ID: 1151678474

View in Genome Browser
Species Human (GRCh38)
Location 17:75611885-75611907
Sequence GGCCATCGGGACGCCCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151678464_1151678474 6 Left 1151678464 17:75611856-75611878 CCTGGGCTGCCTCCCGGTGCTTG No data
Right 1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG 0: 1
1: 0
2: 2
3: 17
4: 140
1151678462_1151678474 16 Left 1151678462 17:75611846-75611868 CCTGGATGCTCCTGGGCTGCCTC No data
Right 1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG 0: 1
1: 0
2: 2
3: 17
4: 140
1151678467_1151678474 -6 Left 1151678467 17:75611868-75611890 CCCGGTGCTTGTTCCCAGGCCAT 0: 1
1: 0
2: 1
3: 14
4: 172
Right 1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG 0: 1
1: 0
2: 2
3: 17
4: 140
1151678461_1151678474 21 Left 1151678461 17:75611841-75611863 CCACACCTGGATGCTCCTGGGCT No data
Right 1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG 0: 1
1: 0
2: 2
3: 17
4: 140
1151678466_1151678474 -3 Left 1151678466 17:75611865-75611887 CCTCCCGGTGCTTGTTCCCAGGC No data
Right 1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG 0: 1
1: 0
2: 2
3: 17
4: 140
1151678458_1151678474 28 Left 1151678458 17:75611834-75611856 CCAGGTACCACACCTGGATGCTC No data
Right 1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG 0: 1
1: 0
2: 2
3: 17
4: 140
1151678468_1151678474 -7 Left 1151678468 17:75611869-75611891 CCGGTGCTTGTTCCCAGGCCATC 0: 1
1: 1
2: 1
3: 17
4: 194
Right 1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG 0: 1
1: 0
2: 2
3: 17
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151678474 Original CRISPR GGCCATCGGGACGCCCTGGC TGG Intergenic
900127766 1:1075966-1075988 GGCTATGGGGACTCCGTGGCGGG + Intergenic
900188902 1:1345147-1345169 GGTCTTCGTGAGGCCCTGGCTGG - Intronic
900199577 1:1398380-1398402 GGCCGTCAGGACGCCGTGGCTGG - Intronic
900242750 1:1624809-1624831 GATCCTCGGGAGGCCCTGGCGGG - Exonic
900374674 1:2348024-2348046 GGCCACGGGGAAGCCCAGGCTGG - Intronic
900489001 1:2937004-2937026 GGCCCTGTGGACGCGCTGGCGGG - Intergenic
901157755 1:7151744-7151766 GACCATTGGGAGGCCCTGGAGGG + Intronic
902840941 1:19073511-19073533 GCCCAGCTGGAAGCCCTGGCAGG - Intergenic
905345275 1:37307042-37307064 GGACGTCGGGAAGCCCAGGCAGG - Intergenic
908036677 1:60061993-60062015 GGCCAATGGGTAGCCCTGGCAGG + Intronic
913975152 1:143450029-143450051 GGCCAACTGGACGCCCTGGGAGG - Intergenic
914069545 1:144275645-144275667 GGCCAACTGGACGCCCTGGGAGG - Intergenic
914109610 1:144690709-144690731 GGCCAACTGGACGCCCTGGGAGG + Intergenic
914824661 1:151132502-151132524 GCCGTTCGGGACGGCCTGGCGGG + Exonic
915590526 1:156867917-156867939 GGCCATTGGGAGGCCGAGGCGGG - Intronic
916989908 1:170231800-170231822 GGCCAAAGGGAAGCCCTGGCAGG + Intergenic
1069861084 10:71472192-71472214 AGCCAACAGGAGGCCCTGGCAGG + Intronic
1071617297 10:87087096-87087118 GGCCATGGGAACCCCCTGGTTGG - Intronic
1072105990 10:92274592-92274614 GGACTTCGGGAGGCCCAGGCGGG + Intronic
1075545634 10:123352325-123352347 GGCCAGAGGGAGGCCCAGGCAGG - Intergenic
1076444135 10:130500340-130500362 AGCCATTGGGAAGCCCTGTCAGG - Intergenic
1077486971 11:2843434-2843456 GGCCCTGGGGAGGCCCTGCCTGG + Intronic
