GTCAAGGGACTGCGGGGGCTGGG + Intronic
1183499180 22:38168226-38168248 CTGGAGACACTGGAGGTGCTTGG + Intronic
1183538175 22:38415200-38415222 CTGGGGGCACTGCAGGTGCGAGG + Intergenic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184463009 22:44650347-44650369 TTTAAAGCACTGCAGGGGGTGGG + Intergenic
1184645909 22:45895464-45895486 CTGTGGCCTCTGCAGGGGCTAGG - Intergenic
1185273130 22:49937700-49937722 CTTAGGTCTCTGCAGGGGCTGGG - Intergenic
1185376986 22:50487211-50487233 CTGAGGCCAGGGCAGGGGCTGGG + Intronic
950113964 3:10438608-10438630 CTGAAACCACAGCAGGGGCCTGG + Intronic
950631476 3:14284868-14284890 CTGGAGGCACTGGGAGGGCTTGG + Intergenic
952193873 3:31052125-31052147 GTGAAGGCAGAGAAGGGGCTAGG + Intergenic
952707343 3:36392660-36392682 CTGAAAGCTCTGCAGGGGCCGGG - Intronic
953472176 3:43176948-43176970 TTGGAGGCACTGCATGGGGTGGG + Intergenic
953862642 3:46558204-46558226 TAGAAGGCACTGGAGGGGCAAGG - Intronic
954467552 3:50665280-50665302 CTGAAGGCTCTTCAGGGTCCAGG - Intergenic
954809380 3:53238694-53238716 CTGAGGGCACCACAGGAGCTCGG - Intronic
954976957 3:54705032-54705054 CAGATGACAGTGCAGGGGCTGGG - Intronic
955238567 3:57160997-57161019 CCCCAGGCACTGCAGGGGCTTGG + Intronic
956575512 3:70748433-70748455 CTGAAGACAATTCAGGAGCTTGG + Intergenic
959526923 3:107388032-107388054 CTGAAGTCCCTGCAGTGGGTGGG + Intergenic
960290939 3:115883518-115883540 CTGAATGCACTGGAAGGGATGGG + Intronic
961536749 3:127575442-127575464 CTCAACCTACTGCAGGGGCTGGG - Exonic
961621369 3:128227461-128227483 CTGAAGGTGCTGGAAGGGCTTGG - Intronic
961650014 3:128412647-128412669 CTGGAGGTGCAGCAGGGGCTGGG - Intergenic
962313458 3:134342440-134342462 CTGAAGTCAATGGAGGGGCGAGG - Intergenic
962686033 3:137848449-137848471 CTGAAGGCACTGTAGGATCAGGG - Intergenic
963125890 3:141815848-141815870 CTGAAGGCTCAGCTGAGGCTGGG - Intronic
966851018 3:184165037-184165059 GGGGAGGCACTGCAGGGCCTGGG - Intronic
967075315 3:185996577-185996599 CAAAAGGCACAACAGGGGCTAGG + Intergenic
967934529 3:194716319-194716341 TTGAAGGCACTGCAGGCTCGAGG + Intergenic
967973052 3:195013210-195013232 CCTGAGGCACTGCATGGGCTGGG - Intergenic
968186057 3:196634268-196634290 CTGAAGGCAGTGCGGGGGTGGGG - Intergenic
968405393 4:336441-336463 CTCATGGCGCTGCAGGGCCTGGG - Intergenic
968455665 4:698046-698068 CTGGAGACACTGCATGGACTTGG - Intergenic
968645922 4:1740468-1740490 CTGGAGGGACTGCAAGGGCCAGG - Intronic
969437653 4:7198036-7198058 CTGGAGGCACTGTGGGGGATGGG + Intronic
970170473 4:13284307-13284329 CTGTAGCCACCTCAGGGGCTTGG - Intergenic
970208430 4:13680531-13680553 CTGAAGGAGCTGCAGGACCTGGG + Intergenic
