ID: 1151680260

View in Genome Browser
Species Human (GRCh38)
Location 17:75619344-75619366
Sequence CTTCCTGCCCACAGGAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 1, 2: 2, 3: 34, 4: 329}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151680253_1151680260 7 Left 1151680253 17:75619314-75619336 CCTCTGTGTGAGCAGAGGGCAGC No data
Right 1151680260 17:75619344-75619366 CTTCCTGCCCACAGGAGGCTTGG 0: 1
1: 1
2: 2
3: 34
4: 329
1151680250_1151680260 10 Left 1151680250 17:75619311-75619333 CCCCCTCTGTGTGAGCAGAGGGC No data
Right 1151680260 17:75619344-75619366 CTTCCTGCCCACAGGAGGCTTGG 0: 1
1: 1
2: 2
3: 34
4: 329
1151680252_1151680260 8 Left 1151680252 17:75619313-75619335 CCCTCTGTGTGAGCAGAGGGCAG No data
Right 1151680260 17:75619344-75619366 CTTCCTGCCCACAGGAGGCTTGG 0: 1
1: 1
2: 2
3: 34
4: 329
1151680251_1151680260 9 Left 1151680251 17:75619312-75619334 CCCCTCTGTGTGAGCAGAGGGCA No data
Right 1151680260 17:75619344-75619366 CTTCCTGCCCACAGGAGGCTTGG 0: 1
1: 1
2: 2
3: 34
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151680260 Original CRISPR CTTCCTGCCCACAGGAGGCT TGG Intergenic
900419036 1:2547639-2547661 CTCCCTGCCCACAGCAATCTGGG + Intergenic
900463970 1:2814958-2814980 CTCCCTGCCCATGGGAAGCTGGG + Intergenic
900569763 1:3352424-3352446 CTTGCTGCCCGCAGTGGGCTGGG + Intronic
900600316 1:3500042-3500064 CTTCCTGCCCAAGGGAGACTGGG + Intronic
900664686 1:3806918-3806940 CTTGCTGCCCACAGATGTCTGGG + Intergenic
900939316 1:5787557-5787579 CTTCCTGCTCTGAGGAGGCATGG - Intergenic
901459880 1:9385090-9385112 CCTCCTGCCCACAGGTGGTGCGG - Intergenic
901745063 1:11367022-11367044 CTCAGTGGCCACAGGAGGCTTGG + Intergenic
902118607 1:14142581-14142603 CTTCCTTCACTCAGGAGTCTTGG - Intergenic
902195071 1:14792260-14792282 CTCCCTGCACACAGGTGACTGGG - Intronic
902467546 1:16627334-16627356 CTTGCTGGCTACAGGAGGTTCGG - Intergenic
902608514 1:17582861-17582883 CTCCCTGCCCACTGGATGCTGGG + Intronic
902674694 1:18000602-18000624 CTCCCTTCCCCCAGGAAGCTGGG + Intergenic
902785978 1:18733016-18733038 CTCCCTGCTCAAAGGAGGCCTGG - Intronic
903570160 1:24298223-24298245 CTGACTGCCCACCAGAGGCTGGG - Intergenic
903673471 1:25050204-25050226 CATGCTGCGCACAGTAGGCTGGG - Intergenic
904812460 1:33172368-33172390 CTTCCTGCACACGTGAGGGTGGG - Intronic
905456971 1:38094965-38094987 CTGCATCCCCAGAGGAGGCTGGG + Intergenic
905460941 1:38122744-38122766 CCTCCTGCACACTGGAGGGTGGG + Intergenic
905945494 1:41898113-41898135 TTTCCTGCCCCCAGGATGCTGGG - Intronic
906406346 1:45545397-45545419 CTTCCTGCTTACTGTAGGCTAGG - Intergenic
907317673 1:53582871-53582893 CCTCCTTCCCACAGGAGTCCAGG - Intronic
907353081 1:53849402-53849424 CTGCCTGCCCACACCAGACTGGG - Intergenic
907412151 1:54290423-54290445 TTCCCTGACCACAGCAGGCTGGG + Intronic
908918601 1:69162766-69162788 CATCCTGCCCATAGAAGGCTGGG - Intergenic
909346032 1:74588678-74588700 GTTCCAGGGCACAGGAGGCTAGG + Intronic
910001170 1:82344142-82344164 CTTCCTGGCCTGAGGAGGCCTGG - Intergenic
910369780 1:86503506-86503528 CTTGCTGCCCACAGAGGCCTGGG + Intergenic
912237208 1:107865122-107865144 TTTCCTGCACACAGGTGGCTGGG + Intronic
912555560 1:110513703-110513725 CTCACTGCAGACAGGAGGCTGGG + Intergenic
912560689 1:110549419-110549441 CTTCCAGACAACAGGAGGCAGGG - Intergenic
912716859 1:111989467-111989489 CTTCCTGGCTCCAGAAGGCTCGG + Intergenic
