ID: 1151680257

View in Genome Browser
Species Human (GRCh38)
Location 17:75619336-75619358
Sequence CCTGGGTCCTTCCTGCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151680253_1151680257 -1 Left 1151680253 17:75619314-75619336 CCTCTGTGTGAGCAGAGGGCAGC No data
Right 1151680257 17:75619336-75619358 CCTGGGTCCTTCCTGCCCACAGG No data
1151680250_1151680257 2 Left 1151680250 17:75619311-75619333 CCCCCTCTGTGTGAGCAGAGGGC No data
Right 1151680257 17:75619336-75619358 CCTGGGTCCTTCCTGCCCACAGG No data
1151680252_1151680257 0 Left 1151680252 17:75619313-75619335 CCCTCTGTGTGAGCAGAGGGCAG No data
Right 1151680257 17:75619336-75619358 CCTGGGTCCTTCCTGCCCACAGG No data
1151680251_1151680257 1 Left 1151680251 17:75619312-75619334 CCCCTCTGTGTGAGCAGAGGGCA No data
Right 1151680257 17:75619336-75619358 CCTGGGTCCTTCCTGCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151680257 Original CRISPR CCTGGGTCCTTCCTGCCCAC AGG Intergenic
No off target data available for this crispr