ID: 1151680262

View in Genome Browser
Species Human (GRCh38)
Location 17:75619347-75619369
Sequence CCTGCCCACAGGAGGCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 1, 2: 5, 3: 41, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151680253_1151680262 10 Left 1151680253 17:75619314-75619336 CCTCTGTGTGAGCAGAGGGCAGC No data
Right 1151680262 17:75619347-75619369 CCTGCCCACAGGAGGCTTGGAGG 0: 1
1: 1
2: 5
3: 41
4: 295
1151680252_1151680262 11 Left 1151680252 17:75619313-75619335 CCCTCTGTGTGAGCAGAGGGCAG No data
Right 1151680262 17:75619347-75619369 CCTGCCCACAGGAGGCTTGGAGG 0: 1
1: 1
2: 5
3: 41
4: 295
1151680250_1151680262 13 Left 1151680250 17:75619311-75619333 CCCCCTCTGTGTGAGCAGAGGGC No data
Right 1151680262 17:75619347-75619369 CCTGCCCACAGGAGGCTTGGAGG 0: 1
1: 1
2: 5
3: 41
4: 295
1151680251_1151680262 12 Left 1151680251 17:75619312-75619334 CCCCTCTGTGTGAGCAGAGGGCA No data
Right 1151680262 17:75619347-75619369 CCTGCCCACAGGAGGCTTGGAGG 0: 1
1: 1
2: 5
3: 41
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151680262 Original CRISPR CCTGCCCACAGGAGGCTTGG AGG Intergenic
900345979 1:2210459-2210481 CCTCCCCAAAGCAGGCGTGGAGG - Intronic
900594866 1:3476171-3476193 CCTGCCCTCATGAGGCCTGGGGG + Intronic
900718801 1:4161734-4161756 CCCGCCCCCATGAGGTTTGGTGG - Intergenic
900837723 1:5018840-5018862 ACTGCCCACAGGAGGCAAGTGGG - Intergenic
900875618 1:5340611-5340633 CCTGGGCACAAAAGGCTTGGGGG - Intergenic
901173952 1:7285016-7285038 CCCTCCCACAGGGTGCTTGGTGG + Intronic
901665915 1:10826062-10826084 CCTGCCCTCAGGAAGCTGTGGGG - Intergenic
902363192 1:15953487-15953509 CCCACCCGCAGGAGCCTTGGCGG - Intronic
902396142 1:16133357-16133379 TCTGCCCACAGGAGAGTTTGGGG - Exonic
902513229 1:16977187-16977209 CCTCCCCACAGCAGGCTTGCTGG - Exonic
902747854 1:18485065-18485087 CCAGCCCACAGGTCCCTTGGAGG - Exonic
903410791 1:23141336-23141358 CTTGCCCACAGGAGGCTCAAGGG - Intronic
904599951 1:31667798-31667820 CCTTTCCACTGGGGGCTTGGGGG - Intronic
904676294 1:32201110-32201132 CCAGCCGACCGGAGGCTTGGGGG + Intronic
905017568 1:34788031-34788053 CCTGGCCAAGGGTGGCTTGGAGG + Intronic
905166817 1:36087926-36087948 CCAGCCCCCATGAGGCTGGGAGG - Intronic
905945492 1:41898110-41898132 CCTGCCCCCAGGATGCTGGGAGG - Intronic
907296914 1:53461257-53461279 CCGGCCCACAGCGGGCTTGATGG + Intronic
908027504 1:59968441-59968463 CCTGCTGTCAGGACGCTTGGAGG + Intergenic
908121985 1:60994511-60994533 CCTGTATACAAGAGGCTTGGAGG - Intronic
908368398 1:63452760-63452782 CCTTCCCACATGAGCTTTGGAGG + Intronic
908550856 1:65207358-65207380 CCTGCCCTCAGGAAGCTTATAGG - Intronic
909920869 1:81379099-81379121 CCTGTGCACAGGTGGCTTGGTGG - Intronic
912568490 1:110605872-110605894 CCTGCCCAGAAGAGGCAAGGAGG - Intronic
915457482 1:156050542-156050564 CCTTCCCACAGCTGGCTTTGGGG - Exonic
917671090 1:177274270-177274292 CCTGCCCCCAGGATGCCTGCAGG - Intronic
