ID: 1151678103

View in Genome Browser
Species Human (GRCh38)
Location 17:75610244-75610266
Sequence GCGGCAGAGACTGCAGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 414}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151678097_1151678103 -5 Left 1151678097 17:75610226-75610248 CCAGCCCCTGCTCCAGAGGCGGC 0: 1
1: 1
2: 5
3: 60
4: 540
Right 1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG 0: 1
1: 0
2: 2
3: 30
4: 414
1151678092_1151678103 11 Left 1151678092 17:75610210-75610232 CCATCCTGCTGGTGGCCCAGCCC 0: 1
1: 0
2: 4
3: 76
4: 435
Right 1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG 0: 1
1: 0
2: 2
3: 30
4: 414
1151678093_1151678103 7 Left 1151678093 17:75610214-75610236 CCTGCTGGTGGCCCAGCCCCTGC 0: 1
1: 0
2: 7
3: 86
4: 678
Right 1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG 0: 1
1: 0
2: 2
3: 30
4: 414
1151678099_1151678103 -10 Left 1151678099 17:75610231-75610253 CCCTGCTCCAGAGGCGGCAGAGA 0: 1
1: 0
2: 2
3: 20
4: 213
Right 1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG 0: 1
1: 0
2: 2
3: 30
4: 414
1151678098_1151678103 -9 Left 1151678098 17:75610230-75610252 CCCCTGCTCCAGAGGCGGCAGAG 0: 1
1: 0
2: 3
3: 21
4: 262
Right 1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG 0: 1
1: 0
2: 2
3: 30
4: 414
1151678095_1151678103 -4 Left 1151678095 17:75610225-75610247 CCCAGCCCCTGCTCCAGAGGCGG 0: 1
1: 0
2: 1
3: 41
4: 328
Right 1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG 0: 1
1: 0
2: 2
3: 30
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151678103 Original CRISPR GCGGCAGAGACTGCAGGTGC AGG Intergenic
900237455 1:1599559-1599581 GCGGCAGCGGCTGCAGGCACAGG + Exonic
900287239 1:1907535-1907557 GAGGCTGGGCCTGCAGGTGCTGG + Intergenic
900409158 1:2505039-2505061 GCAGCAGAGACTGCAGGGCCTGG + Exonic
900703537 1:4062289-4062311 GCGGCAGAGACAGCGGGATCTGG + Intergenic
900708215 1:4093978-4094000 GAGGGAGAGACTGCAGGTCTTGG + Intergenic
900779129 1:4606145-4606167 GCAGCAGATACAGCAGGTACAGG - Intergenic
901817613 1:11803713-11803735 GGGGCAGAGACTGCAGGGGTTGG + Intronic
902150311 1:14437666-14437688 GCTGCAGCGACTGCAGCTCCTGG - Intergenic
902236572 1:15061406-15061428 GCGGCAGAGATTGCTGGCCCGGG + Intronic
902476495 1:16691313-16691335 GCTTCAGAGCCTGCAGGGGCTGG + Intergenic
903073741 1:20745002-20745024 GCAGCTGAGACTTTAGGTGCAGG + Exonic
903522285 1:23959796-23959818 TCGGCAGCGACTGCAGAAGCAGG - Exonic
903523545 1:23974119-23974141 GCAGCTGGGACTACAGGTGCAGG + Intronic
903969872 1:27111678-27111700 GTAGCTGGGACTGCAGGTGCTGG - Intronic
904136287 1:28315092-28315114 GCAGCTGGGACTGCAGGCGCCGG + Intergenic
905345089 1:37305978-37306000 GCGGCAGGGATGCCAGGTGCAGG - Intergenic
905642583 1:39601419-39601441 GTAGCTGGGACTGCAGGTGCCGG - Intergenic
906321422 1:44819655-44819677 GTGGCAGAGACTCCTGGGGCGGG - Intergenic
906500445 1:46338142-46338164 GTAGCTGAGACTACAGGTGCAGG - Intergenic
907052029 1:51336033-51336055 CTGGCAGAGACTGCAGGTGTTGG - Intronic
907281303 1:53349043-53349065 GAGGCAGAGAACGCAGCTGCAGG + Intergenic
908703898 1:66930283-66930305 GCGGCAGAGACGGCAGCGGCCGG + Intronic
909477403 1:76096032-76096054 CAGGCAGAGATTGCAGGAGCTGG + Intronic
912258383 1:108084374-108084396 GCCGCAGAGGCTGCTGGTGTTGG + Intergenic
912659329 1:111514431-111514453 GTAGCTGGGACTGCAGGTGCAGG - Intronic
913714363 1:121519229-121519251 GCGGCACTGGCTGCGGGTGCCGG + Intergenic
916600996 1:166293416-166293438 ATGGCAGAGCCTGCAGGTGAAGG - Intergenic
916750916 1:167722126-167722148 GCGGCGGCGACTGCAGTGGCTGG + Exonic
917970101 1:180200774-180200796 GGGGTAGAGACTGCAGCTCCAGG - Exonic
918781143 1:188702137-188702159 GAGGCATAGACTGCAGCTGCTGG - Intergenic
919767307 1:201135707-201135729 GCGGTGGAAGCTGCAGGTGCAGG - Exonic
919807185 1:201387054-201387076 GAGGCAGAGGCGGCAGGTGGTGG - Exonic
920228826 1:204456976-204456998 GGGGCAGAGACTGCAGTTTTCGG + Intronic
921138837 1:212286035-212286057 GCGGCGGAGACGGCAGGAGGAGG - Exonic
922412188 1:225387689-225387711 GCTGCAGAGGATACAGGTGCAGG + Intronic
922665584 1:227465906-227465928 GCGGCAGCGAGTGAAGGTGTAGG + Intergenic
