ID: 1151680258

View in Genome Browser
Species Human (GRCh38)
Location 17:75619339-75619361
Sequence GGGTCCTTCCTGCCCACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 288}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151680250_1151680258 5 Left 1151680250 17:75619311-75619333 CCCCCTCTGTGTGAGCAGAGGGC No data
Right 1151680258 17:75619339-75619361 GGGTCCTTCCTGCCCACAGGAGG 0: 1
1: 0
2: 1
3: 27
4: 288
1151680252_1151680258 3 Left 1151680252 17:75619313-75619335 CCCTCTGTGTGAGCAGAGGGCAG No data
Right 1151680258 17:75619339-75619361 GGGTCCTTCCTGCCCACAGGAGG 0: 1
1: 0
2: 1
3: 27
4: 288
1151680251_1151680258 4 Left 1151680251 17:75619312-75619334 CCCCTCTGTGTGAGCAGAGGGCA No data
Right 1151680258 17:75619339-75619361 GGGTCCTTCCTGCCCACAGGAGG 0: 1
1: 0
2: 1
3: 27
4: 288
1151680253_1151680258 2 Left 1151680253 17:75619314-75619336 CCTCTGTGTGAGCAGAGGGCAGC No data
Right 1151680258 17:75619339-75619361 GGGTCCTTCCTGCCCACAGGAGG 0: 1
1: 0
2: 1
3: 27
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151680258 Original CRISPR GGGTCCTTCCTGCCCACAGG AGG Intergenic
900363639 1:2301638-2301660 GGGTCCCTGCTGCCTCCAGGAGG + Intronic
900568543 1:3347242-3347264 GGCTCCATCCAGCCCAGAGGTGG + Intronic
900651316 1:3731328-3731350 GGGTGGCTCCAGCCCACAGGTGG - Intronic
901459884 1:9385095-9385117 TCCTCCCTCCTGCCCACAGGTGG - Intergenic
901658074 1:10782000-10782022 GGGGCCTCCCTGGCCACTGGGGG + Intronic
902814507 1:18908485-18908507 GGGGCCTTCCTGGCCCCATGAGG + Exonic
903016583 1:20365894-20365916 GGGTCTTTCCAGCCTACAGCTGG + Intergenic
903257772 1:22114309-22114331 GGGGCCTTCTTCCTCACAGGTGG + Intergenic
903396190 1:23003502-23003524 TGGTACTTCCCGCCCAGAGGAGG + Intergenic
903975665 1:27148368-27148390 TAGCCCTTCCTGCCTACAGGAGG + Intronic
904234947 1:29109493-29109515 GGGTCCTTCTTGCAGAGAGGTGG - Intronic
904317937 1:29677868-29677890 GGGACCTTCCAGGCCACAGGAGG + Intergenic
905269984 1:36781487-36781509 GGGTCCCTGCTGACCACAGGTGG + Intergenic
905294467 1:36945527-36945549 TGATCCTTCCTGCCAACAGATGG + Intronic
905456233 1:38090092-38090114 GGGTCCTCACTGCCCACTGAAGG - Intergenic
906550789 1:46665025-46665047 GGGTACTTCCTGCTCCCAAGAGG - Intronic
907667950 1:56449838-56449860 GTGCCTGTCCTGCCCACAGGGGG + Intergenic
907795438 1:57711433-57711455 GGCTTCTTCCTGCTGACAGGGGG + Intronic
909853227 1:80495941-80495963 GGGTCGGTCCCGCCCACAGCTGG + Intergenic
910630736 1:89351322-89351344 GGGTTTTTCCTTCCCACAGCAGG + Intergenic
911733073 1:101309855-101309877 GGGCCTTCCCTGCCCACACGTGG - Intergenic
914354929 1:146876640-146876662 GGTGCCTTCCTACCCACATGTGG + Intergenic
914970422 1:152304440-152304462 GGATCCTGACTGCCCACGGGAGG + Exonic
914970579 1:152305412-152305434 GGATCCTGACTGCCCACGGGAGG + Exonic
914970734 1:152306384-152306406 GGATCCTGACTGCCCACGGGAGG + Exonic
914971055 1:152308328-152308350 GGATCCTGACTGCCCACGGGAGG + Exonic