915450822 1:156003714-156003736 CTACTAGCCCACAGGAGGCGAGG - Intronic
915584928 1:156839343-156839365 CTTCCTGCCCCCAGGGGCTTGGG - Intronic
916265668 1:162887967-162887989 CTTCCTGCCCACCAGAGTTTAGG - Intergenic
916666326 1:166971087-166971109 CTCCCTTCCCACTGCAGGCTGGG + Intronic
916713904 1:167434469-167434491 CTCCCTCCCCACAGGAGGGGCGG + Intronic
917595924 1:176529003-176529025 CTTCCTGCCCACAAGTAACTTGG - Intronic
917955268 1:180090096-180090118 CTTCCTGCAGACAGGAGGAAAGG + Intronic
918226164 1:182484997-182485019 CTTGCAGGCCACAGGAGGCAGGG + Intronic
918622269 1:186619292-186619314 TTTACTGCCCACAATAGGCTAGG + Intergenic
919932579 1:202230924-202230946 CGTCCTGCCCTCAAGAGACTGGG + Intronic
921284349 1:213595546-213595568 CTTCCTGACCACGGATGGCTGGG + Intergenic
921298009 1:213722738-213722760 CTGCCTGCCCAGAGGAGAGTGGG + Intergenic
923664980 1:235991765-235991787 CTCCCTGCCCACAGGGAGCCAGG + Intronic
923857959 1:237864883-237864905 CCTGCCTCCCACAGGAGGCTGGG + Intergenic
924470697 1:244340276-244340298 CTTCTTCCTCAAAGGAGGCTGGG - Intergenic
1063039083 10:2318247-2318269 CTTCCTGCTCAGAGTAGGCAGGG + Intergenic
1063175674 10:3548862-3548884 CAGCCTGGCCACAGGAGGCCAGG + Intergenic
1063415440 10:5869408-5869430 CTTGCTGGACACAGGTGGCTGGG - Intronic
1063942793 10:11147903-11147925 CTTCCTCCCAGCAGGAGGCATGG + Intronic
1063944549 10:11164305-11164327 ATTCCTGCTCAAAGGAGGGTGGG + Intronic
1063972273 10:11389401-11389423 CTTCCTGTTCTCAGGAAGCTTGG + Intergenic
1064084333 10:12333941-12333963 CTTCCTGCCCGCAGGCAGCTGGG - Intergenic
1066502070 10:36003932-36003954 CTTCAGGGCCACACGAGGCTGGG - Intergenic
1067059299 10:43069754-43069776 CTTCCTTCCTACAGCAGGCATGG - Intergenic
1067203950 10:44197978-44198000 CTTCCTGCCCCTGGGAGGCTGGG + Intergenic
1069631472 10:69899658-69899680 CTTCCTAACCCAAGGAGGCTTGG + Intronic
1069913123 10:71771892-71771914 CTTCCTGCCCTCACTTGGCTGGG - Intronic
1070639291 10:78155043-78155065 CTGCCTGTCCTCAGTAGGCTTGG - Intergenic
1070809108 10:79288695-79288717 GTGCCAGCCCCCAGGAGGCTGGG - Intronic
1071694222 10:87854892-87854914 CTTCCTGCCCGTAGGAAGTTGGG - Intergenic
1071891950 10:90018921-90018943 CCTCCGACTCACAGGAGGCTGGG - Intergenic
1074549217 10:114427502-114427524 CTTCTTCCCCACAGGAGACCAGG - Intergenic
1075044276 10:119133711-119133733 CTTCCTGCTCACAGCTGGCCAGG - Intronic
1075219442 10:120572011-120572033 CTTCCTGCCCACACGCTACTGGG - Intronic
1076646571 10:131958425-131958447 CTTCATCCCCACAGGGGGATGGG - Intronic
1076685502 10:132196773-132196795 GCTCCTGCCCACTGGAGGGTTGG - Intronic
1076834669 10:133014989-133015011 CTTCCTGCCCAGAGGCAGCCCGG - Intergenic
1077091350 11:779750-779772 GATCTTGCCCACAGGAGACTCGG - Intronic
1077444277 11:2583098-2583120 CTGCCTGTCCCCAGGAGGCTGGG - Intronic
1077454372 11:2669579-2669601 CATCCTGCCCACAGGACACTGGG + Intronic
1077543377 11:3158149-3158171 CCGCTTGGCCACAGGAGGCTGGG - Intronic
1078469931 11:11578696-11578718 TGTCCTGCGCACAGGAGGCCCGG - Intronic
1079383336 11:19958021-19958043 TTTCCTTCCCACAGGATGCAGGG - Intronic
1081566332 11:44263407-44263429 CTTCCTGCCTCCAGGAAGCGGGG - Exonic
1081713057 11:45230330-45230352 CTTCTTGCTCAGAGGAGGGTAGG - Intronic
1081998427 11:47378702-47378724 CCCCCTGCCCAGAGGAAGCTGGG + Intergenic
1083171128 11:60924614-60924636 CATCCTTCCCACAGAAGGCGGGG - Exonic
1083338972 11:61946287-61946309 CTTCCTGCCCAGCTGAGGCAGGG + Intergenic