1081906170 11:46671839-46671861 GGGCATCGGGACCCCCTGGGGGG - Intronic
1081994571 11:47355184-47355206 GGCCAGCGGGGAGGCCTGGCGGG + Exonic
1083818319 11:65150569-65150591 GGCCATGGGGCCACCCTGTCTGG - Intergenic
1084041585 11:66545985-66546007 GGCCATGGGGCAGCCCTGGGCGG - Exonic
1085204826 11:74725235-74725257 GCCCTTTGGGAGGCCCTGGCGGG - Intronic
1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG + Intergenic
1089411540 11:118247131-118247153 GGCCAACGGGAGGCATTGGCAGG - Intronic
1089593429 11:119559712-119559734 GGGCATGGGGAGGGCCTGGCTGG + Intergenic
1096657717 12:53102107-53102129 TGCCATCTGGAGACCCTGGCAGG - Exonic
1101817125 12:108153773-108153795 GGCCAACGGGAGGCCCTGGCAGG - Intronic
1102023868 12:109702173-109702195 GCCCATGTGGACGCCCTGCCTGG + Intergenic
1103493869 12:121345638-121345660 GGCCAATGGGAGGCACTGGCAGG - Intronic
1103688661 12:122752851-122752873 GGCGCTCGGGCGGCCCTGGCCGG + Exonic
1103763722 12:123268087-123268109 GGCCACTGGGACGCCATTGCGGG - Intronic
1105211916 13:18261955-18261977 GCCCACGGGGAAGCCCTGGCGGG + Intergenic
1105931656 13:25058147-25058169 GGCCAGTGGGCAGCCCTGGCTGG - Intergenic
1114243945 14:20895070-20895092 GACCATCAGGAAACCCTGGCTGG + Intergenic
1114247007 14:20923645-20923667 GACCATCAGGAAACCCTGGCTGG + Intergenic
1121613158 14:95294777-95294799 GGCCAATGGGAGGCGCTGGCAGG + Intronic
1122985366 14:105209340-105209362 AGCCCTCGAGAAGCCCTGGCAGG + Exonic
1123110766 14:105865968-105865990 GGCCAGCGAGGAGCCCTGGCGGG - Intergenic
1125071305 15:35557127-35557149 AGCCAGCGGGACGCACTGGCAGG - Intergenic
1125653293 15:41334792-41334814 GGACTTCGGGAGGCCGTGGCGGG - Intronic
1128109517 15:65067830-65067852 GGACATGGCGACGCCCTGGACGG + Exonic
1129744374 15:78007914-78007936 GGCCAGCGGGAGGTGCTGGCAGG - Intronic
1138594875 16:58024671-58024693 GGCCCTCGGGGCACCCTAGCCGG - Intergenic
1139529889 16:67537842-67537864 GGGCGCCGGGACGCCCGGGCCGG + Intronic
1142427534 16:90008671-90008693 GGCCCTTGGGACGTCCTGGGAGG - Intronic
1142499705 17:325443-325465 GGGCATGTGGAGGCCCTGGCCGG - Intronic
1142627920 17:1203848-1203870 CGCCACCGGAACGTCCTGGCGGG - Intronic
1142762384 17:2050125-2050147 CGCCATCGGGCCGCCCCGTCCGG - Intergenic
1146686476 17:34844684-34844706 GGCCATAGGGACTTCCTGGAGGG - Intergenic
1147402390 17:40188826-40188848 GGGCATCAGCACGCCCTGCCAGG - Intronic
1148074662 17:44928431-44928453 GGCCATCGGGACCCCTGGGCTGG + Exonic
1148673750 17:49432899-49432921 AGCCAATGGGAGGCCCTGGCAGG + Intronic
1149336787 17:55643834-55643856 GGCCAATGGGAAGCCCTGGAAGG - Intergenic
1149660333 17:58331420-58331442 GGCCCTCGGGGGGCCCTGGCAGG - Intergenic
1149869636 17:60170095-60170117 GTCCATCTGGACACCATGGCAGG - Intronic
1149982369 17:61321557-61321579 GGCCATCTGGATGCCCCTGCAGG + Intronic
1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG + Intergenic
1151786097 17:76275772-76275794 GGCCAGCGGGGAGGCCTGGCAGG + Intronic
1152282283 17:79391990-79392012 GACCATCGCGGGGCCCTGGCGGG - Intronic
1152406470 17:80101135-80101157 TGCCCTCGGGACGCGTTGGCAGG + Intergenic
1153095126 18:1392271-1392293 GGCCAATGGGAGGCACTGGCAGG - Intergenic
1153973846 18:10249443-10249465 GGCCATCGGGAAGCCATAGTGGG + Intergenic
1155209154 18:23586251-23586273 GGCCACCGGGACGCCCTGTGGGG - Intronic