914971374 1:152310275-152310297 GGGTCCTGACTGCCCATGGGAGG + Exonic
914971677 1:152312219-152312241 GGATCCTGACTGCCCACGGGAGG + Exonic
917923669 1:179771312-179771334 GGGTCTGTCCCGCCCACAGATGG + Intronic
918802584 1:188990812-188990834 GGGTACTTCCAGGTCACAGGTGG - Intergenic
921384672 1:214556623-214556645 GGGTCCTTCTAGCACACAGGAGG + Intergenic
923130768 1:231072787-231072809 GGGTCCTTCTTGCCCTCTGTGGG - Intergenic
1062803647 10:398388-398410 GGGGCCTTCCAGGTCACAGGTGG - Intronic
1062918091 10:1257367-1257389 GGGGCCATCCTGGCAACAGGTGG - Intronic
1063296866 10:4815441-4815463 TGGTTCTTCCTGCCCTCTGGTGG - Intronic
1063296881 10:4815551-4815573 TGGTTCTTCCTGCCCTCTGGTGG - Intronic
1063296896 10:4815661-4815683 TGGTTCTTCCTGCCCTCTGGTGG - Intronic
1063296911 10:4815771-4815793 TGGTTCTTCCTGCCCTCTGGTGG - Intronic
1063296926 10:4815881-4815903 TGGTTCTTCCTGCCCTCTGGTGG - Intronic
1063296941 10:4815991-4816013 TGGTTCTTCCTGCCCTCTGGTGG - Intronic
1063395065 10:5678732-5678754 GGGTCATTCCTGCCCAGAGCAGG - Intergenic
1067093657 10:43284703-43284725 GGGGCCTCCCTGGCCACATGGGG + Intergenic
1068411485 10:56660966-56660988 AGGTGATTCCTGCCCACAGAGGG - Intergenic
1069794334 10:71042683-71042705 TGGTCATTCCTGCCCTCAAGTGG + Intergenic
1072236755 10:93460304-93460326 GGATCCTCTCTGCCCTCAGGAGG + Intronic
1072692923 10:97583566-97583588 GGGTCTTTCCTGCCTGGAGGGGG - Exonic
1074984096 10:118642084-118642106 TGGTCATTCATGGCCACAGGAGG + Intergenic
1075277189 10:121104736-121104758 GGGTGTTGCCTGCCCACTGGAGG - Intergenic
1075411892 10:122234234-122234256 GGGTCCTTCCTGCTGGCAGCTGG - Intronic
1075722864 10:124597640-124597662 GGGGCCTCCCTGCCCCCATGTGG + Intronic
1076726412 10:132416198-132416220 GGGCCCTGCCTGACCACAGCAGG - Intronic
1077038685 11:507659-507681 GGGTCCCTCCTGTCCCGAGGCGG - Intergenic
1077273627 11:1693366-1693388 GGGGCCCTCCTGCCACCAGGTGG + Intergenic
1077355770 11:2116067-2116089 GGGTACTGCCTGACCACAGGAGG + Intergenic
1077571305 11:3340509-3340531 GAGACCTTTGTGCCCACAGGTGG - Intronic
1078687714 11:13548763-13548785 GGGTAATTACAGCCCACAGGAGG - Intergenic
1079015899 11:16868425-16868447 GAGTCCTACCTGCCAACAGTGGG + Intronic
1080020774 11:27557615-27557637 GGCGCCTTCCTACCCACAGTGGG + Intergenic
1081135799 11:39438884-39438906 GGGGCCTTCTTTCTCACAGGAGG + Intergenic
1082029092 11:47592016-47592038 GGGCCCTTCCTGCACAGAGGAGG + Intronic
1083132041 11:60633749-60633771 AGGTGCTTCCTGCCCACAGTGGG - Intergenic
1083593433 11:63908146-63908168 GGGTCCTGCCCACCCACTGGTGG + Intronic
1083771792 11:64871680-64871702 GGCTCCTTCCTGCCCATAATGGG + Intronic
1084359069 11:68657780-68657802 GGGTGCTTCCTGCCGAGTGGAGG - Intergenic
1084579664 11:70015362-70015384 AGGTGCTCCCTGCCCTCAGGGGG + Intergenic
1084741966 11:71145920-71145942 GGGTCCTCCCAGCCCACTGAGGG + Intronic
1084795139 11:71500495-71500517 GGGCCCATCCTGCACACAGTAGG - Intronic
1084804077 11:71566626-71566648 GAGACCTTCCTGGTCACAGGTGG - Exonic