1083594153 11:63911059-63911081 CATCTTGCCCACAGGAGACTGGG - Intergenic
1083611237 11:64005458-64005480 CTTGGGGCCCACAGGAGTCTAGG - Intronic
1083629994 11:64090535-64090557 CTGCCTGCTCACAGGTGGCTGGG + Intronic
1084431000 11:69111155-69111177 GTTCCTGCTCTCAGGAGGCTGGG + Intergenic
1084438208 11:69156254-69156276 CTTCCTGGCCACAGGGATCTGGG - Intergenic
1084659890 11:70540472-70540494 CTCCCTGCCCGCGGGAGCCTGGG + Intronic
1087780137 11:102292663-102292685 ATTCCTCCCCACCGGAAGCTTGG - Intergenic
1089300826 11:117497721-117497743 CTTTCTGCCACCTGGAGGCTGGG + Intronic
1090830954 11:130420540-130420562 CTTCCAGACCACAGGAGGAGAGG - Intronic
1091989975 12:4947385-4947407 CTCCCTTCCCACAGGACCCTGGG + Intergenic
1092008306 12:5087991-5088013 CTTCTTTCCCTCAGGCGGCTGGG + Intergenic
1092930705 12:13312770-13312792 TTTCCTGCAGACAGGAGGCCAGG - Intergenic
1095974676 12:47931118-47931140 TTTCCTGCCCATAGCAGGGTTGG - Intronic
1096478083 12:51920912-51920934 CTTTCTGCCTGCAGGGGGCTGGG + Exonic
1096868742 12:54580151-54580173 CTTCCTTCCCAGAGGCAGCTTGG + Exonic
1099134000 12:78870781-78870803 TTTCCTACCCACAGTAGGCATGG - Intronic
1099822620 12:87732348-87732370 CTTCCTGCCCGTAGGAAGTTGGG + Intergenic
1102478090 12:113201793-113201815 CTTCCTGCACACTGGGGGCAGGG + Intronic
1102576772 12:113860684-113860706 TTTCCTGACCCCTGGAGGCTGGG + Intronic
1102932101 12:116870285-116870307 ATTCCTGCCCCCAGGATGATAGG + Intronic
1103141011 12:118548391-118548413 CTTCCTGCCTATAGTAGTCTGGG - Intergenic
1103251930 12:119507295-119507317 CTGCCTGTCAACAGGGGGCTGGG + Intronic
1104041256 12:125132788-125132810 CTTCGTCCCCATAGAAGGCTTGG + Intronic
1104264592 12:127219753-127219775 CATGTTGCTCACAGGAGGCTAGG + Intergenic
1104274969 12:127318317-127318339 CTGCATCCCCACAGGAGACTGGG + Intergenic
1104576061 12:129966773-129966795 CTTCCTGATCACAGGAGGTCAGG + Intergenic
1104696886 12:130871020-130871042 CTTCAGGCCAACAGGGGGCTGGG + Intergenic
1105474225 13:20717308-20717330 ATGACTGCCCACAGGAGGCGCGG + Intronic
1106097195 13:26658583-26658605 CTTCCTGCTCAAGGCAGGCTGGG - Intronic
1107086380 13:36431749-36431771 CTTCCTGCCGGGAGGCGGCTGGG - Intergenic
1108520040 13:51238314-51238336 CTTACTGGCCTCAGGAGGCCTGG - Intronic
1118867005 14:69711909-69711931 CTTGCTGCCCACAGGGGCCTGGG + Exonic
1120626294 14:86831220-86831242 CTTAGTGCCCACAGGAGTCGAGG - Intergenic
1121271175 14:92639183-92639205 CTTCCTGGTGACATGAGGCTGGG - Intronic
1122013871 14:98776969-98776991 CCTCCTGCCCACAGGGTCCTAGG + Intergenic
1122596725 14:102898979-102899001 CCTCTTCCCCACAGGAGGCTGGG + Intronic
1123711656 15:22992320-22992342 CCTACTGTCCACAGGAGGTTTGG - Intronic
1124252829 15:28118190-28118212 CATCATGCCCAGAGGAGACTAGG + Intronic
1125264644 15:37865119-37865141 CTTACTGTCCACAGGGGGCAAGG - Intergenic
1126069802 15:44856219-44856241 CCACAGGCCCACAGGAGGCTTGG - Intergenic
1126088726 15:45032943-45032965 CCACAGGCCCACAGGAGGCTTGG + Intronic
1126385753 15:48091674-48091696 CTTCCTTCTTACAGGAGGCAAGG - Intergenic
1127387042 15:58475111-58475133 CTTCCTGACCACATGAGGTGGGG - Intronic
1128568660 15:68717792-68717814 CTTCCAGCCCAGAGGAGGAGAGG + Intronic
1128697721 15:69781076-69781098 CTTCCTGCTCCCCGGGGGCTTGG - Intergenic
1128801157 15:70497987-70498009 CTTGCTGCCCACAGGGAACTAGG + Intergenic
1129002546 15:72346485-72346507 CTTGCTAACCAAAGGAGGCTGGG - Intronic