1158648788 18:59269012-59269034 GGCCATCGGGAAGCCGTGGCAGG - Exonic
1160239142 18:77110591-77110613 GGCCACCTGGCTGCCCTGGCAGG + Intronic
1161072938 19:2271314-2271336 GGCCGCCCGGACGCCCTGGAGGG + Intronic
1162496362 19:11025313-11025335 GGCCATGGGGACGCTCTAGTGGG - Intronic
1162802371 19:13118492-13118514 AGCCCTCGGGCCGCCCCGGCTGG - Intronic
1164034897 19:21444189-21444211 GCACCTCGGGACGCCCGGGCAGG + Intronic
1164941153 19:32253028-32253050 GGCCCTCAGGAGGCCTTGGCGGG - Intergenic
1165097778 19:33419116-33419138 GGCCTTCTGGAAGCCCTGGTGGG - Intronic
1165227689 19:34365994-34366016 GGCCATCGGGACGTCTAGCCCGG - Intronic
1165583647 19:36892891-36892913 GGCCATCAGCATGCCCAGGCAGG + Intronic
1166386917 19:42387508-42387530 AGCCGTCGGGAGGCCCCGGCTGG - Intronic
1167433035 19:49464186-49464208 GGCCAACGGGACGCCCCGCGGGG + Exonic
1167492697 19:49801509-49801531 GGCCCGCAGGACGCCCTGGATGG - Exonic
1168641429 19:58034204-58034226 GTCCATCGGGACGCCCACCCGGG + Intronic
925340764 2:3134049-3134071 GGCCAGCTGGACACCCTGCCGGG + Intergenic
928341083 2:30443759-30443781 AGCCAATGGGAGGCCCTGGCTGG - Intergenic
934179852 2:89611002-89611024 GGCCAACTGGACGCCCTGGGAGG - Intergenic
934290148 2:91685263-91685285 GGCCAACTGGACGCCCTGGGAGG - Intergenic
934301711 2:91780518-91780540 GCCCACGGGGAAGCCCTGGCGGG - Intergenic
934945349 2:98537374-98537396 GGGCTTCAGGAAGCCCTGGCTGG + Intronic
935371397 2:102350689-102350711 GGCCAATGGGAGGCACTGGCAGG + Intronic
948087726 2:235265531-235265553 GGCCAGCTGGAGGCCCTGGCAGG + Intergenic
948559906 2:238845914-238845936 GGCCCCGGGGACGCCCTGGAAGG - Intergenic
948659340 2:239497554-239497576 GGCCATCAGGACGCAGGGGCAGG - Intergenic
1170691914 20:18624021-18624043 GGCCATGGGGGTGCCCTGTCAGG + Intronic
1172766765 20:37355247-37355269 GGCCTTCGGGAACACCTGGCGGG - Intronic
1174383513 20:50172483-50172505 GGCCAACGGGAGGCCCCGGTCGG + Intergenic
1175557091 20:59872284-59872306 GGCCATCGGGTTGTCCTGCCTGG + Intronic
1176548504 21:8211993-8212015 GACCCTCGAGACGCCCTAGCGGG - Intergenic
1176556398 21:8256201-8256223 GACCCTCGAGACGCCCTAGCGGG - Intergenic
1176567435 21:8395028-8395050 GACCCTCGAGACGCCCTAGCGGG - Intergenic
1176575337 21:8439243-8439265 GACCCTCGAGACGCCCTAGCGGG - Intergenic
1178842288 21:36147360-36147382 GGGCATCGGGACCACCTGGAGGG + Intergenic
1179721735 21:43320258-43320280 GGCCATGGGGAGGCCAAGGCTGG + Intergenic
1180049926 21:45326407-45326429 GGCCCTCGGGACTGTCTGGCCGG + Intergenic
1180814721 22:18782201-18782223 GCCCACGGGGAAGCCCTGGCGGG + Intergenic
1181200908 22:21216537-21216559 GCCCACAGGGAAGCCCTGGCGGG + Exonic
1181700835 22:24620436-24620458 GCCCACGGGGAAGCCCTGGCGGG - Exonic
1185118643 22:48952511-48952533 GGCCATCGGGAGCGGCTGGCAGG - Intergenic
1203226009 22_KI270731v1_random:78898-78920 GCCCACGGGGAAGCCCTGGCGGG - Intergenic
1203253388 22_KI270733v1_random:128298-128320 GACCCTCGAGACGCCCTAGCGGG - Intergenic
1203261442 22_KI270733v1_random:173376-173398 GACCCTCGAGACGCCCTAGCGGG - Intergenic
1203264818 22_KI270734v1_random:7888-7910 GCCCACGGGGAAGCCCTGGCGGG + Intergenic
950720221 3:14877247-14877269 GGCCAACGGGGAGGCCTGGCAGG - Intronic
953614680 3:44478905-44478927 GGCCAATGGGAAGCCCTGGCAGG - Intergenic
954104017 3:48399369-48399391 GGCCAACGGGACGGGCTGGCAGG + Intronic