1084806354 11:71581937-71581959 GAGACCTTCTTGCTCACAGGTGG + Exonic
1087990241 11:104740333-104740355 GGGTACTTCCTGCTGAAAGGGGG + Intergenic
1088550074 11:111003907-111003929 GGGCACTTCTTGCCAACAGGAGG - Intergenic
1089186375 11:116618116-116618138 TGTTCCATCCTCCCCACAGGAGG - Intergenic
1091270896 11:134311173-134311195 GCGTGCTGCCTGGCCACAGGAGG + Intronic
1091630180 12:2154158-2154180 GGGTTCTTCCTGACAAAAGGAGG + Intronic
1092239097 12:6826756-6826778 GGGTCCTCCCAGCCCAGAGCCGG + Exonic
1103029767 12:117603558-117603580 GGGTCCTTCCTGGCCCTTGGTGG - Intronic
1103373609 12:120438165-120438187 GGGTCGGTCCCGCCCACAGCTGG + Exonic
1104920820 12:132289840-132289862 GGGTCCTCCTTGGTCACAGGCGG + Intronic
1106452812 13:29898719-29898741 GGGACCTTCCTACCCACATGAGG - Intergenic
1106490388 13:30216286-30216308 GGTTCCTTCCTGCCCTCTGCTGG - Intronic
1112319537 13:98394463-98394485 CGGCCCTTCCAGCCCACAGGGGG - Intronic
1113971799 13:114196915-114196937 GGGTACTTCCAGGTCACAGGTGG + Intergenic
1113986306 13:114318920-114318942 GTGTCCTTCCTGCCCAGAGCTGG + Intronic
1114046805 14:18882392-18882414 GGGAGCATCCTGCCCACAAGTGG + Intergenic
1114117408 14:19637054-19637076 GGGAGCATCCTGCCCACAAGTGG - Intergenic
1115147326 14:30240340-30240362 TAGTGCTTCCTGCCCTCAGGGGG + Intergenic
1115520824 14:34231522-34231544 CTGTCCCTCCGGCCCACAGGAGG + Intronic
1119667513 14:76495903-76495925 GGTTCCTGCCTGCCCTCTGGAGG - Intronic
1119716291 14:76861871-76861893 GGCTGCTTCCTGCCCCCAGTGGG + Intronic
1120953587 14:90062589-90062611 GGGTCGGTCCTGCCCCCCGGAGG - Intronic
1120970537 14:90203457-90203479 GGGTACTTCCAGGCCATAGGTGG - Intergenic
1122059134 14:99124888-99124910 GGGACCTTCCTTCCAGCAGGAGG + Intergenic
1122413934 14:101539572-101539594 GGGTGCAGCCTGCCCTCAGGGGG - Intergenic
1123478263 15:20608116-20608138 GGATTCTTCCTGCAGACAGGGGG - Intergenic
1123639752 15:22392269-22392291 GGATTCTTCCTGCAGACAGGGGG + Intergenic
1127772669 15:62243839-62243861 GGGCACCTCCTGCCCGCAGGTGG - Intergenic
1128251918 15:66169791-66169813 GGTTCCTTCCTACCCGCAGGCGG + Intronic
1128457537 15:67840608-67840630 GGCCCCTTCCAGCCCACAGTGGG - Intergenic
1128732999 15:70033670-70033692 GGGTCCTCCCTGCCCCGGGGAGG - Intergenic
1129378495 15:75150638-75150660 GGATTCTTCCTGCTGACAGGGGG - Intergenic
1129787650 15:78320226-78320248 GTGTCCTACCTTCCCCCAGGTGG - Intergenic
1130990928 15:88875198-88875220 GGGCACTTCCTGCCCAGTGGGGG + Exonic
1132691608 16:1184137-1184159 GCATCACTCCTGCCCACAGGGGG + Intronic
1132853729 16:2035727-2035749 GGGTCCTTCCGGGCACCAGGAGG + Intronic
1135733900 16:24915778-24915800 GTTTCCCTCCTGCCCACAGCAGG - Intergenic
1137683154 16:50368617-50368639 GGGCCCTTCCTTCCCACGGCAGG - Intronic
1137698566 16:50478971-50478993 GGCTCCTGCCTGCTCCCAGGAGG + Intergenic
1138031322 16:53561774-53561796 GGGTCCTCTTGGCCCACAGGGGG + Intergenic
1139635731 16:68257360-68257382 GGCTCCGTGCTGCCCACAGATGG - Intronic