1129147290 15:73660105-73660127 TTTCCTGCCCACTGGTGGTTGGG + Intergenic
1129261983 15:74373859-74373881 CTTCCTGCACGCGGGCGGCTGGG - Intergenic
1129324741 15:74794114-74794136 CTTACAGTCCACAGGAGGCAGGG + Intronic
1129324758 15:74794169-74794191 CTTACAGTCCACAGGAGGCAGGG + Intronic
1129324777 15:74794224-74794246 CTTACAGTCCACAGGAGGCAGGG + Intronic
1129324798 15:74794279-74794301 CTTACAGTCCACAGGAGGCAGGG + Intronic
1129324819 15:74794334-74794356 CTTACAGTCCACAGGAGGCAGGG + Intronic
1129324838 15:74794389-74794411 CTTACAGTCCACAGGAGGCAGGG + Intronic
1129378494 15:75150633-75150655 CTTCCTGCTGACAGGGGGCATGG - Intergenic
1130709331 15:86264368-86264390 TTTCTTGCCCACAGGAGCTTTGG - Exonic
1131059444 15:89395585-89395607 CCTCCTGCTCACAGCAGGCAGGG + Intergenic
1132352785 15:101150252-101150274 CTGCCTGTCCTCAAGAGGCTGGG + Intergenic
1132678150 16:1129205-1129227 CTGCCTGCCCCGAGGAGGCCGGG + Intergenic
1133278589 16:4652470-4652492 CTTCCTGCCCACAGAAGACGGGG - Intronic
1133574145 16:7071406-7071428 CTTCCTGCAGCTAGGAGGCTAGG - Intronic
1133958178 16:10465511-10465533 ATTCCTGACCTCAGGAGCCTCGG - Intronic
1133997896 16:10762033-10762055 CTACCTGCCCGCAGGGGTCTCGG - Intronic
1135393136 16:22110695-22110717 CATCCCACCCACAGGAGGCCCGG + Intronic
1137484916 16:48882731-48882753 CCTCCTGACCACAGCAGGATGGG - Intergenic
1137698568 16:50478976-50478998 CTGCCTGCTCCCAGGAGGCCTGG + Intergenic
1137712264 16:50574604-50574626 CCTCCTGCCCGCTGGAGGCCAGG - Intronic
1138502778 16:57458362-57458384 CTGCAGGCCCACAGGAGGCTGGG + Intronic
1140200566 16:72891378-72891400 CTTCCTAGCCACAGAAGCCTGGG - Intronic
1140855531 16:78974854-78974876 CTTCCTGTCCACTGGAGGCCCGG + Intronic
1141892879 16:86938847-86938869 CTTGATGCCCACAGACGGCTTGG - Intergenic
1141979981 16:87544165-87544187 CTTCCTGCCCACAGGAAGCTCGG - Intergenic
1143388263 17:6544983-6545005 CTGCCTGTCCGCAGGAGCCTCGG - Intronic
1143713622 17:8751946-8751968 CTTCCAGCCCAGGGGAGGCTGGG + Intergenic
1143872197 17:9965051-9965073 CTTCCTGCCCACCAGTGCCTGGG - Intronic
1143964149 17:10744566-10744588 CTTCCTGCCCACAGTACACGGGG - Intergenic
1144540143 17:16133303-16133325 CTTCCTACAAAAAGGAGGCTGGG + Intronic
1145045724 17:19614126-19614148 CTTACTGCACACAAGAAGCTGGG - Intergenic
1147176470 17:38659052-38659074 CTTCCTCCCCCAAAGAGGCTTGG + Intergenic
1147343086 17:39766837-39766859 CCACCAGCCCACAGGAGCCTGGG + Intronic
1148662557 17:49346789-49346811 CTACCTGCCCACAAGGGACTTGG - Intronic
1148798732 17:50210165-50210187 CCTCCTGCCCTGAGGAGGCAGGG - Intergenic
1148864380 17:50620933-50620955 CTCAGTGCCCACAGGATGCTAGG - Intronic
1150174031 17:63031330-63031352 CATCCTAACCACAGAAGGCTTGG + Intronic
1150291563 17:63985336-63985358 CTTCCTGCCCTCTGTTGGCTTGG + Intergenic
1151496829 17:74462992-74463014 CTTCCTTTCCCCAGGAGCCTGGG - Intergenic
1151680260 17:75619344-75619366 CTTCCTGCCCACAGGAGGCTTGG + Intergenic
1152251852 17:79216548-79216570 CTTCCTTCCTGCAGGAGACTGGG - Intronic
1152486879 17:80600364-80600386 CTTCCTCCTCACAGAAGTCTGGG - Intronic
1152561118 17:81079253-81079275 AGACCTGTCCACAGGAGGCTGGG + Intronic
1153254134 18:3153159-3153181 CTTTCTGCCCACATGAGGTTAGG - Intronic
1154496210 18:14963192-14963214 CTTCCTGCAGACAGGGGCCTTGG + Intergenic
1155315931 18:24569944-24569966 ATTCCAGCACGCAGGAGGCTTGG + Intergenic
1155322442 18:24632368-24632390 CTTCTTGGCTACATGAGGCTGGG - Intergenic