922790070 1:228306397-228306419 GCTGCAGAGTCTGCAGGCGGAGG + Exonic
923229508 1:231971615-231971637 GCTGCAGACACTTTAGGTGCTGG + Intronic
923448523 1:234094799-234094821 GGGGCAGAGATGGCAGGTGATGG + Intronic
923674262 1:236065833-236065855 GCGGCAGAGAAGGGAGGTGGAGG + Intergenic
924168218 1:241307735-241307757 GTGTCAGATACTGCAGGTGCTGG - Intronic
924247548 1:242099536-242099558 GTGGCAGTGTCTGCAGGGGCGGG + Intronic
1062911769 10:1216349-1216371 GTGGCAGCGACTGGAGGTGCTGG + Intronic
1062934931 10:1378529-1378551 GAGGATGGGACTGCAGGTGCGGG + Intronic
1062934951 10:1378637-1378659 GAGGATGAGACTGCAGGTGTGGG + Intronic
1065164158 10:22957353-22957375 GCTACAGAGACTGCACTTGCGGG + Intronic
1065918031 10:30368432-30368454 GCAGGAGAGGCTGCAGGAGCTGG - Intronic
1066151561 10:32625731-32625753 GCTGCACAGGCTGCAGGTGGGGG - Intronic
1066367715 10:34793037-34793059 GCAGCAGGGACTGCAGGTGTGGG + Intronic
1067168648 10:43885630-43885652 GCCCCAGAGACTGTAGATGCAGG + Intergenic
1067344090 10:45425638-45425660 GCAGCTGAGTCTGCAGGTGAGGG - Intronic
1069205945 10:65685852-65685874 GAGGCAGAGACTGCAGCACCAGG - Intergenic
1069858196 10:71453350-71453372 TCTGCAGAGACTGCCGATGCGGG - Intronic
1070128534 10:73640892-73640914 GCGGGAGTGATTGCAGGAGCAGG - Intronic
1072756331 10:98023663-98023685 GAGGAAGAGACTGCCGGTGACGG + Intronic
1072802911 10:98405657-98405679 GAGGCTGAGACTGGAGCTGCTGG - Intronic
1073033710 10:100548351-100548373 GGGGCAGAGAGAGAAGGTGCTGG - Exonic
1073143094 10:101261801-101261823 CAGGCTGAGCCTGCAGGTGCTGG - Intergenic
1074917605 10:117972347-117972369 GCTGCAGGGACTGCAGGCCCTGG + Intergenic
1076589689 10:131574600-131574622 GAGGCAGAGAGTGCAGGTCAGGG + Intergenic
1076603882 10:131677073-131677095 TCGGCAGAGCCTGCATTTGCAGG - Intergenic
1076768413 10:132650249-132650271 GCGGCAGCCACCGCAGGAGCTGG - Intronic
1077050093 11:562701-562723 GCGGCAGAGTGCGGAGGTGCAGG + Exonic
1077165172 11:1131514-1131536 GAGGCAGAGCCAGGAGGTGCAGG + Intergenic
1077540187 11:3143011-3143033 GGGGCAGAGGAGGCAGGTGCGGG + Intronic
1077540247 11:3143211-3143233 GGGGCAGAGGAGGCAGGTGCGGG + Intronic
1078223789 11:9373875-9373897 GCAGCTGGGACTACAGGTGCCGG - Intergenic
1078455097 11:11468802-11468824 GTGGCAGATTCTACAGGTGCTGG + Intronic
1081686368 11:45046022-45046044 TGGGCTGAGACTGCAGGTGAAGG + Intergenic
1081751426 11:45513896-45513918 ATGGCAGAGCCTGCAGGTGACGG + Intergenic
1083766578 11:64844331-64844353 GCGGGAAAGTCTGCGGGTGCGGG + Intronic
1083797344 11:65024785-65024807 GCTGCAGAGAGTCCAGATGCAGG - Intronic
1083823056 11:65183252-65183274 GGGGCAGAGCCTGAAGGAGCGGG - Intronic
1084170594 11:67399134-67399156 GCTCCATAGACTGCAGGTCCGGG + Exonic
1084400586 11:68940711-68940733 GCGGCAGACTCTCCCGGTGCAGG + Intergenic
1084499359 11:69525658-69525680 GCAGCAGGATCTGCAGGTGCAGG - Intergenic
1085018304 11:73189599-73189621 GCAGCAAAGGCTGCAGGTGGGGG - Intergenic
1085075578 11:73588560-73588582 GTAGCTGAGACTTCAGGTGCAGG - Intronic
1085108174 11:73863910-73863932 GGGACAGAGACAGCATGTGCTGG + Intronic
1085157793 11:74311848-74311870 GCGGCGGAGACTGATGTTGCAGG - Intergenic
1085594238 11:77793353-77793375 GTAGCTGAGACTACAGGTGCAGG - Intronic
1086664054 11:89457531-89457553 GGGCCAGAGACTGCAGCTGAGGG + Intronic
1087292738 11:96338317-96338339 GCTGCAGAGTCTGCAGGAACAGG - Intronic
1088981766 11:114870821-114870843 CCGGCAGAAACAGCAGCTGCTGG - Intergenic
1089017879 11:115181829-115181851 GAGGCACAGCCCGCAGGTGCAGG - Intronic
1089294669 11:117460465-117460487 GAGGCAGAAAGTGCAGGAGCTGG + Intronic
1089618589 11:119709406-119709428 GGGGGAGAGCCTGCAGGGGCAGG + Intronic
1091221155 11:133930817-133930839 GGGGCAAAGGCTGCCGGTGCTGG + Intronic
1091720879 12:2812628-2812650 GAGGCAGAGATTGGAGGTTCAGG + Exonic
1092753781 12:11743927-11743949 GAGGCAAAGAATGCAGGTGAAGG + Intronic
1092858266 12:12695429-12695451 GAGGCAGACACTTCAGGTGTTGG + Intronic
1094821735 12:34231486-34231508 GTAGCTGAGACTACAGGTGCAGG - Intergenic
1095632829 12:44398312-44398334 GCAGCAGACACTGCTGGAGCTGG + Intergenic
1095945164 12:47749560-47749582 GCGGCAGGGGCGGCAGGGGCGGG - Intronic
1096621696 12:52869448-52869470 GCAGCAGAGACAGCAGGGGAGGG + Intergenic