961552467 3:127677108-127677130 GGCCATGGGTGCGGCCTGGCAGG + Intronic
961825222 3:129595741-129595763 GGCCCTCAGGGCGGCCTGGCTGG - Intronic
963046253 3:141104676-141104698 GGCTCCCAGGACGCCCTGGCAGG - Intronic
968134986 3:196214806-196214828 AGCCAGCGGGAGGCCCTGCCTGG - Intronic
969829428 4:9782620-9782642 GGCCAACTGGACGCCCTGGGAGG + Exonic
972516645 4:39815669-39815691 GATCATGAGGACGCCCTGGCCGG + Intergenic
972629615 4:40832273-40832295 GGCCATCGTGAAGGTCTGGCCGG + Intronic
976097051 4:81519261-81519283 GGTCATTGGGAGGCACTGGCAGG - Intronic
976287848 4:83387186-83387208 GGCCAGTGGGAGGCACTGGCGGG - Intergenic
977287816 4:95130974-95130996 GCACATCGGGAGGCCATGGCGGG - Intronic
977575156 4:98666727-98666749 GGCCATCGGAGCTCCCTGGGGGG - Intergenic
978888614 4:113796157-113796179 GGACATCGGGAGGCCGAGGCGGG - Intergenic
984639189 4:182144309-182144331 GGCCCGCGGGACGCCCGGCCAGG - Intronic
985707912 5:1412272-1412294 GGCCTGCGGGACCCCGTGGCAGG - Intronic
997335609 5:133107087-133107109 GGCCCTGGGTAGGCCCTGGCAGG - Intergenic
999177033 5:149638946-149638968 GGCCAATGGGAGGCACTGGCAGG + Intergenic
999300003 5:150485507-150485529 GGCCCTGGGAACGCTCTGGCTGG - Intergenic
1000209144 5:159095313-159095335 GCCCTTCGGGGCTCCCTGGCCGG + Intronic
1002912981 6:1505340-1505362 GGACATCGGCACACCCTGGAAGG + Intergenic
1006294803 6:33165546-33165568 GACCATCGGGAAGCTCTGGGTGG + Exonic
1018893222 6:167996850-167996872 GGACAGCGGGGCGGCCTGGCCGG + Intronic
1019525887 7:1480330-1480352 GGCCCTGAGGACGACCTGGCTGG - Exonic
1019577523 7:1744580-1744602 GGCCATCGGGACCGCCCTGCAGG - Exonic
1021091708 7:16490770-16490792 GGCCTTCAGGACCACCTGGCTGG - Intronic
1022597364 7:31725231-31725253 GGCCATCGGGAGGTACTGGTAGG + Intergenic
1032051746 7:128654313-128654335 GGCCACCGGGAGGCCCAAGCTGG - Intergenic
1033342375 7:140502132-140502154 GGCCATGGGGAGCCCCTGGGTGG + Intergenic
1034068116 7:148156053-148156075 GGACATCAGGCAGCCCTGGCTGG + Intronic
1035559917 8:596513-596535 GGCCTCAGGGACGCCATGGCTGG + Intergenic
1038544128 8:28412363-28412385 GGCCGTGGGGACGCCGTGCCAGG - Intronic
1039963051 8:42264400-42264422 GGACATTGGGAAGCCCAGGCAGG - Intergenic
1053749077 9:41235341-41235363 CGACATCGGGACGCTCTGGGAGG - Intergenic
1054254514 9:62800194-62800216 CGACATCGGGACGCTCTGGGAGG - Intergenic
1054336788 9:63815408-63815430 CGACATCGGGACGCTCTGGGAGG + Intergenic
1056189436 9:84170549-84170571 GGCCATCCGGACACACTAGCAGG - Intergenic
1056591193 9:87967361-87967383 GGCCATGGGGAGGCCTTGGAGGG + Exonic
1059429711 9:114242552-114242574 GGCAGTGGGGACGCCCTGCCTGG + Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060509406 9:124221216-124221238 GGCCAAGGGGAAGCACTGGCAGG + Intergenic
1061045696 9:128163757-128163779 GGCCAAGGGGAGGCCCAGGCAGG - Exonic
1062264798 9:135682015-135682037 GGCCAGCGGGACTCCATGACAGG + Intergenic
1062527736 9:136985108-136985130 CGGCAGCAGGACGCCCTGGCTGG - Exonic
1203469788 Un_GL000220v1:111445-111467 GACCCTCGAGACGCCCTAGCGGG - Intergenic
1203477609 Un_GL000220v1:155417-155439 GACCCTCGAGACGCCCTAGCGGG - Intergenic
1189807388 X:44749472-44749494 GGCCTTTGGGAGGCCCAGGCGGG - Intergenic
1192267916 X:69552651-69552673 GGCCAGCAGGACACCCAGGCTGG + Intergenic