1160288876 18:77572195-77572217 GACCCTGGCCACAGGAGGCTGGG + Intergenic
1160405212 18:78640883-78640905 CTGTCTGTCCACAGGAGCCTTGG - Intergenic
1160554371 18:79716518-79716540 CTGACTGCCCACAGGAGGCCAGG - Intronic
1161159837 19:2755667-2755689 CTTCCAGCCCCCAGAAAGCTCGG - Exonic
1161330133 19:3682986-3683008 CTCCCTCCCCACACCAGGCTTGG + Intronic
1161483223 19:4521245-4521267 CTCTCTTCCCACATGAGGCTGGG - Intergenic
1162015651 19:7845236-7845258 CTTCCTGCCATCAGGACCCTAGG + Intronic
1162452961 19:10765790-10765812 CTGCCTGCCAACAGCAGGTTTGG + Intronic
1162801051 19:13110627-13110649 CTTCCTGCCCACAGAGCCCTTGG - Intronic
1163223446 19:15937960-15937982 CCTCCTAGACACAGGAGGCTTGG + Intergenic
1163328099 19:16618239-16618261 CCTCATGACCACAGGAGGCCTGG + Intronic
1164543967 19:29143880-29143902 CTTCCTGACCAGATGAGGCCGGG + Intergenic
1164752211 19:30665435-30665457 CTCCCTGCACACAGCAGACTGGG + Intronic
1165465739 19:35973860-35973882 CTTAGTCCCCACAGGAGACTGGG + Intergenic
1165882701 19:39054789-39054811 CTGCCTGCCTTCTGGAGGCTCGG + Intergenic
1167264689 19:48477795-48477817 CCTCCTGCCCACAGGAGGAGGGG + Intronic
1167427094 19:49434942-49434964 TTTCCCGCCCACAGCAAGCTAGG + Intronic
1167736124 19:51295601-51295623 CTTCCTGCCCACAGCAGGCGGGG + Intergenic
925192581 2:1897367-1897389 CTTCCAGCACAGAGGATGCTTGG + Intronic
925204933 2:1997561-1997583 CTTGCTCCCAACAGGAGCCTGGG - Intronic
926205966 2:10834570-10834592 CTCCCAGGCCACAGGAGCCTCGG - Intronic
926738776 2:16094101-16094123 CTTCGTGCTCCCTGGAGGCTTGG + Intergenic
928330748 2:30356201-30356223 TTGCCTGCCCACAGGAGTCCTGG + Intergenic
929576865 2:43057481-43057503 CATCCTGCCCCAAGGGGGCTGGG + Intergenic
931700291 2:64903641-64903663 CTTCCTGCCCATAGGAGAAAGGG - Intergenic
933107709 2:78353548-78353570 CTTCATGCCCATAGAAGTCTGGG + Intergenic
933781152 2:85802302-85802324 AATTCTGTCCACAGGAGGCTTGG - Intergenic
935280674 2:101515254-101515276 CTGCCTGCCCAGAGCAGGCAAGG + Intergenic
935926036 2:108069709-108069731 CTTCCTGCCTGCAGGAGCCCTGG - Intergenic
947501965 2:230677401-230677423 CCTGCTGCCAAGAGGAGGCTGGG + Intergenic
947912421 2:233810156-233810178 TTTGCTGCCCTCAGGAGGCTTGG + Intronic
949009515 2:241670572-241670594 GTTCCTGGCCACAGGAGCCAAGG + Intronic
1169343435 20:4812900-4812922 CTACCAGCCCACAGCAGGCTGGG + Intronic
1171313605 20:24166649-24166671 CTTCCTGCCCACCGCAGGCCAGG - Intergenic
1173855846 20:46250411-46250433 CTTCTTGCCCACACCAGGCTAGG - Intronic
1174210793 20:48876275-48876297 CGTCCTGCCCACCTGAGGCTGGG - Intergenic
1174713388 20:52730761-52730783 GTTCCTGCCCTCATGGGGCTTGG + Intergenic
1175064327 20:56272464-56272486 CTTCCTCCCCATTGCAGGCTGGG + Intergenic
1175304350 20:57965641-57965663 CTTCCGCTTCACAGGAGGCTTGG - Intergenic
1175305661 20:57973983-57974005 CTTCCTGGGCAGAGGAGGCAGGG - Intergenic
1175611526 20:60355352-60355374 CTTCCTCCCCAAAGGTGACTTGG - Intergenic
1176139182 20:63537677-63537699 CTTCCTGCCCTCAGGCTGCGAGG - Intergenic
1178671713 21:34596551-34596573 CTCCCTGACCACGGCAGGCTGGG + Intronic
1178731752 21:35110150-35110172 CTTCCTGGCCACAGGATGACTGG + Intronic
1179921855 21:44511933-44511955 CTCCCTGCCCAAAGGAGCCCTGG + Intronic
1181010385 22:20036922-20036944 CTTCCTGCACACAGCAGCTTGGG - Exonic
1181178613 22:21052149-21052171 CCTCCTGCCCAGCAGAGGCTCGG + Intronic
1181530589 22:23514882-23514904 ACTCCAGCCCAGAGGAGGCTGGG + Intergenic