918327670 1:183425897-183425919 CTTGCCCACACTAGGCTTGAAGG + Intergenic
919973860 1:202598508-202598530 CCTCCCCGCAGGAGGGCTGGGGG - Intronic
920813240 1:209306684-209306706 CTTGCTCAGAGGAGGCTTTGTGG - Intergenic
921726035 1:218524691-218524713 CCTGCCCACAAGAGGCTCTTGGG + Intergenic
922795747 1:228338617-228338639 CCTGCCAGCACGAGGCTGGGAGG - Intronic
1063175676 10:3548865-3548887 CCTGGCCACAGGAGGCCAGGAGG + Intergenic
1063914801 10:10870741-10870763 CCTGACCGCAGAAGGCTGGGCGG - Intergenic
1067352453 10:45488602-45488624 CCTGCCAACAGAAGGTTTGCTGG + Intronic
1069537517 10:69265822-69265844 AGTGCCCACAAGAGGCGTGGCGG + Intronic
1070304514 10:75232208-75232230 TCTCCACACAGGAGGGTTGGGGG + Intergenic
1071288927 10:84174089-84174111 ACTGCCTGCAGGTGGCTTGGGGG + Intronic
1073257214 10:102160566-102160588 ACCGCCCACAGGTTGCTTGGGGG - Exonic
1073275839 10:102310665-102310687 CCTGCTCAAATGTGGCTTGGGGG - Intronic
1073329391 10:102660861-102660883 GCTGCCCAGAGTTGGCTTGGGGG + Intergenic
1074827529 10:117225182-117225204 CCTGGCCAGAGTAGGCTTGGTGG - Intergenic
1075524217 10:123169074-123169096 CCTGCCCACATGATACCTGGGGG - Exonic
1076001989 10:126919735-126919757 CCTGCCCCCAGGGGGACTGGAGG - Intronic
1076324910 10:129613691-129613713 GATGCACACAGGAGTCTTGGCGG + Intronic
1076612802 10:131737001-131737023 CCTGCCCTCCCGAGGCTCGGGGG + Intergenic
1076685498 10:132196770-132196792 CCTGCCCACTGGAGGGTTGGGGG - Intronic
1076919666 10:133445086-133445108 CCTGCCCCCGGCAGCCTTGGAGG - Intergenic
1077088081 11:764613-764635 GGTGCCCCCAGGATGCTTGGTGG + Intronic
1077355774 11:2116075-2116097 CCTGACCACAGGAGGACTTGGGG + Intergenic
1079695570 11:23478035-23478057 ACTGCCCTGAGGAGGCTGGGAGG + Intergenic
1080587313 11:33693722-33693744 TATGCTCACAGGAGGCTTTGTGG + Intergenic
1080636684 11:34130637-34130659 CCTGTCCAAAGGAGGCAGGGTGG - Intronic
1080694193 11:34586690-34586712 CGTGTCCTCAGGAGGCTTGGGGG + Intergenic
1083143482 11:60740308-60740330 CCTGCCCACAGTAGGGTGGAAGG - Intronic
1083934723 11:65864253-65864275 CCGGCCCAGGGGAGGCTTGAAGG + Intronic
1084164257 11:67367615-67367637 CCTGCCCACAGGGGACTCGTGGG - Exonic
1084172402 11:67406816-67406838 CGTGGCCACAGGAGGCTGTGCGG + Exonic
1084323097 11:68384423-68384445 CATGGCCACAGGATGCTGGGAGG + Intronic
1084877943 11:72147663-72147685 CCTGGCCACATGAGGCCTGAGGG + Intergenic
1084921574 11:72475076-72475098 CCTTTCCAGGGGAGGCTTGGAGG - Intergenic
1085338814 11:75718135-75718157 CCTGCCCAGAGGCTTCTTGGGGG + Intronic
1087094592 11:94306915-94306937 TATCACCACAGGAGGCTTGGTGG + Intronic
1087207065 11:95408014-95408036 AATGCCTACAGGAGGCTTTGTGG + Intergenic
1087892985 11:103556283-103556305 CATGCCCACAGAGGGCATGGAGG + Intergenic
1088543855 11:110940379-110940401 CCTGCCCTCAAGAAGCTTGGTGG - Intergenic
1088760538 11:112924911-112924933 CCTGCCGACAGAAGGTTTGGTGG - Intergenic