1096708092 12:53435460-53435482 GCAGCTGGGACTACAGGTGCCGG - Intergenic
1098038763 12:66333737-66333759 GAGGAAGAGGGTGCAGGTGCTGG + Intronic
1099258229 12:80343009-80343031 GTAGCTGGGACTGCAGGTGCCGG + Intronic
1101441024 12:104704353-104704375 GCGGGGGAGGCTGCAGGTGAGGG + Intronic
1102057732 12:109909366-109909388 TAGACAGAGATTGCAGGTGCTGG - Intronic
1102221129 12:111195096-111195118 GGACCAGTGACTGCAGGTGCTGG - Intronic
1102280136 12:111612228-111612250 GTAGCTGGGACTGCAGGTGCAGG - Intergenic
1102871410 12:116417019-116417041 GTAGCTGGGACTGCAGGTGCAGG - Intergenic
1104780166 12:131414558-131414580 GGGGCGGAGCCTGCAGCTGCTGG - Intergenic
1104845620 12:131845325-131845347 GCTGCAGGGACACCAGGTGCCGG - Exonic
1106152548 13:27119884-27119906 GCAGCAGATTCTGCAGATGCAGG + Intronic
1106414414 13:29534526-29534548 TCAGCAGATACTGCAGCTGCTGG + Intronic
1107725827 13:43298369-43298391 GCTGCAGAAACTGCAGTTGCTGG + Exonic
1107854198 13:44598528-44598550 GCAGCTGGGACTGCAGGTGCGGG + Intergenic
1108043773 13:46363729-46363751 GCAGCTGGGACTACAGGTGCTGG - Intronic
1108236070 13:48406787-48406809 GCAGCTGGGACTACAGGTGCAGG - Intronic
1110471647 13:75866577-75866599 GCAGCTGAGACTACAGGCGCCGG + Intergenic
1110630148 13:77698081-77698103 GCGGCAGCAGCAGCAGGTGCGGG - Intronic
1111701125 13:91691140-91691162 GTGGCTGAGACTGCAGCTGTGGG + Intronic
1112563577 13:100533939-100533961 GCAGACGGGACTGCAGGTGCAGG + Intronic
1112567229 13:100561973-100561995 GCGGCAGAGTCTGCATGCCCCGG + Intronic
1113428960 13:110232654-110232676 GGGACAGAGGCTGCCGGTGCTGG + Intronic
1113657535 13:112077863-112077885 GCGGCAGGGGCTGCAGGGGCAGG - Intergenic
1113796643 13:113062004-113062026 GGGGCAGTAACTGCAGGTGCAGG + Intronic
1117791709 14:59348846-59348868 GCCGCAGAGGTTGCAGGGGCGGG - Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118173745 14:63416188-63416210 GTAGCTGAGACTGCAGGCGCAGG - Intronic
1118842594 14:69524307-69524329 GCAGCAGACACTGGAGGTGAGGG + Exonic
1119400253 14:74358137-74358159 GCAGCAGAGAGGGCTGGTGCCGG - Exonic
1119777690 14:77258794-77258816 CCGGCAGGGGCTGCAGGGGCTGG - Exonic
1120457106 14:84745863-84745885 GTAGCTGAGACTACAGGTGCAGG - Intergenic
1120925594 14:89794093-89794115 GAGGCAGAGTCTGAAGGTGCTGG + Intergenic
1120932890 14:89866484-89866506 GAGGGAGAACCTGCAGGTGCTGG - Intronic
1120955631 14:90079548-90079570 GCAGCAGAGCCTGCAACTGCTGG + Intronic
1122098470 14:99388537-99388559 GGGGCAGAGGAGGCAGGTGCTGG + Intergenic
1122786482 14:104166514-104166536 CCGGCAGCGGCTGCAGGTGGGGG + Intronic
1123030788 14:105450149-105450171 CGGGCAGAGACTCCAGCTGCCGG - Exonic
1123051741 14:105547347-105547369 GCTGCAGAGACTGGATGTGAAGG + Intergenic
1124370683 15:29103325-29103347 TGGGCAGAGCCTGCAGGCGCTGG - Intronic
1124829395 15:33133300-33133322 GTCGCAGAGGCTGTAGGTGCTGG - Intronic
1124890185 15:33725446-33725468 CCGCCAGAGACTGCCTGTGCAGG + Intronic
1128336946 15:66792917-66792939 GCTGCACTGTCTGCAGGTGCAGG + Intergenic
1129029756 15:72609670-72609692 GCAGGAGAGACTGCTGGAGCAGG + Intergenic
1129113950 15:73354522-73354544 GATGCTGAGACTGCTGGTGCAGG + Intronic
1129905303 15:79183073-79183095 GTGGCTGAGACTACAGGTGTAGG + Intergenic
1130951682 15:88596024-88596046 GTAGCTGGGACTGCAGGTGCAGG - Intergenic
1132071927 15:98786009-98786031 GAGGCAGAGTCTGCAGGGGAGGG - Intronic
1132589732 16:721421-721443 GCCGCTGCGGCTGCAGGTGCGGG + Exonic
1132771567 16:1566589-1566611 GCAGCTGGGATTGCAGGTGCGGG + Intronic
1133006474 16:2884251-2884273 GCGGCTGAGGATGCCGGTGCTGG + Intronic
1134048465 16:11119518-11119540 GTGGCTGAGACTACAGGTGTGGG + Intronic
1134114776 16:11539642-11539664 AGGGGAGAGAGTGCAGGTGCTGG - Intergenic
1134203391 16:12217321-12217343 GTGGCAGAAACAGCAGGTGTTGG - Intronic
1134310057 16:13067753-13067775 GCAGCAGGCACAGCAGGTGCAGG - Intronic
1135316590 16:21451577-21451599 GGTGAAGAGACTGGAGGTGCGGG - Intergenic
1135335141 16:21595388-21595410 GCAGCTGGGATTGCAGGTGCAGG + Intergenic
1135369513 16:21883822-21883844 GGTGAAGAGACTGGAGGTGCGGG - Intergenic
1135423934 16:22323014-22323036 CCGGCAGAGGCTCCAGGTGGAGG + Intronic
