ID: 1151680251

View in Genome Browser
Species Human (GRCh38)
Location 17:75619312-75619334
Sequence TGCCCTCTGCTCACACAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151680251_1151680263 15 Left 1151680251 17:75619312-75619334 CCCCTCTGTGTGAGCAGAGGGCA No data
Right 1151680263 17:75619350-75619372 GCCCACAGGAGGCTTGGAGGTGG 0: 1
1: 0
2: 5
3: 39
4: 390
1151680251_1151680262 12 Left 1151680251 17:75619312-75619334 CCCCTCTGTGTGAGCAGAGGGCA No data
Right 1151680262 17:75619347-75619369 CCTGCCCACAGGAGGCTTGGAGG 0: 1
1: 1
2: 5
3: 41
4: 295
1151680251_1151680260 9 Left 1151680251 17:75619312-75619334 CCCCTCTGTGTGAGCAGAGGGCA No data
Right 1151680260 17:75619344-75619366 CTTCCTGCCCACAGGAGGCTTGG 0: 1
1: 1
2: 2
3: 34
4: 329
1151680251_1151680257 1 Left 1151680251 17:75619312-75619334 CCCCTCTGTGTGAGCAGAGGGCA No data
Right 1151680257 17:75619336-75619358 CCTGGGTCCTTCCTGCCCACAGG No data
1151680251_1151680258 4 Left 1151680251 17:75619312-75619334 CCCCTCTGTGTGAGCAGAGGGCA No data
Right 1151680258 17:75619339-75619361 GGGTCCTTCCTGCCCACAGGAGG 0: 1
1: 0
2: 1
3: 27
4: 288
1151680251_1151680266 21 Left 1151680251 17:75619312-75619334 CCCCTCTGTGTGAGCAGAGGGCA No data
Right 1151680266 17:75619356-75619378 AGGAGGCTTGGAGGTGGACCTGG 0: 1
1: 0
2: 1
3: 49
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151680251 Original CRISPR TGCCCTCTGCTCACACAGAG GGG (reversed) Intergenic