ID: 1151677370

View in Genome Browser
Species Human (GRCh38)
Location 17:75605617-75605639
Sequence AGGGATACACACACCCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 238}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151677370_1151677375 1 Left 1151677370 17:75605617-75605639 CCAAGGTGGGTGTGTGTATCCCT 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1151677375 17:75605641-75605663 TGTGCAGAGGGCAGCATGAATGG No data
1151677370_1151677376 2 Left 1151677370 17:75605617-75605639 CCAAGGTGGGTGTGTGTATCCCT 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1151677376 17:75605642-75605664 GTGCAGAGGGCAGCATGAATGGG No data
1151677370_1151677379 22 Left 1151677370 17:75605617-75605639 CCAAGGTGGGTGTGTGTATCCCT 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1151677379 17:75605662-75605684 GGGAAAGGAGAGGTGCATTCTGG No data
1151677370_1151677377 7 Left 1151677370 17:75605617-75605639 CCAAGGTGGGTGTGTGTATCCCT 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1151677377 17:75605647-75605669 GAGGGCAGCATGAATGGGAAAGG No data
1151677370_1151677378 12 Left 1151677370 17:75605617-75605639 CCAAGGTGGGTGTGTGTATCCCT 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1151677378 17:75605652-75605674 CAGCATGAATGGGAAAGGAGAGG No data
1151677370_1151677380 23 Left 1151677370 17:75605617-75605639 CCAAGGTGGGTGTGTGTATCCCT 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1151677380 17:75605663-75605685 GGAAAGGAGAGGTGCATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151677370 Original CRISPR AGGGATACACACACCCACCT TGG (reversed) Intergenic
901849068 1:12003862-12003884 AGGGCTGCACACACGCACCCAGG - Intronic
904030171 1:27528569-27528591 ACGGACACACACACACCCCTTGG - Intergenic
904950295 1:34232612-34232634 TGGTATAAATACACCCACCTTGG + Intergenic
905110246 1:35589611-35589633 AGGGCCACACACACCTACCAGGG - Intronic
905347253 1:37319451-37319473 AGGGGCACACACACCCCCCCAGG - Intergenic
906541874 1:46592984-46593006 AGGGTGACACACAGCCACCAGGG + Intronic
909125707 1:71666457-71666479 AAACATACAAACACCCACCTTGG + Intronic
909273713 1:73657612-73657634 AGAGATACACACACACACACAGG + Intergenic
911266874 1:95753562-95753584 AAGCATACACACACCCAGCCAGG - Intergenic
914851360 1:151316542-151316564 AGGGAGACACATACACACATTGG + Intronic
915113268 1:153578400-153578422 GGGGCCCCACACACCCACCTGGG + Intergenic
915969970 1:160347845-160347867 AGTGATCCACCCACCCACTTCGG + Intronic
918812177 1:189136618-189136640 AGGAACACACACACACACATTGG - Intergenic
920774889 1:208926370-208926392 AGGTATACACACACACACGGTGG + Intergenic
921396906 1:214678157-214678179 AGGGCTCCACAAAGCCACCTGGG - Intergenic
924221576 1:241881263-241881285 AGTGATCTACCCACCCACCTTGG + Intronic
1064066961 10:12190559-12190581 AGGGACACACACATCCCCTTGGG + Intronic
1066164610 10:32772808-32772830 TGGCATACACACCCCCACCAGGG - Intronic