1135429840 16:22374123-22374145 GCGGCGGAGGATGCAGGTGCCGG - Intronic
1135442301 16:22487305-22487327 GGTGAAGAGACTGGAGGTGCGGG + Intronic
1136101966 16:28003327-28003349 GCAGCAGGGACTGCAGGGGACGG + Intronic
1136180598 16:28549078-28549100 GCAGCTGAGATTACAGGTGCGGG + Intergenic
1136326703 16:29532056-29532078 GGTGAAGAGACTGGAGGTGCGGG - Intergenic
1136410001 16:30070607-30070629 GGGGCAGAGCCTGCAGTGGCTGG - Intergenic
1136441393 16:30272040-30272062 GGTGAAGAGACTGGAGGTGCGGG - Intergenic
1136545278 16:30950873-30950895 ACGGCAGAATATGCAGGTGCAGG + Intronic
1136591254 16:31219106-31219128 ACAGCAGAAACTGCAGCTGCAGG + Exonic
1137988406 16:53130183-53130205 GCGCCGGCTACTGCAGGTGCTGG + Intronic
1138312692 16:56041700-56041722 CAGGCAGAGTCTGCAGGTGTTGG - Intergenic
1139288092 16:65833300-65833322 GTGGCTGGGACTACAGGTGCAGG - Intergenic
1140500831 16:75432419-75432441 GTAGCTGGGACTGCAGGTGCAGG - Intronic
1141386584 16:83627158-83627180 GTAGCTGAGACTACAGGTGCAGG - Intronic
1141531052 16:84647520-84647542 GCAGCTGAGACCACAGGTGCCGG - Intergenic
1141682583 16:85553243-85553265 GGGGCAGGGAGGGCAGGTGCCGG + Intergenic
1141768636 16:86075068-86075090 GAGGCAGAGGCTGAGGGTGCTGG + Intergenic
1141992398 16:87618032-87618054 GTGGCTGGGACTGCAGGCGCAGG - Intronic
1142105322 16:88299406-88299428 AGGGCAGAGGCTCCAGGTGCCGG + Intergenic
1143323038 17:6080430-6080452 TGGGCAGAGGCTGCAGCTGCAGG + Exonic
1144026226 17:11278394-11278416 GCTCCTGAGAGTGCAGGTGCAGG - Intronic
1144366173 17:14547065-14547087 GCAGTAGAGACTGAAGATGCAGG - Intergenic
1144508101 17:15850645-15850667 GCAGGAGAGACAGCAGCTGCTGG - Intergenic
1144858212 17:18282640-18282662 ACGGCTGACACCGCAGGTGCTGG + Intronic
1145172221 17:20668283-20668305 GCAGGAGAGACAGCAGCTGCTGG - Intergenic
1145963924 17:28903460-28903482 CTGGCAGAGACTACAGATGCAGG - Intergenic
1146357018 17:32142772-32142794 GCGACAGGGGCTGCAGGGGCAGG - Intronic
1146744555 17:35315870-35315892 GGGGTAGAGTCTGCATGTGCTGG - Intergenic
1146922640 17:36723493-36723515 GCCTCAGAGTCTGCAGGAGCAGG + Intergenic
1146943457 17:36859394-36859416 GTGGGAGAGGCTGCAGGTGGGGG - Intergenic
1147829854 17:43291742-43291764 GAGGCACAGACTGCCGCTGCGGG + Intergenic
1148054764 17:44787473-44787495 GGGGAAGAGCCTGAAGGTGCTGG - Intergenic
1149339369 17:55670069-55670091 GAGCCAGAGACTGCAGCAGCTGG - Intergenic
1150376099 17:64682984-64683006 GCGGGAGAGAGTGTAAGTGCAGG - Intergenic
1151580143 17:74972831-74972853 GCGGCGGGCGCTGCAGGTGCAGG - Intronic
1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG + Intergenic
1151745232 17:76008362-76008384 GCAGCAGACACTGCAGCTGCAGG - Exonic
1151747844 17:76021411-76021433 GCGGCAGGGGCGGCAGGGGCGGG - Intronic
1152101788 17:78305750-78305772 GGGACAGAGGCTGCAGGGGCTGG - Intergenic
1152196960 17:78924042-78924064 GCTGCAGAGGCTTGAGGTGCAGG + Intronic
1152259945 17:79261464-79261486 GAGGCAGAGGATGCAGGTGGAGG + Intronic
1152353380 17:79795376-79795398 GCGGCAGGTGCTGCTGGTGCTGG + Exonic
1152588137 17:81198183-81198205 GCTGCACACACTGCAGCTGCTGG - Exonic
1153027021 18:681310-681332 GCTGCAGAGCCTGCAGGTCCAGG - Intronic
1153669366 18:7395397-7395419 GTAGCTGAGACTACAGGTGCAGG - Intergenic
1153759404 18:8316206-8316228 CCAGTAGAGACTGCAGGAGCTGG - Intronic
1154107438 18:11534536-11534558 CCTGCAGAGACTGCAGGAGAAGG - Intergenic
1154449063 18:14459956-14459978 GTGGCAGAGACTGGCAGTGCTGG - Intergenic
1155319942 18:24609273-24609295 GGGGCAGAGCCTGCAGGAGATGG - Intergenic
1157333648 18:46721361-46721383 GCGGCAGTGACTCCAGCTCCAGG - Intronic
1158322237 18:56276255-56276277 AAGGCAGAGACCGCAGGTACTGG - Intergenic
1158588854 18:58762977-58762999 TCAGCATAGACTGCAGATGCTGG + Intergenic
1160662174 19:306268-306290 CCGGCGGAGGCTGCTGGTGCGGG + Exonic
1160750620 19:732563-732585 GCAGCTGAGATTACAGGTGCCGG - Intronic
1161124086 19:2546300-2546322 CCTGGAGAGGCTGCAGGTGCAGG - Intronic
1161288676 19:3481335-3481357 GTAGCTGAGACTACAGGTGCAGG - Intergenic
1161807591 19:6454043-6454065 GCAGGAGACACTGCATGTGCAGG - Exonic
1162556872 19:11392485-11392507 GTAGCTGAGACTACAGGTGCAGG + Intronic
1163105960 19:15123207-15123229 GCGGCAGTGACAGCAGGCCCTGG - Exonic