975405409 4:73982815-73982837 CTGAAGACACAGCAGGCACTGGG - Intergenic
976022502 4:80646134-80646156 CTGGAGGCACTGTTGTGGCTTGG - Intronic
977528563 4:98173472-98173494 GTAAAGGCTCTGCAGGAGCTTGG - Intergenic
979351669 4:119650703-119650725 CTGAAGCCAGAGCAGAGGCTTGG + Intergenic
979718170 4:123866683-123866705 CAGAAGGCACAGCAGGGGGCCGG - Intergenic
980732414 4:136840019-136840041 CAGACAGCACTGCAGGGGATGGG + Intergenic
983979589 4:173977822-173977844 CTGAAGGCTTGGCTGGGGCTGGG - Intergenic
984483082 4:180330599-180330621 CTAAAGGAACAGCATGGGCTGGG - Intergenic
984732222 4:183078719-183078741 CTGCAGGTACTGCAGGGGTCGGG - Intergenic
985130634 4:186735100-186735122 CTGAAGGTACAGCTAGGGCTGGG - Intergenic
985188676 4:187346801-187346823 CTGAAGCCCCTGCAGGGCTTTGG - Intergenic
988558669 5:32260712-32260734 GTGAAGGCACTGCAGGGCGGGGG + Intronic
990969168 5:61484193-61484215 CTGAAGGCATTTCAGCTGCTTGG - Intronic
992715871 5:79510870-79510892 CTGAAGCCTCTGTAGGGGCCTGG - Intronic
993705705 5:91167558-91167580 CTGAGTCCACTGCAGGGGCCAGG - Intergenic
996517900 5:124394009-124394031 CTGAGGGCAGTCCAGGTGCTGGG - Intergenic
997931049 5:138071593-138071615 ATGAATGCACTGCAGAGGCAGGG - Intergenic
997956904 5:138285954-138285976 CTGAAGGCTTTGCAGGCCCTGGG + Intronic
998007816 5:138668709-138668731 CTGAAGGCACGGGAGGGGCCGGG - Intronic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
999481288 5:151950446-151950468 CCCAAGGCCATGCAGGGGCTGGG + Intergenic
1000028003 5:157376829-157376851 CTGCAGACTCTGCAGGGCCTAGG + Intronic
1000196212 5:158960904-158960926 CTGAAGGCTCGACCGGGGCTGGG - Intronic
1001301197 5:170535071-170535093 CAGTGGGCACAGCAGGGGCTGGG + Intronic
1001311808 5:170616513-170616535 AGGAAGGCCTTGCAGGGGCTGGG + Intronic
1002459514 5:179366086-179366108 CTGAAGGAATTCCAGAGGCTGGG - Intergenic
1002603918 5:180370844-180370866 CTGCAGGCAGGGCAGGGGCCAGG + Intergenic
1003690735 6:8351375-8351397 CTGGAGGTACTGCAGGGACACGG + Intergenic
1004015546 6:11728674-11728696 TTGAAAGCTCTGCAGGGGCAGGG + Intronic
1004185530 6:13418201-13418223 CCGAAGCCACTGCAGGGGACAGG + Intronic
1004555524 6:16693694-16693716 CTGAAGGTACTTCAGAGTCTTGG - Intronic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1005875237 6:30006360-30006382 CCGAAGGCGGTGCATGGGCTGGG + Intergenic
1006394425 6:33777882-33777904 CAGGAGGCACAGCAGGGGCTTGG - Intronic
1006402318 6:33825015-33825037 CTGCAGGCACTGCTGGGTTTGGG + Intergenic
1006573055 6:35021277-35021299 CTGAAGGCTCTGAAGGTGCTTGG + Intronic
1007257007 6:40536526-40536548 GTGAAGGGACTGAAGGGCCTGGG + Intronic
1007511135 6:42375125-42375147 CAGAAGGCCCTGCCTGGGCTGGG - Intronic