1088761132 11:112929945-112929967 CCTGCTGACAGAAGGTTTGGTGG - Intergenic
1089879542 11:121760443-121760465 TCTGCCCTCAGGATGCTTGAAGG + Intergenic
1090940997 11:131388217-131388239 CCGGGACAGAGGAGGCTTGGTGG + Intronic
1091270899 11:134311181-134311203 CCTGGCCACAGGAGGCGGAGTGG + Intronic
1095894223 12:47264405-47264427 CCTTCCCTCTGGAGGCCTGGAGG + Intergenic
1098078908 12:66762340-66762362 CCTGGTCAGAGGAGGCTGGGAGG + Intronic
1102202947 12:111070136-111070158 ACTGCCCACAGCAGCCATGGAGG + Intronic
1102608725 12:114091983-114092005 CATGGCTAAAGGAGGCTTGGAGG - Intergenic
1103881162 12:124166963-124166985 CCTGCCCAGAGCGGGCCTGGAGG - Intronic
1104041257 12:125132791-125132813 CGTCCCCATAGAAGGCTTGGTGG + Intronic
1104274972 12:127318320-127318342 CATCCCCACAGGAGACTGGGGGG + Intergenic
1104815699 12:131644332-131644354 CCTGACCACGGGAGGCCTGCAGG + Intergenic
1105440593 13:20412730-20412752 GCTGCCTCCAGAAGGCTTGGGGG - Intronic
1105518869 13:21113934-21113956 CCTGGAGACAGGAGCCTTGGAGG + Intergenic
1106050126 13:26181650-26181672 CCTGCCCACAGAAGGAGGGGAGG + Intronic
1106504698 13:30360951-30360973 CCTGCCCACAAGAGACCTAGGGG + Intergenic
1106949591 13:34868280-34868302 GCCGCCCACAGGAAGCTTTGGGG + Intergenic
1108212925 13:48156676-48156698 CATGCCCACATGAGCCCTGGGGG + Intergenic
1112103568 13:96216690-96216712 GGTGCCCAGAGGAAGCTTGGAGG + Intronic
1112256879 13:97842180-97842202 CTTGCCCACAGGAAGGTGGGAGG - Intergenic
1113960072 13:114121259-114121281 CCTGGTCCCAGGAGGCTCGGCGG - Intronic
1120865924 14:89295114-89295136 CCTGCACCCAGGAGGCTTTTTGG + Intronic
1121345887 14:93135676-93135698 CCTGGCCCCAGCAGGGTTGGTGG + Intergenic
1122027996 14:98891675-98891697 CCTGCCCGTAGGATGCATGGAGG - Intergenic
1122066904 14:99180123-99180145 CCTGCCCACAGGTGAGCTGGAGG + Intronic
1122114919 14:99522828-99522850 CCTGCACACAGGAGGGAGGGAGG + Intronic
1122610165 14:102976939-102976961 CCAGCCCACAGGAGGCTTTCTGG - Intronic
1122976583 14:105173359-105173381 CCTGCCTACTGGAGGGCTGGAGG - Intronic
1202867794 14_GL000225v1_random:134343-134365 TCTGCCTACAGGAGGCTTTATGG + Intergenic
1123798468 15:23797655-23797677 CCTGCCCAGAAGAGGCTTTGGGG - Intergenic
1126183007 15:45804248-45804270 CGTGCCCTCTGGAGGCTTGGAGG + Intergenic
1127396941 15:58550600-58550622 CCTACCCTCAGGGGGCTCGGTGG + Intronic
1127760734 15:62136966-62136988 CCTGCCCAGAAGAGGCATGTAGG - Intergenic
1128459339 15:67854522-67854544 CCTGCAGACAGGAAGCTTGCAGG + Intergenic
1128781422 15:70361297-70361319 TCTGCCCACACCAGGGTTGGAGG + Intergenic
1129153213 15:73702244-73702266 CCTACCCCCAGGAGCCCTGGAGG + Exonic
1129153523 15:73703648-73703670 CCCGCCCCCAGGAGCCGTGGAGG + Exonic
1129461126 15:75700542-75700564 CCTGCCCACTGGTGACTTGGAGG + Intronic
1129694951 15:77735197-77735219 CCTGCCCTCTGGAAGCTTGCGGG + Intronic
1129723704 15:77891200-77891222 CCTGCCCACTGGGGACTTGGAGG - Intergenic