1163388669 19:17016071-17016093 GTGGCTGGGACTACAGGTGCAGG + Intronic
1163529102 19:17839370-17839392 GTGGCAGAAACTGCAGGTCAAGG - Intronic
1163635614 19:18435942-18435964 GCCGCAGGGCCTGCAGCTGCTGG - Intronic
1163651387 19:18520382-18520404 GTGGCAGCGACAGCAGCTGCTGG - Intronic
1164605341 19:29593916-29593938 GAGGCTGAGCCTGCCGGTGCTGG - Intergenic
1165289931 19:34874817-34874839 GCTGCAGAGTCTGCAGGCCCTGG + Intergenic
1165862381 19:38915984-38916006 GCGGCAGAGGCTGCGGGCGAGGG + Intronic
1167483796 19:49748373-49748395 CCTGCAGAGACTGCACGTGCTGG + Exonic
1202710514 1_KI270714v1_random:17154-17176 GCTTCAGAGCCTGCAGGGGCTGG + Intergenic
925059312 2:878831-878853 AGGGCAGAGACTGCAGTTGAGGG - Intergenic
925082114 2:1078559-1078581 CAGGGAGAGACTGCAGGTGCCGG + Intronic
925221453 2:2144581-2144603 ACGGCAGACACTTTAGGTGCTGG + Intronic
926142790 2:10378139-10378161 ACGGCAGAGAATTCAGATGCTGG - Intronic
926873183 2:17445952-17445974 GCAGCAAACACTGCAGCTGCAGG + Intergenic
928823620 2:35392163-35392185 GAAACAGAGACTGCAGGGGCAGG + Intergenic
928885492 2:36143609-36143631 TCTTCAGAGACTGGAGGTGCTGG + Intergenic
929518641 2:42627205-42627227 GTAGCTGGGACTGCAGGTGCTGG + Intronic
930720286 2:54631467-54631489 GCGGCAGCGGCTGCAGGCCCTGG + Exonic
930927293 2:56833836-56833858 GTAGCTGAGACTACAGGTGCTGG - Intergenic
934588599 2:95526961-95526983 GCTGCAGGCACTGCAGGGGCAGG - Intergenic
937066818 2:119023805-119023827 GCAGCTGGGACTGCAGGTGGTGG - Intergenic
937192811 2:120120985-120121007 GTGGCTGGGATTGCAGGTGCCGG - Intronic
937243587 2:120477981-120478003 GGGACAGAGGATGCAGGTGCTGG - Intergenic
938664565 2:133521162-133521184 ACAGCAGAGACTGCAGATCCAGG + Intronic
940805297 2:158180529-158180551 CAGGCAGAGACAGCAAGTGCAGG + Intronic
940903386 2:159147135-159147157 GAGGCAGAGAGAGCAGCTGCAGG - Intronic
941866976 2:170345062-170345084 GCAGCAGAGACTGGAAGAGCAGG - Intronic
944069931 2:195657337-195657359 GCGGCGGAGACTGCGAGTCCCGG + Intronic
945022277 2:205585547-205585569 GTGGCAGGGACTGTTGGTGCAGG + Intronic
946043846 2:216804626-216804648 GCTGCTGAGTCTGCAGGTTCTGG + Intergenic
946200997 2:218070746-218070768 ATGGCAGAGACGGCAGCTGCTGG - Exonic
946363744 2:219235797-219235819 GCAGCAGAGGCAGCAGGAGCAGG + Exonic
947588630 2:231371850-231371872 GCCCCAGAAACAGCAGGTGCTGG + Intronic
947985303 2:234442457-234442479 ACAGCAGAGACTGCAGGCCCAGG - Intergenic
948002130 2:234576914-234576936 GTTTCAGAGACTTCAGGTGCAGG + Intergenic
948477574 2:238230210-238230232 GTGGCTGGGACTACAGGTGCGGG + Intronic
948576674 2:238956137-238956159 GAGGCAGAGCCTGATGGTGCAGG - Intergenic
1169179404 20:3550196-3550218 GCAGCTGAGACTACAGGTGCCGG - Intronic
1171415504 20:24977526-24977548 GTGGCAGAGACAGCAGTGGCAGG + Intronic
1171523214 20:25791473-25791495 GAGGAAGAAACTGCAGGTGGAGG - Intronic
1171530957 20:25853453-25853475 GAGGAAGAAACTGCAGGTGGAGG - Intronic
1171553612 20:26064410-26064432 GAGGAAGAAACTGCAGGTGGAGG + Intergenic
1172681531 20:36719583-36719605 GCTCCAGAGGCTGCAGGTGAAGG + Intronic
1173020939 20:39267876-39267898 GGGTCAGAGACTGCAAGGGCAGG + Intergenic
1174614373 20:51824743-51824765 TAGGGAGAGACTGCAGGTGGAGG + Intergenic
1175215995 20:57391948-57391970 CCGGGAGAGGCGGCAGGTGCGGG - Intronic
1175503567 20:59466899-59466921 GCGGCTGGGGCTGCAGGGGCAGG + Intergenic
1175694495 20:61091262-61091284 AGGGCCGTGACTGCAGGTGCAGG - Intergenic
1175753524 20:61515186-61515208 GCAGCAGGGCCTGCCGGTGCTGG - Intronic
1175836734 20:62000853-62000875 GTGGCAGATGCAGCAGGTGCAGG - Intronic
1175976548 20:62713190-62713212 GAGGCTGAGCCTGCAGGAGCAGG - Intronic
1176145536 20:63563748-63563770 GCGGCAGATCCTGCTGGCGCTGG - Exonic
1176191917 20:63815502-63815524 GGTGCAGTGAGTGCAGGTGCAGG + Intronic
1176191951 20:63815679-63815701 GGTGCAGTGAGTGCAGGTGCAGG + Intronic
1176191976 20:63815840-63815862 GGTGCAGTGAGTGCAGGTGCAGG + Intronic
1178847202 21:36183695-36183717 CTGGCAGAGGCGGCAGGTGCTGG - Intronic
1179493571 21:41757145-41757167 GTCTCAGAGACTGCAGGTGCAGG + Intronic
1179823082 21:43948279-43948301 GAGGCAGTGTCTGAAGGTGCAGG - Intronic