1066653229 10:37679094-37679116 AGGGATACACACAGCCAAGGAGG + Intergenic
1067538689 10:47136046-47136068 AGGGTTAAACACATGCACCTGGG - Intergenic
1068367447 10:56068795-56068817 AGGGATTCACACTACCATCTGGG + Intergenic
1072164893 10:92803729-92803751 AGTGATCCTCCCACCCACCTCGG + Intergenic
1073056292 10:100705060-100705082 AAAGATACACACACGCAGCTGGG + Intergenic
1073748352 10:106495404-106495426 AAGGATACATTCACCCACCATGG + Intergenic
1075488585 10:122847478-122847500 ATGGATACCCACTCCCACCCTGG + Intronic
1076492883 10:130875517-130875539 AGGGCCACACACACAAACCTGGG + Intergenic
1077455952 11:2680874-2680896 AAGGATACACACAATAACCTGGG - Intronic
1078033073 11:7773354-7773376 AGGCATTCACACATCCACCCAGG + Intergenic
1079538048 11:21539293-21539315 AGTGTAACACACACCCACTTGGG - Intronic
1079560168 11:21811716-21811738 AGGGAAACCCCTACCCACCTGGG + Intergenic
1080541478 11:33269949-33269971 AGGTATACACACACACACACAGG - Intronic
1080930006 11:36800029-36800051 AGGCATAGACACAGCAACCTGGG - Intergenic
1083437003 11:62649446-62649468 AGGCATCCACACACGCATCTGGG + Exonic
1085291783 11:75405526-75405548 ATGGATACACACTCCCACTTAGG - Intronic
1087308535 11:96513025-96513047 AGGGACACACACACACACAGAGG + Intergenic
1088041574 11:105390665-105390687 AGTGATACACACAACAACATAGG + Intergenic
1090378568 11:126308964-126308986 AGGGCCACCCCCACCCACCTGGG + Intronic
1091648045 12:2288626-2288648 AGGGAGGCACAGACCCACCACGG - Intronic
1091860137 12:3773929-3773951 ATGAATACAAACACCCACTTGGG + Intergenic
1096542570 12:52316289-52316311 ACAGATACACACACACACCTTGG + Intronic
1097011382 12:55955765-55955787 AGTGAGACACTCACCCGCCTTGG + Exonic
1101180245 12:102208752-102208774 ATGGACACACACACACGCCTAGG + Intergenic
1101400804 12:104385050-104385072 AGGGAACTACCCACCCACCTGGG - Intergenic
1101524058 12:105511578-105511600 AGGGATGCCCAGACTCACCTGGG - Intergenic
1102899609 12:116626217-116626239 AGCGATCCTCCCACCCACCTTGG + Intergenic
1103362992 12:120364696-120364718 AGACATAGACACACCTACCTTGG + Exonic
1107877520 13:44803822-44803844 AGAGATACACACAGGAACCTGGG - Intergenic
1109128350 13:58547361-58547383 AGGGGAAGACACACCCATCTTGG - Intergenic
1113667638 13:112151955-112151977 ATGGATACACCCACCCTGCTGGG + Intergenic
1114031753 14:18585267-18585289 AGGAACATAGACACCCACCTAGG + Intergenic
1114055977 14:18967301-18967323 GGGAAAACCCACACCCACCTGGG - Intergenic
1114106572 14:19434452-19434474 GGGAAAACCCACACCCACCTGGG + Intergenic
1114747286 14:25163317-25163339 AGGGGTATACACATCCACCATGG + Intergenic
1117521805 14:56558698-56558720 GGGGATACAGCCACACACCTAGG + Intronic
1117873441 14:60224518-60224540 GGGGATAAAAACACCTACCTTGG + Intergenic
1119761921 14:77157881-77157903 ACAGATACGCACACCCACGTGGG - Intronic
1123054993 14:105565414-105565436 AGAGAGACACACACACACATAGG - Intergenic
1123143498 14:106105923-106105945 TGGGATACACATCCACACCTGGG - Intergenic