1139979091 16:70838889-70838911 GGTGCCTTCCTACCCACATGTGG - Intronic
1140237762 16:73174175-73174197 GAGACCTTCCTGGTCACAGGAGG + Intergenic
1140282336 16:73566150-73566172 AGGGCCTTCCTGCCCGCATGTGG - Intergenic
1140457232 16:75112518-75112540 GTCTCCTTCCTGCCCCCAGGCGG - Exonic
1140910888 16:79451300-79451322 GCGCCCTGCCTGTCCACAGGAGG + Intergenic
1141440480 16:84026559-84026581 GGGTACTGCCTGCCCTCAGCAGG - Intronic
1142011571 16:87718009-87718031 GGTTCCTTCCGGCACACAGCTGG + Intronic
1142150248 16:88509487-88509509 GGGCCCCTCCTGCACACAGCTGG - Intronic
1142625116 17:1186965-1186987 GGGGCCGTCGTGACCACAGGAGG - Intronic
1142709834 17:1716918-1716940 GGGCTCTTCCTAACCACAGGAGG + Intronic
1144167098 17:12623626-12623648 GTGTCCTTCCTGCTCCCTGGAGG - Intergenic
1145794508 17:27647756-27647778 GGGTGCTTCCTGCGCAAAGCAGG - Intronic
1146493161 17:33296889-33296911 GCCTCCTTCCTGCCCACTGTAGG + Intronic
1147484943 17:40803782-40803804 GGGTCCCTGCTGTCCTCAGGTGG + Intergenic
1147646591 17:42038049-42038071 GTGCCCTTCCTCCCCACAGCTGG + Intronic
1148086481 17:44996611-44996633 GGGTCCTTTCTACCCAGTGGAGG + Intergenic
1148086860 17:44998766-44998788 GGATGCTTCCTTCCCACTGGGGG + Intergenic
1150227600 17:63532263-63532285 GGGTCCTAGCAGCCCTCAGGAGG + Intronic
1150287944 17:63964412-63964434 GGGTTCTACCTGCCCTCAGCCGG - Intronic
1151343231 17:73485229-73485251 TGAGCCTTCCTGCCCTCAGGAGG - Intronic
1151680258 17:75619339-75619361 GGGTCCTTCCTGCCCACAGGAGG + Intergenic
1152436882 17:80281724-80281746 GGTCCCTTGTTGCCCACAGGGGG + Intronic
1152677286 17:81648176-81648198 GGGCCCTCGCTGCCCGCAGGGGG + Exonic
1152727059 17:81952714-81952736 GGGTCCTTCCTGACAACGAGGGG - Exonic
1152854082 17:82653981-82654003 GGGTCCCCTCTGCACACAGGTGG + Intergenic
1153792232 18:8589031-8589053 GGGTCCTGGCTGCACAGAGGCGG + Intergenic
1156462992 18:37332128-37332150 GGCTCCTGTCTTCCCACAGGTGG - Intronic
1157447077 18:47754143-47754165 GGGGGCTCCCCGCCCACAGGTGG + Intergenic
1160379042 18:78436063-78436085 TCGTCCTTCCTGTCCACAGTGGG + Intergenic
1160576021 18:79854150-79854172 GGGGGCTGCCTGTCCACAGGAGG + Intergenic
1160805326 19:990032-990054 GGGTCCTGGCTGCCCACACTGGG + Intronic
1162025864 19:7893866-7893888 GGGTACAGCCTGCCCACACGGGG - Intronic
1162285153 19:9732925-9732947 GGGTTCTTCCTACCCAAAGTAGG - Intergenic
1162452959 19:10765785-10765807 TGGTCCTGCCTGCCAACAGCAGG + Intronic
1164181232 19:22820510-22820532 GCTTCCTTCCTATCCACAGGTGG + Intergenic
1166311847 19:41967435-41967457 GGATCCTTCGTGCTCACAGGTGG + Intronic
1167699475 19:51034009-51034031 GTGTCCTTATTGACCACAGGTGG - Exonic
1168426568 19:56244062-56244084 GGGTCCTCCCTGACCCCATGAGG - Intronic
1202647225 1_KI270706v1_random:153315-153337 AGGTGCTGCCTGCACACAGGGGG + Intergenic
925010344 2:480413-480435 GGGTGCTCCCTGCTCCCAGGTGG + Intergenic
925288156 2:2729379-2729401 GGGCCCTCCCTGCCCCCAGGAGG - Intergenic