1180108600 21:45637034-45637056 CCGGCACAGACTGCGGGTGCAGG - Intergenic
1180215819 21:46323473-46323495 GCGGCGGGGCCTGCAGGTCCAGG + Exonic
1180783550 22:18534861-18534883 TGGGCAGTGACTGGAGGTGCAGG - Intergenic
1180795308 22:18601067-18601089 GCGGGGTAGACTGCAGCTGCAGG - Intergenic
1181127117 22:20708912-20708934 TGGGCAGTGACTGGAGGTGCAGG - Intronic
1181226432 22:21394245-21394267 GCGGGGTAGACTGCAGCTGCAGG + Intergenic
1181240452 22:21474213-21474235 TGGGCAGTGACTGGAGGTGCAGG - Intergenic
1181252218 22:21540593-21540615 GCGGGGTAGACTGCAGCTGCAGG - Intergenic
1181473963 22:23157378-23157400 GTAGCTGGGACTGCAGGTGCCGG + Intronic
1182398811 22:30058171-30058193 GTGGCTGGGACTACAGGTGCTGG + Intergenic
1183836330 22:40456556-40456578 GTAGCTGAGACTACAGGTGCGGG - Intronic
1184153110 22:42649652-42649674 GCCTCCGAGACTGCAGGGGCCGG + Intergenic
1185182743 22:49372611-49372633 ACGGCAGAGACTGCAGCTGCGGG - Intergenic
949256808 3:2058032-2058054 GCAGAAGAGAATGCAGGAGCAGG + Intergenic
949710258 3:6862958-6862980 GGGGCAGAGGCTGCTGGAGCAGG - Intronic
949995713 3:9614962-9614984 GTAGCTGAGACTACAGGTGCAGG + Intergenic
950128807 3:10527830-10527852 TCTGCAGTGACTGTAGGTGCTGG - Intronic
950604313 3:14064811-14064833 GCTGCTGGGACTGCTGGTGCTGG - Exonic
950630101 3:14276622-14276644 GCTGCAGGGACTCCAGCTGCAGG - Intergenic
950645585 3:14374695-14374717 GTGGCAGAGACAGCAGGAGGAGG + Intergenic
950711325 3:14814804-14814826 ACAGGAAAGACTGCAGGTGCTGG - Intergenic
950964846 3:17139003-17139025 GAGGAAGAAACTCCAGGTGCTGG - Intergenic
953603741 3:44393329-44393351 GTAGCTGAGACTACAGGTGCAGG - Intronic
953985715 3:47441029-47441051 GTGGCGGGGACTACAGGTGCAGG + Intronic
954268716 3:49490697-49490719 GTAGCTGAGACTGCAGGTGCAGG + Intronic
954446947 3:50551947-50551969 GCCTCAGAGACTGGGGGTGCAGG - Intergenic
954834540 3:53454160-53454182 GTAGCAGGGATTGCAGGTGCCGG + Intergenic
956387047 3:68730606-68730628 GTGGCAAAGAGCGCAGGTGCTGG + Intergenic
958880433 3:99663293-99663315 GCAGCTGAAACTACAGGTGCAGG + Intronic
959579561 3:107969645-107969667 GAGGCAGAGACAGCTGCTGCTGG - Intergenic
960993918 3:123328859-123328881 GGGGGTGAGGCTGCAGGTGCAGG + Intronic
961458184 3:127034462-127034484 GCGGCAGAGTCTGAGGGTCCCGG + Exonic
961543848 3:127618509-127618531 GCTGCAGAGATGGCGGGTGCGGG - Intronic
961645803 3:128392234-128392256 GCAGCAGACATTGCAGATGCAGG + Intronic
962033103 3:131621940-131621962 GAGGTGGAGACTGCAGTTGCAGG + Intronic
962579843 3:136788466-136788488 GGGGCAGAGACTCCAGATGAAGG + Intergenic
963786356 3:149538474-149538496 GCGGCAGACACTTCAAGTGGAGG - Intronic
964343369 3:155731271-155731293 GAGCCTGAGTCTGCAGGTGCTGG - Intronic
966520658 3:180870167-180870189 GCGGCAGAGCGTGCGAGTGCGGG + Intronic
967332836 3:188309089-188309111 GAGGCAGAGGATGCAGGAGCAGG - Intronic
968356152 3:198109135-198109157 GCGGCAGAGTCTGCCTCTGCAGG - Intergenic
968505294 4:968509-968531 GCGGCAGTCACTGCAGGCGAAGG + Exonic
968566031 4:1313381-1313403 GCTGCACGGACTGCAGGTGCAGG + Intronic
968874041 4:3255893-3255915 GGTGCAGAGCCTGCAGCTGCAGG + Exonic
968894089 4:3388654-3388676 GCAGCAGGGGCTGCAGGCGCTGG - Intronic
969418650 4:7077036-7077058 GGGGCAGAGAATACAGGGGCTGG - Intergenic
969629094 4:8325045-8325067 AAGGCAGAGGCTGGAGGTGCGGG - Intergenic
969669052 4:8579758-8579780 CTGGCAGAGCCTGCAGGTGAGGG + Intronic
969683500 4:8656313-8656335 GAGGCAGAGCCTGCAGGTCAGGG + Intergenic
971999304 4:34009476-34009498 GCAGCTGGGACTACAGGTGCCGG + Intergenic
973981813 4:56314249-56314271 GGAGCAGAGGCTGCAGGCGCTGG + Exonic
974773896 4:66454594-66454616 GCGGCAAAGACATCAGGTCCTGG - Intergenic
975281475 4:72568070-72568092 TGGGCAGAGGCTGCAGGCGCCGG - Intronic
975448876 4:74501040-74501062 GTAGCAAAGACTGCAGGTGCAGG + Intergenic
976070677 4:81236353-81236375 AAGGCAGAGACTGAAGCTGCTGG - Intergenic
977666216 4:99649868-99649890 GGAGCTGAGGCTGCAGGTGCTGG + Exonic
978142676 4:105335466-105335488 GTGGCAGAGTCTAAAGGTGCAGG + Intergenic
978143143 4:105340478-105340500 GTGGCAGAGTCTAAAGGTGCAGG - Intergenic
981847943 4:149191240-149191262 GAGGTAGAGACAGCAGGTGGCGG - Intergenic
982202568 4:152974710-152974732 GCTGCAGAGGCTGAAGGAGCAGG + Exonic