1123913896 15:25000907-25000929 AGTGACCGACACACCCACCTCGG - Intergenic
1125306997 15:38328951-38328973 AGTGATCCACCCACCCACCTTGG + Intronic
1127341754 15:58052864-58052886 AGGTATACACACATCCACTTTGG - Intronic
1129702811 15:77777402-77777424 ATGGACACACACACACAACTGGG + Intronic
1130272059 15:82456907-82456929 AGGTATACATACACCCACTAGGG - Intergenic
1130464410 15:84184296-84184318 AGGTATACATACACCCACTAGGG - Intergenic
1130488276 15:84410526-84410548 AGGTATACATACACCCACTAGGG + Intergenic
1130499857 15:84489241-84489263 AGGTATACATACACCCACTAGGG + Intergenic
1130523343 15:84681839-84681861 AGTGATCCACCCACCCACCTTGG - Intronic
1130586702 15:85188929-85188951 AGGTATACATACACCCACTAGGG - Intergenic
1130819093 15:87473934-87473956 AGGGCTACACTTACCCATCTGGG + Intergenic
1131138313 15:89956204-89956226 AGAAATCCACACAGCCACCTTGG + Intergenic
1134627669 16:15734184-15734206 AGTGATACACACACATACTTGGG + Intronic
1134824183 16:17271460-17271482 AGGGAGACACACACACAGATAGG + Intronic
1135058715 16:19252864-19252886 AGGACTACACATAACCACCTAGG - Intronic
1137368012 16:47877538-47877560 AGGGGAACACACACCCACATTGG - Intergenic
1139597952 16:67968884-67968906 GGGGAAACACACTTCCACCTCGG + Intronic
1140577374 16:76186812-76186834 AGGGAAACCCACACCCACCATGG + Intergenic
1141154906 16:81590479-81590501 AGGGACACCCACATCCACTTGGG - Intronic
1141216406 16:82028509-82028531 AGAGATACACATACACATCTAGG + Intergenic
1141303119 16:82836513-82836535 TGGGATACATACACCCACTTTGG - Intronic
1142998044 17:3772883-3772905 AGGGAAAACCCCACCCACCTGGG - Intronic
1143434496 17:6913868-6913890 TGGGATACACACCCCCACCAGGG + Intronic
1143564615 17:7714116-7714138 ACGCACACACACACGCACCTCGG - Intergenic
1143738287 17:8930706-8930728 ATTGATACACACAACAACCTGGG + Intronic
1146432122 17:32807623-32807645 TGGGATACACACACACTTCTGGG + Intronic
1146770647 17:35565892-35565914 AGTGATCCACCCACCCACCTTGG - Intergenic
1146777533 17:35634956-35634978 AGAAACACACACACCCATCTTGG - Intronic
1147017065 17:37500543-37500565 AGGCAAACTCACACCTACCTGGG + Intronic
1149752613 17:59160504-59160526 AGTGATCCATCCACCCACCTTGG + Intronic
1150344840 17:64396718-64396740 GGTGATCCACCCACCCACCTTGG + Intronic
1151328839 17:73394922-73394944 AGGGATACCCCCGCCCCCCTTGG + Intronic
1151677370 17:75605617-75605639 AGGGATACACACACCCACCTTGG - Intergenic
1152934791 17:83129901-83129923 AGGGACTCACACACCCAGCACGG + Intergenic
1152945060 17:83193635-83193657 CAGGAGACACACACCCAGCTGGG + Intergenic
1154197993 18:12280029-12280051 AGGGACACACACGCCACCCTGGG - Intergenic
1155471254 18:26194954-26194976 AGAGATACATACACCCAACTCGG + Intergenic
1155513292 18:26598690-26598712 TGAGATACTCACACCCACTTAGG - Intronic
1155797693 18:30060398-30060420 AGGGATACACAGAGAAACCTCGG + Intergenic
1156682978 18:39613491-39613513 GAGGACACACACACCCACCCGGG - Intergenic
1157788895 18:50512361-50512383 ACATATACACACACACACCTAGG + Intergenic