1130149418 15:81299915-81299937 CCTCCCCAGAGGAGGGCTGGAGG - Exonic
1130540909 15:84820201-84820223 CCTGCCCCCTGGATTCTTGGAGG + Intronic
1131218344 15:90559094-90559116 CTTGCTCCCAGGGGGCTTGGAGG - Intronic
1132601599 16:775370-775392 CCCGGCCACAGGAGTCCTGGGGG - Intronic
1132678152 16:1129208-1129230 CCTGCCCCGAGGAGGCCGGGCGG + Intergenic
1132684740 16:1157599-1157621 CCTGCCCACGAGAGGCCTGCGGG - Intronic
1132887882 16:2190402-2190424 CCTGCCCTCAGGCCGCCTGGAGG - Intronic
1133267518 16:4593949-4593971 CGTCCCCACAGCAGGGTTGGAGG - Intronic
1134588630 16:15434441-15434463 CATGCGCAGTGGAGGCTTGGAGG - Exonic
1136491726 16:30612856-30612878 CCTGCTCGCAGGACCCTTGGGGG - Intronic
1138453698 16:57108588-57108610 CCTGACCACAGGAGGCTCAAAGG + Intronic
1139277589 16:65742205-65742227 CCTGCTCCTAGGAGGCTTGAGGG - Intergenic
1139489156 16:67277495-67277517 GCTGACCACAGCAGGCTTTGTGG - Exonic
1139510884 16:67428015-67428037 TCTGCCAAGAGGAGGCATGGTGG + Intergenic
1140910892 16:79451308-79451330 CCTGTCCACAGGAGGCTAATAGG + Intergenic
1141435949 16:83999764-83999786 CCTGACCAAAGGAGGCTGAGGGG - Intronic
1141991837 16:87615108-87615130 CCTGCACACATGAGGGTTGGTGG + Intronic
1142104907 16:88297458-88297480 TCTGCCCACACGTGGCCTGGAGG + Intergenic
1142809031 17:2386765-2386787 CCTTCCCCTAGGAGGCCTGGGGG + Exonic
1144092674 17:11871970-11871992 GCTGCCCCCAGGTGGCCTGGAGG - Intronic
1144778729 17:17797468-17797490 CCTGCCCTCCGGGGGCTGGGAGG - Exonic
1147122413 17:38343494-38343516 GCTGCCCCCTGTAGGCTTGGGGG + Exonic
1148238443 17:45984228-45984250 TCAGCCCACAGGAGGTTTGGTGG + Intronic
1148339864 17:46866979-46867001 CCTGCCTGTAGGAGGCCTGGGGG - Intronic
1148731410 17:49839063-49839085 CCTGCCCACACCATGCATGGAGG + Intronic
1151325730 17:73378937-73378959 CCTGCCCTCAGGAAGCTGGAGGG + Intronic
1151458503 17:74240865-74240887 CCTGACAACATGAGGCGTGGAGG + Intronic
1151662391 17:75525725-75525747 CCTGCCCACGGGCTGCTGGGCGG - Exonic
1151680262 17:75619347-75619369 CCTGCCCACAGGAGGCTTGGAGG + Intergenic
1151981232 17:77510475-77510497 ACTGCCCACAGTAGGGGTGGGGG + Intergenic
1152126018 17:78447387-78447409 CCTGCCCACAGGAGGTCCAGAGG - Intronic
1152334296 17:79691653-79691675 CCAGACCCCAGGAGGCCTGGTGG + Intergenic
1152966696 18:122643-122665 TCTGCCCACATGGGGCTTGGAGG + Intergenic
1154032360 18:10765121-10765143 CCTGCCCGCAGGAGGCATGTGGG + Intronic
1154400627 18:14033481-14033503 CCTGCCGTCAGGATGCCTGGGGG - Intergenic
1154927291 18:20949417-20949439 ATTGCCCACATGGGGCTTGGAGG - Exonic
1155056548 18:22188841-22188863 CCTGCCCCCAGGATCCCTGGAGG - Intronic
1157276214 18:46312759-46312781 CCTGCCCAGGGGAGGCTGGCAGG + Intergenic
1160288879 18:77572198-77572220 CCTGGCCACAGGAGGCTGGGTGG + Intergenic
1160340186 18:78082972-78082994 CCGTCCCACAGGAGGCTTAGTGG + Intergenic
1160405211 18:78640880-78640902 TCTGTCCACAGGAGCCTTGGAGG - Intergenic