1181917453 22:26292446-26292468 CCTCCTGCCCTCAGGAGCCCCGG + Exonic
1181990607 22:26833925-26833947 CTTTCTGGCCTCAGGGGGCTGGG + Intergenic
1182087247 22:27569606-27569628 ACTCCTGTCCACAGGAGGGTGGG + Intergenic
1182573779 22:31259107-31259129 CCACCTGCTCACAGGTGGCTGGG + Exonic
1183135493 22:35883194-35883216 CTTCCTGCCAGCAGAATGCTAGG + Intronic
1183341120 22:37282425-37282447 CTTCCTCCCCACACAGGGCTGGG + Exonic
1183708508 22:39489193-39489215 CCTCCTGGCCACAGCAGTCTTGG - Exonic
1184179821 22:42813195-42813217 GCTCCTGCCCTCATGAGGCTTGG + Intronic
1184271674 22:43387963-43387985 CGTCCAGGCCCCAGGAGGCTGGG - Intergenic
1184558593 22:45247804-45247826 CTTCGTGGCTACAGGAGGATTGG - Intergenic
950514394 3:13454689-13454711 CTACAGGCCCACAGGAGGATTGG + Intergenic
950658482 3:14452085-14452107 TTTCCTGCCCAGAAGAAGCTGGG - Intronic
951051587 3:18099762-18099784 CTTCCTACACACAGGAAACTTGG - Intronic
951264870 3:20553097-20553119 CCTCCTGCCCCCTGCAGGCTTGG - Intergenic
952235667 3:31477222-31477244 TTCCCTCCCCACAGGAGGCTGGG + Intergenic
952753957 3:36849679-36849701 CAGCCAGACCACAGGAGGCTGGG + Intronic
953040311 3:39250480-39250502 CTTACTTCCCACAGGAGGCTAGG - Intergenic
953730531 3:45443632-45443654 TCACCTGCCCAGAGGAGGCTGGG - Intronic
953928641 3:46995190-46995212 CTGCCTGCACACAGGTGGCACGG - Exonic
954493436 3:50930398-50930420 CTCCCTGCCCACAAGAGCCCAGG + Intronic
954566381 3:51603639-51603661 CTTCCAAGCCACAGTAGGCTTGG - Intronic
954581595 3:51706193-51706215 CTTCCCTCCCACAGCAGGATGGG - Intergenic
954976241 3:54697614-54697636 CTTCCAGACCACAGGAGTGTGGG - Intronic
955925425 3:63999569-63999591 CTTGAGGCCCACAGGAGGTTGGG - Exonic
956602378 3:71035604-71035626 CTTCCTGCCAACATGAGTCAAGG - Intronic
956632009 3:71325793-71325815 CCTCCTCCCCACAAGAAGCTAGG + Intronic
959662098 3:108880082-108880104 CCACCTGTCCTCAGGAGGCTGGG + Intergenic
961353808 3:126321372-126321394 CCTCCTCCCCACAGCAGGCATGG - Intergenic
962264345 3:133934822-133934844 CCTCCTGCCCACAGGTACCTGGG - Exonic
962752156 3:138441401-138441423 CTTCCTGCCCACTGGAGAGGGGG - Intronic
963842749 3:150124297-150124319 CTCTCTGCCTACAGGAGGTTAGG - Intergenic
965661782 3:171049697-171049719 ATTCCTGCTCACAGCAGGATGGG + Intergenic
967688433 3:192444658-192444680 CTTGCTACGCACAGGAGGCCAGG + Intronic
968092415 3:195907595-195907617 CCTCGTGCCCCCAGGGGGCTTGG - Intronic
968627196 4:1631291-1631313 TTTGCTGCCCACAGCAGGCCTGG - Intronic
968782915 4:2596740-2596762 CTTCGAGGCCACAGCAGGCTTGG + Intronic
969700071 4:8763041-8763063 CCTCCTGCCCACAGCGGCCTTGG + Intergenic
969903834 4:10374475-10374497 CTTCCTGCCCAGAGAAGGTGTGG - Intergenic
969928673 4:10609606-10609628 ATTCCTGCCTCCAGGAGTCTTGG - Intronic
973026766 4:45283461-45283483 CTGCTCGCCCTCAGGAGGCTTGG - Intergenic
973633621 4:52842228-52842250 CTTTCTTCCCAGAGGAGGATGGG + Intergenic
974047304 4:56908459-56908481 CCCCCTCCCCACTGGAGGCTGGG + Intronic
975913460 4:79297057-79297079 CTGCCTGGCCTCAGGAGGGTGGG - Intronic
978377834 4:108094389-108094411 CTTCGTGTCCACAGGAGGTATGG - Intronic
979435423 4:120683114-120683136 CTTCCTGCTCACAGAATGTTGGG + Intergenic
979980376 4:127247662-127247684 ATTCTTGACCACAGAAGGCTTGG + Intergenic
980897365 4:138872828-138872850 CTTACTGCCAACAGGCGCCTGGG + Intergenic
983649758 4:170026411-170026433 CTTCCCACCTACAGGAGCCTGGG + Intronic