1159702071 18:71641144-71641166 AGGGATACACATTCTCACTTTGG + Intergenic
1160458323 18:79018704-79018726 AGGGATACACAGAGACACATCGG - Intergenic
1160968241 19:1755910-1755932 AGGGAAAGAAACCCCCACCTAGG - Intronic
1160969808 19:1762556-1762578 TGGGATCCACACACCCGCCAAGG - Intronic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1163355949 19:16811055-16811077 AGGGTTTCACCCACCCACCTTGG + Intronic
1163843020 19:19622921-19622943 AGCGATCCACCTACCCACCTTGG - Intergenic
1165320205 19:35080366-35080388 AGGGATTCCCAGACCCACCTAGG + Intergenic
1166195598 19:41203633-41203655 AGCCATACGCATACCCACCTGGG - Exonic
1166415157 19:42589851-42589873 TGTGACACACACACCCACCGTGG - Intronic
925287301 2:2724184-2724206 AGGGATCCACACATCAACTTGGG + Intergenic
925585652 2:5461514-5461536 GGGGATCCACAAAGCCACCTGGG + Intergenic
926894711 2:17672492-17672514 ATGAATACATACACACACCTGGG + Intronic
928162791 2:28943977-28943999 TGGGATACACACAAGCACTTTGG - Intronic
928314227 2:30233130-30233152 ATGGGTCCAAACACCCACCTTGG - Intronic
928840431 2:35598899-35598921 AAGCATGCACACACCCATCTGGG - Intergenic
928947330 2:36783241-36783263 ATGGATATTCACACCCAGCTTGG - Intronic
930391583 2:50768271-50768293 AGGGATAAAGAGACACACCTTGG + Intronic
930901403 2:56511448-56511470 AAGTAAACACACACCAACCTGGG - Intergenic
932653139 2:73581689-73581711 AGGGACACACAACTCCACCTGGG - Intronic
932835393 2:75031188-75031210 ATGGCTCCACACAGCCACCTCGG + Intergenic
933131697 2:78681050-78681072 TGGGATACACACCCCCACCAGGG + Intergenic
933846756 2:86332950-86332972 AGGGCAACTCCCACCCACCTGGG - Intronic
933883098 2:86691033-86691055 AGGGATGCATACACCCACTTTGG + Intronic
935152890 2:100454191-100454213 ACACATACACACACACACCTTGG - Intergenic
935808229 2:106770078-106770100 ACGGATTCACACACATACCTTGG - Intergenic
936839315 2:116751050-116751072 AAAGATACACACACTCACTTAGG + Intergenic
937553305 2:123122280-123122302 ACGCATACACACACACACCATGG + Intergenic
938474119 2:131591511-131591533 AGGAAAACCCACACCCACCCGGG - Intergenic
939451820 2:142384270-142384292 AGGAACACACACACACACATAGG + Intergenic
939792450 2:146595298-146595320 AGGGACACACATACACACATAGG + Intergenic
940366372 2:152852658-152852680 TGGGATACACACCCCCACCAGGG - Intergenic
940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG + Intergenic
941666030 2:168245536-168245558 AGGAATATTCACACTCACCTTGG + Intronic
941709589 2:168698056-168698078 AGTGATCCACCCACCCACCTCGG - Intronic
941929278 2:170924446-170924468 AAGGATACACACACCTGGCTGGG + Intergenic
942652503 2:178183366-178183388 AGCGATCCACCCACCCACCTTGG - Intergenic
942851159 2:180488444-180488466 ATGTATATACACACACACCTTGG - Intergenic
943446465 2:187993833-187993855 TGGGATACACACCCCCACTGGGG + Intergenic
944194985 2:197042962-197042984 AGCCATAGACACACCCACATTGG - Intronic
946750832 2:222894932-222894954 AAAGACACACACACACACCTGGG - Intronic
948555737 2:238809622-238809644 AGGGATCTGCCCACCCACCTTGG - Intergenic