1007598347 6:43065816-43065838 CTGGAGACAGGGCAGGGGCTGGG + Intronic
1008150782 6:47949103-47949125 ATGAAGATAATGCAGGGGCTAGG + Intronic
1010003759 6:70973541-70973563 CTGAAGGCATTGCCTGGGCCAGG + Intergenic
1011588947 6:88952239-88952261 CTGTAGCCACTGTAGGGGATGGG - Intronic
1011930276 6:92701934-92701956 CTGCAGAGCCTGCAGGGGCTGGG - Intergenic
1013423274 6:109986250-109986272 TTGAAGGCATTGAAGGGGGTGGG + Intergenic
1013471310 6:110468862-110468884 CGGCAGCCAGTGCAGGGGCTGGG - Intronic
1016997944 6:149974227-149974249 CTGAAGGGGCACCAGGGGCTTGG + Intergenic
1017925085 6:158904127-158904149 CTGAAGCCACTGCTGTGCCTAGG + Intronic
1018952368 6:168387511-168387533 CTGAAGGAACCGCAGGGGATGGG + Intergenic
1019563917 7:1670482-1670504 CTGGGGGCGCAGCAGGGGCTGGG - Intergenic
1019572494 7:1719542-1719564 GGGAGGGCACTGCGGGGGCTGGG - Intronic
1019709465 7:2511681-2511703 CTGAAGACAAGGCTGGGGCTGGG - Intergenic
1022101314 7:27170497-27170519 CTAAAGTAATTGCAGGGGCTCGG + Intronic
1022417791 7:30192767-30192789 CTGAAGGATCAGCAGGAGCTGGG + Intergenic
1022488384 7:30797978-30798000 CTGGAGGCACTGAAGGACCTGGG + Intronic
1024619726 7:51147052-51147074 CAGAAGGCACTGCAGAGGGGAGG + Intronic
1025251342 7:57353444-57353466 CTGAAGGCAGTGCTGGAACTGGG - Intergenic
1026035542 7:66827913-66827935 TGGGTGGCACTGCAGGGGCTGGG - Intergenic
1032330982 7:130979226-130979248 TTGAAGCCACAGCAGGGGCAAGG + Intergenic
1032720561 7:134547754-134547776 CTGAAGGGACAGCACAGGCTGGG - Intergenic
1033814137 7:145051757-145051779 GAAAAGGCACTGAAGGGGCTAGG - Intergenic
1034959936 7:155358842-155358864 CCGAGGGCAGCGCAGGGGCTGGG - Intronic
1035472016 7:159116367-159116389 CAGAGGGCACTGCAGTGGGTTGG + Intronic
1035740848 8:1927296-1927318 CTGTAGGCAGGACAGGGGCTTGG + Intronic
1036811264 8:11868557-11868579 CAGAAGCCGCTGCAGAGGCTGGG + Intronic
1040441415 8:47447023-47447045 CTGAAGTCACTGAAGAGGGTTGG - Intronic
1040513086 8:48112677-48112699 CTGAAGTCACTGCCTGGGCAAGG - Intergenic
1040734600 8:50490655-50490677 TTGGAGGAACTGCAGGGGCAGGG + Intronic
1042449013 8:68922886-68922908 CTAGAGGTACTGCATGGGCTTGG + Intergenic
1044693509 8:94900813-94900835 CAGAGGGGACTGCAGGGGCGGGG + Intronic
1045801633 8:106108857-106108879 CAGAAGGCACAGCTGGGTCTGGG + Intergenic
1047044124 8:121032701-121032723 CTGAAGGCAGTGCAAGGGAGAGG + Intergenic
1047290463 8:123525036-123525058 ATCAAGGCCCAGCAGGGGCTTGG + Intronic
1048491516 8:134897991-134898013 CTGAAGGCATGGCAGAGGATAGG - Intergenic
1048866489 8:138765266-138765288 CTGGAGGGACTGCGGGGCCTGGG + Intronic
1049145616 8:140999868-140999890 CTGAAGGCAGTGCAAGAGTTTGG - Intronic