1160739582 19:679805-679827 CCTTCCCCCAGGAGGCGTCGGGG - Intronic
1160908729 19:1465088-1465110 CCTGCCCACCGAAGGATGGGGGG - Intronic
1161679527 19:5672892-5672914 CCTGGCCACAGAAGGAATGGAGG + Intergenic
1162027603 19:7903365-7903387 GCTGCCAGCAGGAGGCTAGGAGG + Intergenic
1162801047 19:13110624-13110646 CCTGCCCACAGAGCCCTTGGGGG - Intronic
1163097820 19:15073096-15073118 CCTGCCGACAGAAGGTTTGCCGG + Intergenic
1163328100 19:16618242-16618264 CATGACCACAGGAGGCCTGGTGG + Intronic
1163561734 19:18023374-18023396 CCTGCCCTTAGGGGGCTTGTAGG - Intergenic
1164207170 19:23068683-23068705 ACTGCCCTCAGAAGGCATGGTGG - Intergenic
1164249069 19:23461097-23461119 CCTGCCCACAGGGGGCATTGTGG + Intergenic
1164259841 19:23560032-23560054 CTTGCCCACAGGAGGCTTGATGG - Intronic
1164282037 19:23777570-23777592 CCTGCCCACAGGATGCTTTGTGG + Intronic
1164312678 19:24059902-24059924 CCTGCCCACAGGAGGCTTTGTGG + Intronic
1164752216 19:30665438-30665460 CCTGCACACAGCAGACTGGGGGG + Intronic
1165405118 19:35625565-35625587 CTTGGCCACAGTAGTCTTGGAGG - Intergenic
1165771067 19:38380641-38380663 CCAGCCCAGAGCAGGCTTGGGGG + Intronic
1165882705 19:39054792-39054814 CCTGCCTTCTGGAGGCTCGGGGG + Intergenic
1166321064 19:42019178-42019200 CGTCCTCACAGGAGGGTTGGGGG - Intronic
1166360960 19:42252880-42252902 CCTGCACGGAGGAAGCTTGGGGG + Intronic
1166838386 19:45681582-45681604 CCTGCCCAGAGGAGGCGCGGAGG - Exonic
1167160737 19:47765827-47765849 CCTGCCCACACAAGGCTGGAAGG + Intergenic
1168350870 19:55674926-55674948 CCCGCCGACAGGAGGGATGGTGG + Intergenic
927847574 2:26479440-26479462 CCAGGCCACAGGAGGATGGGAGG + Intronic
927998819 2:27505950-27505972 CCTTCCCAGGGGAGGCGTGGTGG - Intronic
928173416 2:29017943-29017965 CCTGCCCACCTGAGGCGTGGCGG - Exonic
929828224 2:45327216-45327238 CATGTCAACATGAGGCTTGGAGG - Intergenic
929947915 2:46384209-46384231 CCTGCTGCCAGGAGGCATGGGGG + Intronic
930022756 2:47011459-47011481 CCTCCCCACAGGAGGCCTCTGGG - Intronic
932449583 2:71800853-71800875 CATCCCCACTGGAGGCTTTGGGG - Intergenic
932498471 2:72159621-72159643 CGTTCCCTAAGGAGGCTTGGAGG + Intergenic
933789199 2:85870360-85870382 CCTGCCAACAAAAGCCTTGGAGG - Intronic
936057734 2:109273424-109273446 CCTGCCCCCAGGAGGTGTGCGGG + Intronic
937862701 2:126723418-126723440 CATGACCACTTGAGGCTTGGGGG - Intergenic
938727994 2:134123558-134123580 CCTGGCCCTAGGAGGCATGGAGG + Intronic
938929859 2:136077123-136077145 CCTGCCAACAGAAGGTTTGCTGG - Intergenic
940020094 2:149147153-149147175 TCTGCTTCCAGGAGGCTTGGGGG + Intronic
947719681 2:232362913-232362935 CCTGCCCCTAGCAGGCATGGGGG + Intergenic
948109119 2:235440377-235440399 CCTCGCCACGGGAGGCTGGGAGG + Intergenic
948856008 2:240730961-240730983 GCTGCCCTCAGGGGGCTTGGAGG - Intronic
948980860 2:241494074-241494096 CCAGCCCTGAGGAGGGTTGGGGG - Exonic
948989152 2:241543045-241543067 GCTGCCTCCAGGAGGCTGGGCGG - Intergenic