948897741 2:240935106-240935128 TGGGAGACCCACAGCCACCTGGG - Intronic
949073224 2:242039226-242039248 AGGGACACACCCACCCACCCTGG - Intergenic
1168940993 20:1711515-1711537 GGGGATAGACACCCCCACCAGGG + Intergenic
1169462490 20:5807860-5807882 AATGATACATATACCCACCTGGG - Intronic
1171320464 20:24239387-24239409 AGGAATACATACACCTACATAGG - Intergenic
1172226246 20:33306983-33307005 AGGGCCACACCCACTCACCTTGG - Exonic
1172701669 20:36856992-36857014 AGGCTTACAGACACCCACCAAGG - Intronic
1173207670 20:41007389-41007411 AAGCATGCACACACCCAGCTGGG + Intergenic
1173617210 20:44411061-44411083 AGGGAGACAGACACCTGCCTTGG + Intronic
1174116680 20:48231073-48231095 AGGGCTGCCCACACACACCTGGG + Intergenic
1175670975 20:60902663-60902685 GGGGATACCCATACTCACCTGGG + Intergenic
1175945524 20:62556750-62556772 ATGGCCACACAAACCCACCTGGG - Intronic
1176388704 21:6152423-6152445 AGGGACACCCACACACACCACGG + Intergenic
1176388713 21:6152464-6152486 AGGGACACCCACACACACCAGGG + Intergenic
1176388727 21:6152524-6152546 AGGGACACACACACACACACCGG + Intergenic
1176388740 21:6152591-6152613 AGGGACCCACACACACACCAGGG + Intergenic
1176457761 21:6928589-6928611 AGGGAAACAGACACCCAGGTGGG - Intergenic
1176835933 21:13793673-13793695 AGGGAAACAGACACCCAGGTGGG - Intergenic
1179304273 21:40140845-40140867 AGGGACAGACACAGCAACCTTGG + Intronic
1179734732 21:43385657-43385679 AGGGACCCACACACACACCAGGG - Intergenic
1179734745 21:43385724-43385746 AGGGACACACACACACACACCGG - Intergenic
1179734759 21:43385784-43385806 AGGGACACCCACACACACCAGGG - Intergenic
1179734768 21:43385825-43385847 AGGGACACCCACACACACCACGG - Intergenic
1180455867 22:15512324-15512346 AGGAACATAGACACCCACCTAGG + Intergenic
1180474456 22:15689893-15689915 GGGAAAACCCACACCCACCTGGG - Intergenic
1180948809 22:19711347-19711369 GTGGATGCACACACCCACTTTGG + Intergenic
1181983403 22:26782312-26782334 ACGCACACACACACACACCTTGG - Intergenic
1182598622 22:31441939-31441961 TGGGAGAAAAACACCCACCTTGG - Exonic
1182704681 22:32269749-32269771 GGGGATTCACACACCCAGCTGGG - Intergenic
1182993927 22:34795479-34795501 AGACACACACACACCCACCATGG + Intergenic
1183486896 22:38092927-38092949 GGTGATCCACCCACCCACCTCGG - Intronic
1184458974 22:44626429-44626451 AAGGCAGCACACACCCACCTGGG + Intergenic
1184586844 22:45453637-45453659 AGTGATCCACCCACCCTCCTTGG - Intergenic
1184602749 22:45553145-45553167 AGGGATATCCACAAGCACCTGGG + Intronic
1185039218 22:48495865-48495887 AGGGATGGAGACTCCCACCTGGG - Intronic
1185222279 22:49635101-49635123 AGGGACACAGAATCCCACCTGGG + Intronic
950029940 3:9845726-9845748 AGGGATTCACCCACCTACTTCGG + Intronic
952592806 3:34977735-34977757 AGGTATACACACACACACCATGG - Intergenic
952946486 3:38481164-38481186 AGGGATTCTCACACCCATGTCGG + Intronic
954639513 3:52089648-52089670 AGGGCTGCACACGCCCTCCTGGG + Intronic
962116404 3:132513583-132513605 AGGGTTACAGACAGACACCTGGG + Intronic