983180750 4:164645730-164645752 GGAGCTAAGACTGCAGGTGCAGG - Intergenic
984566452 4:181336734-181336756 GCAGCAGGGACTACAGGTGTGGG - Intergenic
984846729 4:184114888-184114910 TGGTCAGGGACTGCAGGTGCAGG - Intronic
985070030 4:186158620-186158642 GCGGCAGTGTGTGCAGGGGCTGG - Intronic
985538357 5:476626-476648 GCTCCAGAGACTGCATGTCCAGG + Exonic
985904062 5:2819243-2819265 GAGGCAGAGCCTGCAGCTGTGGG + Intergenic
986389569 5:7271962-7271984 GAGGCAGAGACCACAGTTGCTGG + Intergenic
990071102 5:51784127-51784149 GTAGCTGGGACTGCAGGTGCAGG - Intergenic
991379439 5:66004526-66004548 GTAGCTGAGACTACAGGTGCAGG + Intronic
992200975 5:74383618-74383640 GGAGGAGAGACTGCAGATGCAGG - Intergenic
994093957 5:95832171-95832193 GAGGCAGAGGCTGAAGGGGCTGG + Intergenic
995990756 5:118236266-118236288 GCTACAGAGACTGCAGGTCTTGG + Intergenic
996431613 5:123385744-123385766 GTAGCTGGGACTGCAGGTGCTGG + Intronic
998869369 5:146537138-146537160 GCAGCAGAAGGTGCAGGTGCAGG + Intergenic
999354809 5:150915985-150916007 GTGGCTGAGACTGCAGATTCAGG - Intergenic
999628145 5:153541798-153541820 GCAGCTGAGACTACAGGTGTGGG - Intronic
1000092949 5:157946171-157946193 GTAGCTGAGACTACAGGTGCAGG + Intergenic
1000338725 5:160260829-160260851 GAGGCAGGGACTCCAGGTGAAGG - Intronic
1002321321 5:178377730-178377752 GAGGCCGAGAGAGCAGGTGCAGG + Intronic
1002445403 5:179287329-179287351 GGGGCAGTGAGTGCAGGCGCAGG + Intronic
1002617190 5:180463310-180463332 GAGGCAGAGACTGGAGGTTGTGG + Intergenic
1003235505 6:4291907-4291929 GCAGCAGGCACTGCAGGTGCTGG - Intergenic
1004272243 6:14205957-14205979 GCAGCAGTGACTTCAGGTGTGGG + Intergenic
1004424155 6:15496506-15496528 GCGGGAGGGCCTGCAGCTGCGGG + Exonic
1004607607 6:17208569-17208591 GCTGCAGAGTCTGCTGGAGCAGG + Intergenic
1005041492 6:21604396-21604418 GGGGCAGAGACTGAAGGTCAGGG - Intergenic
1005709196 6:28487187-28487209 GAGGCAGAGATTGCAGTTACTGG - Intergenic
1007614266 6:43171340-43171362 GCGGCCGAGACGGCGGGTGGAGG - Exonic
1007729252 6:43935923-43935945 GAGGTAGAGACTGCAGTTGTGGG + Intergenic
1008621255 6:53273613-53273635 GCAGCAAAGCCTGTAGGTGCTGG - Intronic
1011517061 6:88166303-88166325 GCGGCAGGGACTGCGCGAGCGGG - Exonic
1011930277 6:92701935-92701957 TCTGCAGAGCCTGCAGGGGCTGG - Intergenic
1013226649 6:108123744-108123766 AGAGCAGAGACTGCCGGTGCTGG + Intronic
1013466107 6:110418419-110418441 ACAGCACATACTGCAGGTGCTGG + Intergenic
1016260109 6:142159232-142159254 GTAGCTGAGACTACAGGTGCGGG - Intronic
1019155718 6:170037650-170037672 TGGGCAGAGGCTGCAGGTCCTGG - Intergenic
1019298046 7:289550-289572 GCGGCGGACAGTGCAGGTGGCGG + Intergenic
1019600994 7:1883710-1883732 GAGGCAGAGGGTGCAGGTCCAGG + Intronic
1019625085 7:2011849-2011871 TGGGGGGAGACTGCAGGTGCTGG + Intronic
1019666527 7:2254707-2254729 GAGGCAGGGCCTCCAGGTGCTGG - Exonic
1020727286 7:11831859-11831881 GCGGCAGCGGCAGCAGCTGCAGG + Exonic
1021114141 7:16729531-16729553 TCAGCAGAGACTGCAGTAGCTGG + Intergenic
1021230578 7:18082522-18082544 GTGGCTGAGTCTGCAGGAGCAGG + Intergenic
1021692055 7:23240202-23240224 GCGGCTGGGACTACAGGTGTAGG - Intronic
1022301309 7:29105245-29105267 TCAGCTGAGACTGAAGGTGCTGG - Intronic
1023959228 7:44912871-44912893 GGAGCAGAGACTGCAGCTTCTGG - Intergenic
1024216547 7:47253929-47253951 GTTGCAGAGACAGCCGGTGCTGG - Intergenic
1025634856 7:63313308-63313330 GCCTCAGACACTACAGGTGCTGG - Intergenic
1025647839 7:63434862-63434884 GCCTCAGACACTACAGGTGCTGG + Intergenic
1025934776 7:66026709-66026731 GTGGCTGGGACTACAGGTGCCGG - Intergenic
1029366575 7:100120197-100120219 TCTGCAGAGGCTGCAGGAGCCGG + Intronic
1030207442 7:106964631-106964653 GGAGCAGAGACTGGATGTGCAGG + Intergenic
1030472859 7:109989122-109989144 GTGGCTGGGACTACAGGTGCCGG - Intergenic
1031379810 7:121071643-121071665 GGGGCTGAGACTACAGGAGCGGG + Intronic
1032406140 7:131657163-131657185 GTGGCTGAGACTACAGGTGCAGG + Intergenic
1032779296 7:135150578-135150600 GCGGAAGAGAGGGCTGGTGCGGG + Intronic
1033350884 7:140560802-140560824 GCAGCTGGGACTACAGGTGCCGG - Intronic
1033365918 7:140672829-140672851 GCGGGCGGGAGTGCAGGTGCAGG - Intronic