949052745 2:241905855-241905877 CCAGCCCACAGGTGCCTCGGTGG + Intergenic
1169343437 20:4812903-4812925 CCAGCCCACAGCAGGCTGGGAGG + Intronic
1172212286 20:33208991-33209013 ACTGCCCATAGGAGTCATGGGGG + Intergenic
1173639526 20:44591044-44591066 CTTGCCCTCAGGAAGCTTGTGGG + Intronic
1173790286 20:45823844-45823866 CCTGCCCCCAGGAGACTATGGGG + Intronic
1174210791 20:48876272-48876294 CCTGCCCACCTGAGGCTGGGTGG - Intergenic
1174548699 20:51345483-51345505 CCTGCCTGCTGGAGGCGTGGTGG + Intergenic
1174955219 20:55090429-55090451 CCTGCCACCAGGAGCCTTTGGGG - Intergenic
1175463659 20:59174200-59174222 CCTGGCCACGGGAGGCTAGCTGG + Intergenic
1175867040 20:62184390-62184412 CATGCTCACAGGAGGATTTGAGG + Intronic
1175981603 20:62741477-62741499 CTTGCCCCCAGCTGGCTTGGGGG + Intronic
1176359492 21:5982976-5982998 CCTGCCCTCAGGTCCCTTGGTGG + Intergenic
1179183180 21:39062283-39062305 GCTGCCCACGGCAGGCATGGAGG + Intergenic
1179764026 21:43555574-43555596 CCTGCCCTCAGGTCCCTTGGTGG - Intronic
1180039059 21:45266488-45266510 CCTCCCCACAGCAGGCTTCCTGG + Intronic
1180140204 21:45888621-45888643 GCTGCACACAGGAGGCTGGCGGG - Intronic
1180747846 22:18103744-18103766 CCTGCCCGGAGGAGGCTTCTTGG + Exonic
1180980532 22:19876195-19876217 CCTGTCCACAGGCATCTTGGGGG + Intronic
1183074684 22:35419423-35419445 GACACCCACAGGAGGCTTGGCGG - Intronic
1183400535 22:37601275-37601297 CCTCCCCAAAGGTGGGTTGGGGG - Intergenic
1183521314 22:38297690-38297712 ACTGCCCACAAGGGGCCTGGTGG - Intronic
1184248240 22:43246315-43246337 CCGTGCCCCAGGAGGCTTGGAGG + Intronic
1184361843 22:44023853-44023875 CCTACCCACGGGAAGCTTAGAGG - Intronic
1184938275 22:47740655-47740677 ACTTCCCACAGGAGCCTTGTTGG - Intergenic
1185071301 22:48658217-48658239 CCTGCCCTCAGGAGTGTTTGTGG - Intronic
1185272371 22:49935294-49935316 CCTGCGCAGAGCGGGCTTGGGGG + Intergenic
1185411091 22:50683542-50683564 ACTGCCCACAGGAGGTGTTGGGG + Intergenic
949950770 3:9226999-9227021 CCTGCCCACAGGAGCCAAGCAGG + Intronic
950623293 3:14225174-14225196 CCTGCCGACAGAAGGTTTGCTGG + Intergenic
950623838 3:14229906-14229928 CCTGCCGACAGAAGGTTTGCTGG + Intergenic
952129477 3:30343913-30343935 CCTGCCCAAAGAATGTTTGGAGG - Intergenic
952758508 3:36893212-36893234 CCTGTCCTCAGCAGGCTTTGAGG - Intronic
952824846 3:37516154-37516176 CATGCCCAGTGGAGGCCTGGGGG - Intronic
953833802 3:46326072-46326094 CCTGCCAACAGAAGGTTTGTTGG + Intergenic
954285625 3:49616962-49616984 CCTGGCCACAGGAGGGCTGCTGG - Intronic
954466077 3:50655608-50655630 CCTGCCCACAGGAGGCACACTGG - Intergenic
955344363 3:58150073-58150095 CCTGCTCACAGGAGCCTTCTTGG + Intronic
956464784 3:69508606-69508628 CCTGCCCAGATAAAGCTTGGAGG + Intronic
956654620 3:71536966-71536988 CCTGCCCACCTGAGCCATGGAGG + Intronic
960927950 3:122815046-122815068 CCAGCCCACAGGAGGGTAAGTGG + Intronic