968209290 3:196834636-196834658 GGTGATAGATACACCCACCTCGG - Intergenic
968802884 4:2755299-2755321 CAGCATACACACACCCCCCTCGG + Intronic
973536605 4:51888871-51888893 TGTGATCCACCCACCCACCTCGG - Intronic
974194115 4:58548987-58549009 AGGAATTCACACATCCACCAAGG + Intergenic
974431727 4:61806346-61806368 ACACATACACACACACACCTTGG - Intronic
974742557 4:66025032-66025054 AGGGAAAAACACACACACCGGGG + Intergenic
979737287 4:124103151-124103173 AGACACACACACACACACCTAGG - Intergenic
980935107 4:139218914-139218936 AAGCAAACACACACCAACCTGGG + Intergenic
981412925 4:144454203-144454225 AGGCATGCACACACACTCCTTGG - Intergenic
983823164 4:172222667-172222689 AATGATCTACACACCCACCTTGG + Intronic
984130906 4:175874966-175874988 CAGTATACACACACACACCTTGG - Intronic
991087485 5:62661285-62661307 ACTGTAACACACACCCACCTGGG + Intergenic
992024026 5:72653182-72653204 AGGGACACACACACACACAGAGG - Intergenic
994127735 5:96188018-96188040 AGTGAGCCACTCACCCACCTGGG + Intergenic
996643448 5:125786810-125786832 AGGAAAACACACACACACGTTGG + Intergenic
996846857 5:127909185-127909207 AGGGAGATACACACCCAGGTGGG + Intergenic
997579787 5:135010047-135010069 AAGGAGAGACACACCCACCAAGG - Intronic
999686743 5:154109989-154110011 AGGGAGACACTAGCCCACCTGGG + Intronic
1002826401 6:777964-777986 AGGGGAACACAGACTCACCTGGG + Intergenic
1002884668 6:1282841-1282863 AAGGCTGCACCCACCCACCTGGG + Intergenic
1003126817 6:3362460-3362482 AGGGATTGAAACACCCACCAAGG + Intronic
1003185625 6:3827898-3827920 AGGGATGCAGACCCCAACCTGGG - Intergenic
1005456380 6:26023656-26023678 AGGCATACCCACCACCACCTTGG + Intergenic
1006914442 6:37585331-37585353 GGGGACACACACACACACCTGGG - Intergenic
1008718693 6:54322066-54322088 AGTGATCCACCCACCCACCTTGG - Intronic
1012079240 6:94735472-94735494 TGGGATACACATCCCCACCCCGG + Intergenic
1016839956 6:148516299-148516321 TGAGCTACACACACACACCTGGG - Intronic
1017763007 6:157585593-157585615 AGGGCTTCACATACCAACCTTGG - Intronic
1018034880 6:159873525-159873547 ATGGTTACGGACACCCACCTGGG - Intergenic
1019340485 7:506742-506764 AAGGAAACACCCACCCAGCTAGG + Intronic
1019414494 7:921021-921043 TGGGGGACACACACACACCTGGG - Intronic
1021170632 7:17394396-17394418 AGGGATACACACACTCCAGTGGG + Intergenic
1022452920 7:30532590-30532612 AGGCATACACACACCACCTTTGG - Intronic
1022759973 7:33338096-33338118 AGGGATACACCCACAGACTTAGG + Intronic
1023490613 7:40736084-40736106 AGAGAGACACACACACACATAGG + Intronic
1023578086 7:41651340-41651362 ACATATACACACACACACCTTGG - Intergenic
1023870803 7:44262142-44262164 GGGCATCCACACACTCACCTGGG - Intronic
1023924497 7:44656165-44656187 AGGGACACACACACACATCAAGG - Intronic
1024012336 7:45279723-45279745 GGGGATAGACATGCCCACCTGGG - Intergenic
1024026169 7:45411765-45411787 ATACATACACACACTCACCTAGG - Intergenic
1024288409 7:47780722-47780744 ATTGATCCACACAGCCACCTGGG - Intronic