925335973 2:3099584-3099606 GGGTCCGTCCTGTGCACCGGGGG + Intergenic
927250425 2:20991228-20991250 GGCTCCTTCCTCCCAGCAGGAGG - Intergenic
927508064 2:23627318-23627340 GGATCCTGCCTGGCCACACGTGG + Intronic
927681899 2:25145238-25145260 GGGTCCTCCCTGCTCCCATGAGG + Intronic
928181405 2:29071278-29071300 GAGGCCTTTCTGCCCACAGGGGG + Exonic
928673103 2:33622270-33622292 GGCTACTTCCTGCCCATAGCAGG - Intergenic
929668582 2:43852335-43852357 AGCTCCTTCTGGCCCACAGGTGG + Exonic
929956781 2:46464267-46464289 GGCTCCTTCCAGCAGACAGGAGG - Intronic
932708222 2:74043375-74043397 CTGTGCTTCCTGCCCACAGCTGG - Intronic
933302803 2:80561638-80561660 GTTTCTTTCCTGCCCTCAGGAGG - Intronic
933465085 2:82641542-82641564 GGCTCCATGCTGCTCACAGGTGG - Intergenic
934660153 2:96138848-96138870 GGTTCCTTCCTGCCTCCAGGGGG + Intergenic
937229299 2:120388241-120388263 TGGTCCTTCCTGTCCCCAGCTGG - Intergenic
937750582 2:125472251-125472273 GGCTGCTTCCAGCACACAGGTGG - Intergenic
938107823 2:128545278-128545300 GGGTCCATCCAGCCCAGGGGAGG + Intergenic
943349882 2:186785098-186785120 GGCTCCTTGCTGCTCCCAGGTGG - Intergenic
948074725 2:235156869-235156891 CTGTTCTTCCTGGCCACAGGGGG - Intergenic
948528549 2:238588483-238588505 GGGTCTCTCATGCCCACATGGGG + Intergenic
948653866 2:239464948-239464970 GGGTGTCTCCTGTCCACAGGAGG - Intergenic
1170620359 20:17990534-17990556 GTGTCCTCCCTGCACACAGCTGG - Exonic
1171313606 20:24166654-24166676 TGGTTCTTCCTGCCCACCGCAGG - Intergenic
1172014306 20:31863815-31863837 AGGTCCAACCTTCCCACAGGGGG + Intronic
1172688653 20:36775527-36775549 GGCTCCCTCCTGTCCACAGGAGG + Intergenic
1173060604 20:39656366-39656388 GGCTCCTTCATGCTTACAGGTGG + Intergenic
1173979078 20:47208959-47208981 GGATCCTTGCTGCCCACGCGAGG + Intergenic
1175356401 20:58372187-58372209 GGGTTCTTCCTTCCATCAGGTGG - Intergenic
1175870940 20:62209079-62209101 CTGTCCTTTCTGTCCACAGGAGG - Intergenic
1175870958 20:62209227-62209249 GGGTCACTCCTGCCCAAGGGAGG - Intergenic
1175925320 20:62468571-62468593 GGGTCCTGCCTGGAGACAGGAGG - Intronic
1178478175 21:32956044-32956066 GGGTCCTGACAGCCCAGAGGGGG + Intergenic
1178991946 21:37364341-37364363 GAGTCCTTCCGGCCTACATGTGG + Intergenic
1180085714 21:45507138-45507160 CGGCCCTCCCAGCCCACAGGAGG - Intronic
1180085740 21:45507203-45507225 CGGCCCTCCCAGCCCACAGGAGG - Intronic
1180085780 21:45507312-45507334 CGGCCCTGCCAGCCCACAGGAGG - Intronic
1180085827 21:45507444-45507466 TGGCCCTCCCAGCCCACAGGAGG - Intronic
1180183992 21:46130516-46130538 GGATCCTTCATCCCCACAGTGGG - Intronic
1180465341 22:15605031-15605053 GGGAGCATCCTGCCCACAAGTGG + Intergenic
1181028082 22:20137153-20137175 GGGTCCCTCCTGCCCAGTGCGGG - Intronic
1181052460 22:20244313-20244335 GGGGCCCTCCTACCCACATGGGG + Intronic
1182475731 22:30575330-30575352 GGTTCCTTACTGCCCACAGCTGG - Intergenic
1182715694 22:32354695-32354717 GGGGCCTCACTGCCCACAGAGGG - Intergenic