1034845441 7:154440257-154440279 ACTGCAGAGACTGCAGGCGTGGG - Intronic
1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG + Intronic
1034899069 7:154896312-154896334 GGGGCAGTGTCTGCAGGTGCAGG - Intergenic
1035157466 7:156925887-156925909 GAGCCAGAGGCTGCAGGTGGTGG + Intergenic
1035223284 7:157419194-157419216 GTGGCAGGGACTGCAGTTGTGGG + Intergenic
1035295485 7:157864859-157864881 GGGGCAGAAACTGCAGGTTCAGG - Intronic
1036178476 8:6562685-6562707 GGTGCAGAGGCTGCAAGTGCTGG - Exonic
1036827146 8:11986387-11986409 GGTGCAGAAACTGCAAGTGCAGG + Intergenic
1036953911 8:13166810-13166832 GGGAGAAAGACTGCAGGTGCTGG + Intronic
1037582307 8:20252919-20252941 GCTGCAGTACCTGCAGGTGCAGG + Exonic
1037614601 8:20507378-20507400 GTAGCTGGGACTGCAGGTGCAGG + Intergenic
1038804045 8:30774476-30774498 GTAGCTGAGACTACAGGTGCAGG - Intronic
1039570644 8:38583585-38583607 GCGGCAGAGGCTGCGGGGTCAGG - Intergenic
1041087431 8:54269781-54269803 GTAGCTGAGACTGCAGGTGCAGG + Intergenic
1042316996 8:67435493-67435515 GGGGAGGAGACGGCAGGTGCGGG + Intronic
1042903073 8:73747110-73747132 CCCGCAGAGCCTGCAGCTGCTGG - Intronic
1043769946 8:84184873-84184895 GCGGCAGAGACCGCATATTCCGG + Exonic
1044072753 8:87782776-87782798 GCAGCTGGGACTACAGGTGCCGG + Intergenic
1045276055 8:100706751-100706773 GCTGCAGCGGCTGCAGCTGCAGG + Exonic
1047106350 8:121734714-121734736 GTAGCTGAGACTACAGGTGCCGG + Intergenic
1047481041 8:125283407-125283429 GTAGCTGGGACTGCAGGTGCAGG - Intronic
1047772771 8:128043587-128043609 GAGCCAGAGACAGCAGGTGGAGG - Intergenic
1048338220 8:133518867-133518889 GCCACAGAGCCTGTAGGTGCTGG + Intronic
1048570342 8:135648797-135648819 GCGGCAGAGATTGGAGGCTCAGG + Intronic
1048969805 8:139639098-139639120 GTGGCAGAGACTGCAGGAAGGGG - Intronic
1049481992 8:142829642-142829664 AAGTCAGAGACCGCAGGTGCGGG + Intergenic
1049537530 8:143189271-143189293 TCGCCAGACACTGCAGCTGCTGG + Intergenic
1049614227 8:143569201-143569223 GAGGGAGAGACTGTAGGGGCGGG + Intronic
1049640067 8:143711466-143711488 GGGGGTGAGACTGCAGGTCCTGG - Intronic
1050343273 9:4662303-4662325 GCGGAAGAGGCTGCAGGGCCGGG + Exonic
1052037817 9:23703128-23703150 ACTGCTGATACTGCAGGTGCGGG + Intronic
1053294167 9:36901176-36901198 GGGGCAGACCTTGCAGGTGCTGG - Intronic
1053586656 9:39465621-39465643 GTAGCTGAGACTGCAGGTGTGGG + Intergenic
1054579651 9:66899611-66899633 GTAGCTGAGACTGCAGGTGTGGG - Intronic
1055465153 9:76558313-76558335 GTGGCAGAGATTGGAGGTGGTGG - Intergenic
1056056184 9:82826345-82826367 GGCGCACAGACTGCAGGTTCTGG + Intergenic
1057596464 9:96418906-96418928 GCAGCAGAGACTCCAGCCGCCGG - Intergenic
1058013494 9:100004134-100004156 GAGGCTGAGTGTGCAGGTGCTGG + Intronic
1059027605 9:110652364-110652386 GCGGCTGAGAGCACAGGTGCTGG + Intergenic
1059157873 9:112005857-112005879 GGAGGAGAGATTGCAGGTGCAGG + Intergenic
1060707952 9:125823944-125823966 GTGGCTGGGACTACAGGTGCGGG - Intronic
1061204221 9:129153660-129153682 GCTGCAAAGACTGCAGGTGAAGG + Intergenic
1061765101 9:132876932-132876954 GTAGCCGAGACTACAGGTGCAGG - Intronic
1062029154 9:134354242-134354264 GCCGCAGAGACCGCAGGGCCAGG - Intronic
1062060688 9:134493709-134493731 GTGGCAGACACTGCAGGTGCAGG - Intergenic
1062216867 9:135393994-135394016 ATGGCAGAGCCTGCAGGGGCAGG - Intergenic
1062478992 9:136742879-136742901 GAGGCAGGGGCTGCTGGTGCTGG - Exonic
1203769665 EBV:42896-42918 GCGGCAGAAATTGAAAGTGCTGG + Intergenic
1185639643 X:1581307-1581329 GTGGCAGAGACAGAAGGTGGTGG - Intergenic
1186577313 X:10780093-10780115 GTAGCTGAGACTACAGGTGCAGG + Intronic
1190685100 X:52866426-52866448 GCAGCTGAGACTCAAGGTGCTGG - Exonic
1190691974 X:52919922-52919944 GCGGCAGAGAATGCCAGGGCAGG + Intergenic
1190694009 X:52935870-52935892 GCGGCAGAGAATGCCAGGGCAGG - Intronic
1191854183 X:65609418-65609440 GGGGCAGAGACTGCTTGTACAGG + Intronic
1192451683 X:71248773-71248795 GCGGCAGAAGCTGCAGGGTCGGG + Exonic
1192788185 X:74354637-74354659 GAGGCTGAGTCTACAGGTGCTGG - Intergenic
1193227238 X:78998414-78998436 GCAGCCAACACTGCAGGTGCAGG + Intergenic
1197422675 X:126258054-126258076 GTGGCAGTGGCAGCAGGTGCAGG + Intergenic
1201338790 Y:12908810-12908832 GTAGCTGGGACTGCAGGTGCCGG + Intronic