1024890889 7:54201718-54201740 AGGCATACACACACACACACAGG + Intergenic
1026780083 7:73260374-73260396 GGTGATCCACCCACCCACCTTGG + Intergenic
1027020938 7:74813792-74813814 GGTGATCCACCCACCCACCTTGG + Intronic
1027067088 7:75132132-75132154 GGTGATCCACCCACCCACCTTGG - Intronic
1027364106 7:77439694-77439716 AGGGATATAGACACCCAGCCAGG + Intergenic
1028712826 7:93929302-93929324 ATTGATACACACAACCAACTTGG - Intergenic
1031371596 7:120974268-120974290 AGGAATAGAAACACCCACGTAGG + Intronic
1031434360 7:121713852-121713874 ACGCATACACACACACAGCTAGG - Intergenic
1032393230 7:131570235-131570257 AGGTACACTCACTCCCACCTTGG - Intergenic
1035279712 7:157769969-157769991 TAGGATACACACCCCGACCTCGG + Intronic
1035866102 8:3083894-3083916 AGCAATCCACCCACCCACCTTGG + Intronic
1038346743 8:26740017-26740039 AGGCATACACACACCAAACATGG + Intergenic
1040408498 8:47132819-47132841 AGGGAAGCCCACGCCCACCTGGG + Intergenic
1042176033 8:66037524-66037546 AAGCATACACACACCCTCTTGGG - Intronic
1042484711 8:69337084-69337106 AGGGCCACACCCACCCACCCTGG - Intergenic
1042557085 8:70042741-70042763 AGGAATAGAGAGACCCACCTTGG + Intergenic
1045257134 8:100535713-100535735 ATGGATACACACAGCTACCCTGG - Intronic
1045328694 8:101136823-101136845 AGTGATACACACAATCACATGGG + Intergenic
1045707310 8:104940856-104940878 ACACATACACACACTCACCTAGG - Intronic
1047661359 8:127040466-127040488 AGGGATTCACCCAACCACCATGG - Intergenic
1048807825 8:138256965-138256987 AGGGATATACATACCCAGTTTGG + Intronic
1048829805 8:138465103-138465125 AGGGATACACAAACCAAGCCGGG + Intronic
1049637250 8:143695749-143695771 AGGGTCACACACAGCCCCCTCGG - Intronic
1049828465 8:144685301-144685323 GGGCACACTCACACCCACCTAGG + Intergenic
1056274478 9:84980592-84980614 AGGAATACAGACTCACACCTAGG - Intronic
1056754757 9:89374697-89374719 AGGCATACACACAAGCCCCTGGG - Intronic
1057518185 9:95738814-95738836 AGCAACACACACACACACCTTGG + Intergenic
1058275551 9:103037524-103037546 TGGGATACACACCCCCACCAGGG + Intergenic
1062606601 9:137351304-137351326 AGGGCTTCACTCACCCAGCTTGG + Exonic
1062622735 9:137429973-137429995 AGGGACACAGGCACCCCCCTGGG - Intronic
1188094095 X:26001782-26001804 GGGGATACACACTCCCACCAGGG + Intergenic
1190797533 X:53759216-53759238 AGGGCCACACACACCCAGATGGG + Intergenic
1195563385 X:106311700-106311722 ATGGTTACACACATCCACCCAGG + Intergenic
1196059826 X:111395963-111395985 AAGGAAAAACACACCTACCTTGG + Intronic
1196703502 X:118696847-118696869 AGGGGTACCCATACCTACCTGGG + Intergenic
1199738465 X:150708858-150708880 GGCGAACCACACACCCACCTTGG - Intronic
1199740296 X:150729320-150729342 ATGGCTACACACATACACCTTGG - Intronic
1200169399 X:154061332-154061354 AGACATTCACACACTCACCTAGG + Intronic
1200466847 Y:3529507-3529529 AGTGATACACACCTCCACCATGG - Intergenic
1202370809 Y:24194340-24194362 AGGTATACATACACCCACTAAGG + Intergenic
1202499975 Y:25475777-25475799 AGGTATACATACACCCACTAAGG - Intergenic