1183057287 22:35314710-35314732 GTGTCCTTCCTGACCACACAGGG - Intronic
1183937530 22:41271903-41271925 GGCTGCTTCCTGCACAGAGGAGG + Intronic
1184644546 22:45889009-45889031 GGGTCCTTGCTGCCCGCTGCGGG + Intergenic
1185159610 22:49215303-49215325 GGGGTCATCCTGCCCACAGCTGG + Intergenic
949887763 3:8709952-8709974 TGGGCCTCCCTGCCCACAGGAGG - Intronic
950112207 3:10426528-10426550 GTGTCCTTGCTGTCGACAGGAGG + Intronic
951704371 3:25528646-25528668 GGGCCCTTCCATCCCTCAGGAGG - Intronic
954031758 3:47824936-47824958 GGGTCCGCCCGGCCCGCAGGGGG + Intronic
954472379 3:50708565-50708587 GGGTCCTACATACCCACTGGAGG - Intronic
955843155 3:63133147-63133169 GGGTCAGTCCTGTCCACACGGGG + Intergenic
957079227 3:75622865-75622887 GGATGCTCCCTGCCCACAGATGG - Intergenic
960927947 3:122815038-122815060 CTGTCATTCCAGCCCACAGGAGG + Intronic
961016982 3:123475978-123476000 GGGTCCATCCTGCCCCCACTCGG - Intergenic
962126706 3:132627129-132627151 GGGGCCTGCCTGCACACTGGGGG + Intronic
962251125 3:133836721-133836743 TGGTCCTTCCTGCTCCCTGGGGG - Intronic
962804498 3:138917054-138917076 GGGCCATTCCTGCCCACACCAGG - Intergenic
964479944 3:157130320-157130342 GGGTCTCTTCTGCCCAGAGGTGG + Intergenic
965535856 3:169822982-169823004 GGGTCCTTCCTGCCCTAAGTTGG + Intronic
967904391 3:194488036-194488058 GGCGCCCTCCTGCCCGCAGGAGG - Intronic
968704213 4:2070466-2070488 TGGTGCTTCCTGCCCCCTGGGGG - Intergenic
968810863 4:2799167-2799189 GGCTCCTTCCTCCCCACCGGAGG + Intronic
968947073 4:3670742-3670764 GGCTCCTTGCTGCCCACCTGAGG + Intergenic
969022315 4:4146820-4146842 GGATGCTCCCTGCCCACAGATGG - Intergenic
969326698 4:6448430-6448452 GGGACCTTCCTGCCCCCACCAGG + Intronic
969447247 4:7252328-7252350 GGGCCCATCCTGCCCACACCTGG - Intronic
969487415 4:7480073-7480095 GGGGGCTTCCTGCCCAAAGGAGG - Intronic
969651298 4:8469776-8469798 GCCTCCCTCCCGCCCACAGGCGG + Intronic
969700756 4:8766361-8766383 AGGTGCTCCCTGCCCACAGGTGG + Intergenic
969731558 4:8960573-8960595 GGATGCTCCCTGCCCACAGATGG + Intergenic
969791156 4:9494681-9494703 GGATGCTCCCTGCCCACAGATGG + Intergenic
969889886 4:10250010-10250032 GAGCCCTTCTTGCCCAGAGGTGG - Intergenic
969892455 4:10272375-10272397 GAGTCCTTCCTGCCCAGAGAAGG - Intergenic
972644386 4:40954007-40954029 CGGTCCTTGCTGCTCACAGATGG - Intronic
974083301 4:57234423-57234445 GGCTACTACATGCCCACAGGCGG + Intergenic
975913464 4:79297062-79297084 AGGTCCTGCCTGGCCTCAGGAGG - Intronic
976095795 4:81506948-81506970 GGGCCATTCCTGCCTAAAGGGGG + Intronic
978654444 4:111049431-111049453 GGGTTCCTCCTGGCCCCAGGTGG - Intergenic
978811947 4:112859502-112859524 GGAGCCTTCCTGGACACAGGAGG - Intronic
980496478 4:133591928-133591950 AGCTACTTCCTGCTCACAGGGGG - Intergenic
982158240 4:152541310-152541332 GGGTCCTGCCTGGCCATATGAGG + Intergenic
982724926 4:158896262-158896284 GGGCCTTTCCTGCCACCAGGTGG - Intronic
985516175 5:345831-345853 GGATCCTTCCTTCCCAAGGGAGG - Intronic
985527948 5:416564-416586 GGGTCCCTCGTTCCCACAGATGG + Intronic