1049178740 8:141209526-141209548 ATGAGGGGACCGCAGGGGCTGGG - Intronic
1049201266 8:141341701-141341723 CAGAGGGCACTGGAGGGGCCTGG + Intergenic
1049405104 8:142448889-142448911 CTGAAGGCTGTGCAGGTGCAAGG - Intergenic
1049479727 8:142816170-142816192 CTGTAGGCCCTGCAGGAGCAAGG - Intergenic
1051415344 9:16833834-16833856 CTGAAGGGAAGGAAGGGGCTAGG - Intronic
1055898574 9:81208597-81208619 CTGAAGGCAAAGCAGTGGTTAGG + Intergenic
1057061055 9:92004104-92004126 GTGAAGTCCCTGCAGGGACTTGG + Intergenic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1060891183 9:127189586-127189608 GTGAAGGCACTACAGGGTCAAGG + Intronic
1061061054 9:128250755-128250777 CTGGGGGCACGGCGGGGGCTCGG - Exonic
1062101350 9:134730273-134730295 CTGAAACCAGTGAAGGGGCTGGG + Exonic
1062312485 9:135946509-135946531 CTGAGGGCAAGGCAGGGGATTGG + Intronic
1062385699 9:136310695-136310717 CCGAGGGCGTTGCAGGGGCTGGG - Intergenic
1185705428 X:2263012-2263034 CTGAGGGTACTCCAGGGCCTGGG + Intronic
1185746586 X:2578219-2578241 CAGAAAGCACAGCAGGGGTTTGG + Intergenic
1185896277 X:3862033-3862055 CTTAAAGCGCAGCAGGGGCTGGG + Intergenic
1185901396 X:3900459-3900481 CTTAAAGCGCAGCAGGGGCTGGG + Intergenic
1186592482 X:10945702-10945724 CTGAATGCACTCCAGCGACTAGG - Intergenic
1190060302 X:47206508-47206530 CTGAAGGCAAGGCAAGGGCCTGG - Intronic
1190980865 X:55455740-55455762 CAGGAGGCTCTGCAGGGGATTGG + Intergenic
1190987832 X:55517440-55517462 CAGGAGGCTCTGCAGGGGATTGG - Intergenic
1191174148 X:57482018-57482040 CTGAAAGCACTGAGGAGGCTGGG - Intronic
1192098039 X:68234026-68234048 CTGAAGGCACTGCAAGTCCCAGG + Intronic
1192369722 X:70503428-70503450 CAGAAGGGAAAGCAGGGGCTGGG + Exonic
1194806130 X:98330388-98330410 CTGAAAGGCCTCCAGGGGCTTGG + Intergenic
1195254751 X:103080828-103080850 CTGAAGGCTCTGCAGGGAGTAGG + Intronic
1195469641 X:105218341-105218363 CTGAGGCCACTGCTGAGGCTTGG - Intronic
1197872469 X:131072900-131072922 CTGCAGGCACTGCCAGCGCTTGG - Intronic
1197942113 X:131801428-131801450 CTGAAGGCACTGTGGAGGCTGGG + Intergenic
1198506616 X:137307801-137307823 ACAAAGGCACTGCATGGGCTAGG - Intergenic
1198916272 X:141675900-141675922 GTGAAGGTAATGCAGGGGATCGG + Intronic
1199143277 X:144335673-144335695 CTGACTCCACTGCAGTGGCTAGG + Intergenic
1199606139 X:149581166-149581188 TTGAACACAGTGCAGGGGCTAGG - Intergenic
1199632982 X:149788202-149788224 TTGAACACAGTGCAGGGGCTAGG + Intergenic
1199952356 X:152716134-152716156 CTGAAGTAACCGCAGGGGCAGGG - Intronic
1199957327 X:152752314-152752336 CTGAAGTAACCGCAGGGGCAGGG + Intronic
1200061549 X:153486053-153486075 CTCAAGGGACTGCAGGTGCTGGG + Exonic