984156406 4:176200442-176200464 CTTCTTGCCCACAGGTGTCTCGG + Intergenic
985199598 4:187471144-187471166 CTTTCTGCTCACAGGAACCTGGG - Intergenic
985722985 5:1500598-1500620 CTGCCTTCGGACAGGAGGCTCGG - Intronic
985758443 5:1732869-1732891 ATTCCTGCTGACTGGAGGCTGGG + Intergenic
985786466 5:1897919-1897941 CTCCCCGGCCACTGGAGGCTGGG - Intergenic
987934611 5:24448029-24448051 CTGCCTGACCACTGAAGGCTAGG - Intergenic
988362097 5:30249733-30249755 CTTCATGACCAAAGGACGCTTGG + Intergenic
988623102 5:32843468-32843490 CTTCCTGCCGTCAGCAGGGTTGG + Intergenic
988827265 5:34950778-34950800 CTTCCTGCTCAGAGGAGCCCTGG + Intronic
989019400 5:36984703-36984725 ATTCTTACCCACAGGAGGCTGGG + Exonic
990856144 5:60268609-60268631 CTGCTCTCCCACAGGAGGCTGGG - Intronic
992042447 5:72848743-72848765 CTTCCGGCGCGCAGGAGGCGGGG + Intronic
996765570 5:127031255-127031277 CTGGCGGCCAACAGGAGGCTTGG + Intergenic
997266988 5:132500744-132500766 CCTTCTGCACACTGGAGGCTGGG + Intergenic
997345643 5:133190084-133190106 CTTCCTGCGCAAAGGAGGGAAGG - Intergenic
998539400 5:142965764-142965786 CTTGCCGCCCACAGTAGCCTAGG + Intronic
999152528 5:149435788-149435810 CTTCCTGGCCAGAGGCAGCTGGG - Intergenic
1001097740 5:168788984-168789006 CTTCCTGCCGGCAGGGGTCTTGG + Intronic
1001734925 5:173989666-173989688 CTTGCGGCACGCAGGAGGCTGGG + Intronic
1002535891 5:179875179-179875201 CATCCTGCCCGCAGGAGCCCTGG - Exonic
1002680632 5:180960189-180960211 CTTCGTCCACACTGGAGGCTGGG + Intergenic
1002861541 6:1084074-1084096 GTCCCTGCACACAGGAGGCAAGG - Intergenic
1002985924 6:2190899-2190921 CTGCCTGGCCACATGAGGGTGGG - Intronic
1003528173 6:6915708-6915730 CTACCTGCCTTCTGGAGGCTGGG - Intergenic
1003807203 6:9738412-9738434 CTTCCTGCCCATAGAAAGTTGGG - Intronic
1004281927 6:14287261-14287283 CTTCCTGTCCACCAGAGGCTTGG - Intergenic
1004325771 6:14672810-14672832 TTTATTGCCCACTGGAGGCTGGG - Intergenic
1005666291 6:28060629-28060651 CATTCTGCCCACAGGAGGTAGGG + Intergenic
1005785564 6:29242095-29242117 CTACATGCCCACAGGAGGAAGGG - Intergenic
1006436004 6:34026553-34026575 CTTCCTGCCCAGAGGGGCCTGGG - Intronic
1007632877 6:43282669-43282691 CTTCCTGGGCCCAGGAGGGTGGG + Intronic
1007744317 6:44034254-44034276 TGTCCTGCCCACTGGAGGCCAGG - Intergenic
1007753367 6:44083326-44083348 CTGGGTGCCCACAGGAAGCTGGG - Intergenic
1007777587 6:44232448-44232470 CTTACTTCCCACAGGGGCCTGGG - Intronic
1009197956 6:60709877-60709899 CTTCTTGCCCATAGAAGGTTGGG + Intergenic
1010703496 6:79078493-79078515 CTTCCAGCCAACCGGCGGCTTGG - Intergenic
1011797432 6:90972189-90972211 CTTCCTTCGAAAAGGAGGCTTGG + Intergenic
1013017299 6:106171618-106171640 CTTCCTCCCCTCAAGAGGGTAGG - Intergenic
1013645960 6:112141631-112141653 CTGCCTGCTCACAGGAGCTTCGG - Intronic
1013709440 6:112880012-112880034 CTGCCTGCCCCCTGGCGGCTGGG - Intergenic
1015551687 6:134418826-134418848 AGTTCTGTCCACAGGAGGCTGGG - Intergenic
1016898082 6:149073826-149073848 CTTCCAGAGCACAGGAAGCTTGG + Exonic
1017639084 6:156472959-156472981 CTTTCTGCCCACAGGTGTTTTGG - Intergenic
1019125489 6:169837885-169837907 CTTCTGGCCCACAGAATGCTAGG + Intergenic
1019348976 7:544350-544372 CTTCAGGCCCACAGGATGCTGGG + Intergenic
1019498345 7:1351965-1351987 CTGCCCGGCCACTGGAGGCTGGG + Intergenic
1019603358 7:1896160-1896182 CTCCCTGACCTCAGGAGCCTGGG + Intronic
1019715372 7:2536414-2536436 CTTCCTGGTGACAGCAGGCTAGG - Intergenic
