ID: 1151676528

View in Genome Browser
Species Human (GRCh38)
Location 17:75601631-75601653
Sequence CACCCACTCCTCTCCGCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151676528_1151676533 -3 Left 1151676528 17:75601631-75601653 CCGACAGCGGAGAGGAGTGGGTG No data
Right 1151676533 17:75601651-75601673 GTGTGGGGAGGCCCCTTGCAAGG No data
1151676528_1151676534 2 Left 1151676528 17:75601631-75601653 CCGACAGCGGAGAGGAGTGGGTG No data
Right 1151676534 17:75601656-75601678 GGGAGGCCCCTTGCAAGGCTTGG No data
1151676528_1151676538 27 Left 1151676528 17:75601631-75601653 CCGACAGCGGAGAGGAGTGGGTG No data
Right 1151676538 17:75601681-75601703 ACCTGTCCCTACCTGAGCCATGG No data
1151676528_1151676540 28 Left 1151676528 17:75601631-75601653 CCGACAGCGGAGAGGAGTGGGTG No data
Right 1151676540 17:75601682-75601704 CCTGTCCCTACCTGAGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151676528 Original CRISPR CACCCACTCCTCTCCGCTGT CGG (reversed) Intergenic
No off target data available for this crispr