985537592 5:473630-473652 GGGACCTTCCTGCGCCGAGGAGG - Intronic
985588472 5:752832-752854 GGGTCTTTACTCCCCACAAGTGG - Intronic
985603144 5:845287-845309 GGGTCTTTACTCCCCACAAGTGG - Intronic
985643995 5:1076567-1076589 GGATCCTGACTGCCCACAGCTGG + Intronic
985989030 5:3539912-3539934 TGGTCCTTCCTGGGCTCAGGTGG - Intergenic
996565785 5:124878905-124878927 GGGTCCATCCACCCCAGAGGAGG - Intergenic
1001924317 5:175625332-175625354 GCGTCCTTGCTGCTCACCGGTGG + Intergenic
1001961457 5:175882508-175882530 GGGTCCCTCCGGCCCACCTGGGG - Exonic
1002985928 6:2190904-2190926 GGGTCCTGCCTGGCCACATGAGG - Intronic
1003244291 6:4371066-4371088 GGGTGATGCCTGCCCACAGAGGG + Intergenic
1006012388 6:31053920-31053942 TCGGCCTTCCTTCCCACAGGTGG - Intergenic
1006450448 6:34103014-34103036 GGGTCCTGCCTGAACCCAGGAGG - Intronic
1006739397 6:36296674-36296696 GGGTCCTTTCTCCCAACAAGGGG + Intronic
1006843210 6:37044898-37044920 GGGTCGGTCCCGCCCACAGCTGG + Exonic
1007739359 6:44001472-44001494 TGTTGCTTCCTGCCCATAGGGGG - Intronic
1009588654 6:65638161-65638183 GGGTAGTTCCTTCCCACAGCTGG - Intronic
1012818878 6:104059569-104059591 GTGGCCTTCATGCCAACAGGTGG + Intergenic
1015542858 6:134333487-134333509 GGCTCCATCCAGCCCACAGATGG - Intergenic
1016267217 6:142246584-142246606 GGGTCCATCCAGACCACAGCAGG - Intergenic
1017133989 6:151132337-151132359 GTTGCCTTCCTGCCCACAAGCGG - Intergenic
1017926487 6:158915440-158915462 GCCTCCTTCCTTCCCACTGGCGG - Intergenic
1018974814 6:168556304-168556326 GTGTCCTTGTTGCCCACATGGGG + Intronic
1019015826 6:168878843-168878865 GGGGCCTTTCTGACCTCAGGGGG - Intergenic
1019018802 6:168900618-168900640 GGCTCCCTCCTGACCCCAGGGGG + Intergenic
1019331465 7:462756-462778 GGGTCCTTCCGGGCCACGGCAGG - Intergenic
1019515708 7:1438987-1439009 GGGACCTGGCTGCCCCCAGGTGG + Exonic
1019523197 7:1469630-1469652 GGGTCTTTCCAGCACACAGATGG - Intergenic
1020099982 7:5389150-5389172 GGGTCCTTCTTGCCGAAAAGCGG + Exonic
1020309738 7:6858862-6858884 GGATGCTCCCTGCCCACAGATGG - Intergenic
1023733025 7:43210128-43210150 AGGGCCTTCCTTCCCACAGAAGG + Intronic
1023975709 7:45028282-45028304 GGCACCTTAGTGCCCACAGGAGG - Intronic
1024055469 7:45657543-45657565 GGAGCCTTCCTGCCCACCTGTGG - Intronic
1024637304 7:51301250-51301272 GGGTGCTGCCTGCCCAGAAGAGG - Intronic
1027229325 7:76263108-76263130 GGGTCCCTACTGCCCCCAAGTGG + Intronic
1028082647 7:86598502-86598524 GGCTCCGTGCTGCCCCCAGGTGG - Intergenic
1032840614 7:135710901-135710923 GGGCCTTCCCTGCCCCCAGGGGG - Intronic
1033870641 7:145750361-145750383 GGCTGCTTCCTGCTGACAGGTGG + Intergenic
1034056383 7:148039361-148039383 GGATCATGCCTGCCCACATGAGG + Intronic
1035036610 7:155899591-155899613 GGGTCCTGCCAGCTCACAAGGGG + Intergenic
1035476558 7:159148360-159148382 GGGGCCTTCCAGGTCACAGGTGG - Intergenic
1036296714 8:7543439-7543461 GGGGACTTCCTGGACACAGGCGG - Intergenic
1036325853 8:7777580-7777602 GGGGACTTCCTGGACACAGGCGG + Intergenic