1019788309 7:2993658-2993680 TTTCCTGCACAAAGGAGTCTGGG + Intronic
1020055730 7:5116727-5116749 CTTCCTTCTCACTGTAGGCTGGG + Intergenic
1022386049 7:29900414-29900436 CTTCCTGTCCACAGGTGCTTGGG - Intronic
1022467887 7:30663631-30663653 CTACCTTCCCAAAGGAGGCAGGG + Intronic
1022721252 7:32943196-32943218 CTCCCCGCCCACCGGCGGCTGGG - Intergenic
1022755291 7:33281487-33281509 CTTCAGCCCCACAGGTGGCTGGG + Intronic
1023578712 7:41658205-41658227 AGTCCTGCCCAAGGGAGGCTTGG + Intergenic
1026501448 7:70946487-70946509 CTCCCTTCCCAGAGGAGCCTTGG + Intergenic
1027199599 7:76055028-76055050 CTTCCTGTCCCCAGTAGGCCAGG + Intronic
1029658876 7:101945784-101945806 GTTCCTGAGCACAGGAGGTTTGG - Intronic
1029848011 7:103433145-103433167 CTTCAGGCCCACAGGAGACCAGG - Intronic
1034268858 7:149793721-149793743 CTTCCTGCCACCCTGAGGCTGGG - Intergenic
1034815979 7:154172373-154172395 CTTTCTTCACACAGGAGGCGGGG - Intronic
1036381284 8:8237912-8237934 CTTCCTTCCTGCAGGAGGCCTGG - Intergenic
1036443024 8:8797997-8798019 CCCCTTGCCCAGAGGAGGCTGGG - Intronic
1036702591 8:11022970-11022992 CTTCCTGGCCACAGCAGGGCTGG + Intronic
1037659853 8:20917120-20917142 CTTCCTACCCAAATGAGGCATGG - Intergenic
1037883324 8:22583343-22583365 CACCCTGCCCACTGGAGGCCAGG - Intronic
1038121101 8:24616408-24616430 CTGCCTGCCCACAGGAGATGAGG + Intergenic
1044457881 8:92410128-92410150 CTTACTGCCCAGAGGTAGCTGGG - Intergenic
1044843714 8:96360022-96360044 CTTCCTGCTCCCAGCAGCCTTGG - Intergenic
1045493049 8:102685023-102685045 GTTCCTGCTCTCAGGAAGCTTGG + Intergenic
1048892595 8:138961214-138961236 CTTACTGTCCAGAGGAGGCTGGG - Intergenic
1049071181 8:140357273-140357295 CTTCCTTCCCACAGCAGGGCCGG - Intronic
1049562316 8:143317885-143317907 TTTCCTTCCCGCGGGAGGCTGGG - Intronic
1050585631 9:7108599-7108621 CTTCCTGTCCTCATGAGGCATGG + Intergenic
1050920460 9:11195605-11195627 CCTTCTGGCCCCAGGAGGCTTGG - Intergenic
1051610413 9:18956492-18956514 TTCACTGCCCACATGAGGCTAGG - Intronic
1055772908 9:79736556-79736578 ACTCCTGCCCTCAGGTGGCTCGG - Intergenic
1055781637 9:79827653-79827675 CTTCCTGCCCCCAGGACCTTCGG - Intergenic
1056249049 9:84729428-84729450 CTTCCTGCACACTGCAAGCTAGG - Intronic
1056427055 9:86488188-86488210 TTCCCTGCCCCCAGGAGGCAGGG + Intergenic
1059325642 9:113502548-113502570 TTTCCTGCCCTCATGGGGCTGGG + Intronic
1060199714 9:121645397-121645419 CCTTCTGCCCACAGGAGCCCTGG - Intronic
1060875760 9:127082481-127082503 CCTCCTGCCCACAGCAGGAGTGG - Intronic
1060878275 9:127099087-127099109 CTTCCTGCCCACAGCGGGACTGG + Intronic
1061993456 9:134172560-134172582 CTTCCGGCCCATCGGAGCCTCGG - Intergenic
1062138531 9:134942781-134942803 ATTCCTGCCCAGATGAGGCTGGG - Intergenic
1062386014 9:136311827-136311849 CATCCTGCCCACAGCAGGGCTGG - Intergenic
1062465697 9:136680144-136680166 CTAGCTGCCTGCAGGAGGCTCGG + Intronic
1186378379 X:9033017-9033039 CCTCCTGCCCACAGGATCCGTGG + Exonic
1190112954 X:47606838-47606860 GTTCTTGCCCACAGAAGGATGGG + Intronic
1190690402 X:52908795-52908817 CTTCCTGTGCACAGGAGACGTGG + Intergenic
1190695581 X:52946997-52947019 CTTCCTGTGCACAGGAGACGTGG - Intronic
1192507572 X:71698307-71698329 CTTGCTGCCCACAGAGGCCTGGG + Intergenic
1192519124 X:71783245-71783267 CTTGCTGCCCACAGAGGCCTGGG - Intergenic
1194469357 X:94273071-94273093 CATCCTGTGCACAGGATGCTGGG + Intergenic
1200910126 Y:8524497-8524519 CTTCTTTCCCAAAAGAGGCTGGG - Intergenic