ID: 1151676596

View in Genome Browser
Species Human (GRCh38)
Location 17:75601987-75602009
Sequence TGGTAGGCATAGAACTCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151676596_1151676611 24 Left 1151676596 17:75601987-75602009 CCTTCCGAGTTCTATGCCTACCA No data
Right 1151676611 17:75602034-75602056 AGGAGGAGAGGAACTGGGGGTGG No data
1151676596_1151676614 27 Left 1151676596 17:75601987-75602009 CCTTCCGAGTTCTATGCCTACCA No data
Right 1151676614 17:75602037-75602059 AGGAGAGGAACTGGGGGTGGGGG No data
1151676596_1151676613 26 Left 1151676596 17:75601987-75602009 CCTTCCGAGTTCTATGCCTACCA No data
Right 1151676613 17:75602036-75602058 GAGGAGAGGAACTGGGGGTGGGG No data
1151676596_1151676601 7 Left 1151676596 17:75601987-75602009 CCTTCCGAGTTCTATGCCTACCA No data
Right 1151676601 17:75602017-75602039 GCACGCGTGCCTACCCCAGGAGG No data
1151676596_1151676607 20 Left 1151676596 17:75601987-75602009 CCTTCCGAGTTCTATGCCTACCA No data
Right 1151676607 17:75602030-75602052 CCCCAGGAGGAGAGGAACTGGGG No data
1151676596_1151676605 19 Left 1151676596 17:75601987-75602009 CCTTCCGAGTTCTATGCCTACCA No data
Right 1151676605 17:75602029-75602051 ACCCCAGGAGGAGAGGAACTGGG No data
1151676596_1151676602 12 Left 1151676596 17:75601987-75602009 CCTTCCGAGTTCTATGCCTACCA No data
Right 1151676602 17:75602022-75602044 CGTGCCTACCCCAGGAGGAGAGG No data
1151676596_1151676612 25 Left 1151676596 17:75601987-75602009 CCTTCCGAGTTCTATGCCTACCA No data
Right 1151676612 17:75602035-75602057 GGAGGAGAGGAACTGGGGGTGGG No data
1151676596_1151676604 18 Left 1151676596 17:75601987-75602009 CCTTCCGAGTTCTATGCCTACCA No data
Right 1151676604 17:75602028-75602050 TACCCCAGGAGGAGAGGAACTGG No data
1151676596_1151676609 21 Left 1151676596 17:75601987-75602009 CCTTCCGAGTTCTATGCCTACCA No data
Right 1151676609 17:75602031-75602053 CCCAGGAGGAGAGGAACTGGGGG No data
1151676596_1151676600 4 Left 1151676596 17:75601987-75602009 CCTTCCGAGTTCTATGCCTACCA No data
Right 1151676600 17:75602014-75602036 GCTGCACGCGTGCCTACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151676596 Original CRISPR TGGTAGGCATAGAACTCGGA AGG (reversed) Intergenic
No off target data available for this crispr