1036595255 8:10206268-10206290 GGGTCCTTCCATCACACAGCTGG + Intronic
1037426515 8:18761371-18761393 GGGTCCTTCCAGCCCACTTTAGG + Intronic
1037786849 8:21908477-21908499 GGCTCCTCCTTGCCCACATGGGG + Intergenic
1037905809 8:22715507-22715529 GGTTCCTTCCTGCCCTACGGTGG - Intronic
1039751141 8:40479865-40479887 GGATCATGCCTGCCCACAGTGGG + Intergenic
1039907846 8:41799070-41799092 GGTTCCTTCTAGCCCACATGTGG - Intronic
1041181882 8:55257915-55257937 GGCTTCTTCCTGCCCCCAGTGGG + Intronic
1042284158 8:67089232-67089254 GTGCCCTTCCTGCCCAGAGATGG + Intronic
1043396486 8:79842633-79842655 GGATCCCTTCTGCCCCCAGGTGG - Intergenic
1047884534 8:129234544-129234566 GACTCCTTCCTCCCCACAGCTGG + Intergenic
1048446452 8:134496881-134496903 AGGTCCTTCCTGCCCTGAGGGGG - Intronic
1048979518 8:139695654-139695676 GGGTCCTTCCCACCTCCAGGTGG - Intronic
1049582063 8:143417277-143417299 GGGGCATTCCTGGACACAGGGGG + Intergenic
1051586932 9:18736507-18736529 GGGTCAATCCAGCCCACATGTGG - Intronic
1052470262 9:28885160-28885182 GTGTCCCTCCTACCCACATGTGG - Intergenic
1055559680 9:77510604-77510626 CAGTCCTTCCTGCCCTCAGATGG + Intronic
1056666755 9:88587549-88587571 GGGTCCTTTCTGCCCAGTGATGG + Intergenic
1060260601 9:122070725-122070747 AGGTTCTTCCTGCCCTGAGGAGG - Intronic
1060518118 9:124278557-124278579 GGGTTCTGCCCGCCAACAGGGGG + Intronic
1060878273 9:127099082-127099104 GAGTCCTTCCTGCCCACAGCGGG + Intronic
1061029103 9:128068779-128068801 GGGTTCTTCGTGGACACAGGTGG + Intronic
1061477066 9:130875077-130875099 TGGTCCTTCCTGACTACAGGAGG + Intronic
1061618944 9:131798447-131798469 GGGAACTGCCTGCCCAGAGGTGG - Intergenic
1061785458 9:133025172-133025194 GGTGGCTTGCTGCCCACAGGTGG - Intergenic
1061936770 9:133862170-133862192 GGGTCCTGCCTATCCAGAGGAGG - Intronic
1061950116 9:133931409-133931431 GGGTGCTCCCTGCCTGCAGGAGG - Intronic
1062041673 9:134407277-134407299 GGGAGCTTCCTGCGCACAAGCGG + Intronic
1062087930 9:134658222-134658244 GGGTGCTGCCTGCTCACAGAGGG - Intronic
1062585588 9:137248002-137248024 GGGCTCTTGCTGCCCCCAGGAGG + Intergenic
1186069486 X:5802938-5802960 AGGTTCTTCCTGCACTCAGGCGG - Intergenic
1186428263 X:9482666-9482688 GGCTTCTTCCTGCTGACAGGGGG - Intronic
1186763302 X:12745660-12745682 GAGTCCTTGCTGCCAACAGAAGG - Intergenic
1188514610 X:30971913-30971935 GGTTCCTTCCTGGCCACTAGAGG + Intronic
1189355126 X:40304634-40304656 GCGTCCTCCTTGGCCACAGGTGG - Intergenic
1193624733 X:83804251-83804273 GGGGTCTTGCTGCCCACAGAAGG + Intergenic
1194332125 X:92596281-92596303 GGCTTCTTCCTGCTGACAGGTGG - Intronic
1196568893 X:117242624-117242646 GGCTCTTTCCCTCCCACAGGAGG + Intergenic
1200856765 Y:7947255-7947277 GGCTTCTTCCTGCTCATAGGTGG - Intergenic
1202261558 Y:22975644-22975666 GGCTTCTTCCTGCTCATAGGTGG + Intronic
1202414546 Y:24609385-24609407 GGCTTCTTCCTGCTCATAGGTGG + Intronic
1202456239 Y:25060701-25060723 GGCTTCTTCCTGCTCATAGGTGG - Intronic