961468795 3:127098331-127098353 CCTGCCCCCAGGAGCCCTGAGGG - Intergenic
966865962 3:184259436-184259458 CCTGACCCCAGGAGGCTTTCTGG - Exonic
968092414 3:195907592-195907614 CGTGCCCCCAGGGGGCTTGGCGG - Intronic
968273426 3:197422367-197422389 CCAGCACACAGGAGGCTCTGAGG + Intergenic
968704738 4:2072643-2072665 CCTGCCCCCGGGAGGATTGGTGG + Intronic
969496866 4:7531222-7531244 CCGGCTCATAGGAGGCATGGGGG + Intronic
969721855 4:8896411-8896433 CCTGACCTCAGGAGGCTGGTGGG + Intergenic
970430645 4:15986176-15986198 CCTGCCCTCAGGGGCCTGGGTGG - Intronic
971352288 4:25864357-25864379 CCTGGCCACACCAGGCATGGTGG + Intronic
971409944 4:26359666-26359688 CCCGCCGACAGGAGGGATGGTGG + Intronic
972725482 4:41743582-41743604 CCTGCCCACATGGAGCTTGTCGG + Intergenic
975560673 4:75705560-75705582 CCACCCTACAGGAGGCCTGGAGG + Intronic
976751568 4:88455494-88455516 CATGCCCACAAGGGACTTGGGGG - Intergenic
977823536 4:101503427-101503449 CATGTCCAGAGGAGACTTGGTGG - Intronic
980651581 4:135723760-135723782 CGTGCACACAGGAAACTTGGTGG - Intergenic
982105611 4:152009374-152009396 CAGGCCCACAGGAAGCCTGGAGG - Intergenic
982268103 4:153558829-153558851 CCTGCCCGGATGGGGCTTGGTGG + Intronic
984910511 4:184670085-184670107 CCTGTCCTCATGAGGGTTGGGGG + Intronic
984943828 4:184955806-184955828 CCACCCCACGGGAGGCTGGGTGG + Intergenic
986418741 5:7554968-7554990 CCTCCCCACAAGATGCTTGAAGG + Intronic
986873774 5:12081404-12081426 CCTGCCCTCAGGACCCCTGGTGG - Intergenic
987948740 5:24649788-24649810 CCTGCCAACAGAAGGTTTGCTGG + Intergenic
987955569 5:24735464-24735486 CCTGCCAACAGAAGGTTTGCTGG + Intergenic
989178932 5:38556857-38556879 CCTCACCACCGGAGGCTCGGAGG - Intronic
990580181 5:57160431-57160453 CCTTTAAACAGGAGGCTTGGCGG + Intergenic
992316901 5:75565819-75565841 CCTGCCATCAGGAGGCATTGGGG + Intronic
995544068 5:113212754-113212776 CCTGCCCACAGGGAGCTCAGAGG + Intronic
997266989 5:132500747-132500769 TCTGCACACTGGAGGCTGGGAGG + Intergenic
997356185 5:133264478-133264500 CCTGCAGACACCAGGCTTGGGGG + Intronic
999232209 5:150068370-150068392 CCTGACCTCAGGGGGCTCGGAGG - Intronic
1001283806 5:170407709-170407731 CCTGCCCTCAGGAAGCGTGTTGG - Intronic
1001474944 5:172043977-172043999 CCTGCACACAGGAGCCTGTGCGG + Exonic
1002535889 5:179875176-179875198 CCTGCCCGCAGGAGCCCTGGTGG - Exonic
1002861538 6:1084071-1084093 CCTGCACACAGGAGGCAAGGTGG - Intergenic
1002938498 6:1695691-1695713 CCTGCACACAGGGGCCTTGCAGG - Intronic
1003124999 6:3349031-3349053 CCTGCTCAGGGGAGGCTTTGTGG - Intronic
1004292054 6:14376441-14376463 CCTGCCCTCAGAAGGCTTCACGG + Intergenic
1005879230 6:30042277-30042299 CCTGCACACAGGAGTCTCTGTGG + Intergenic
1006741883 6:36314699-36314721 CCTGCCCACAGGATGCTCACAGG - Intergenic
1006831496 6:36970835-36970857 ACTGCCCAGAGAAGGCCTGGGGG + Intronic
1007341268 6:41192764-41192786 TCTGCCCTCAGGAGGCTGGGAGG + Intronic
1007702670 6:43773747-43773769 CATGCCCACAGGTTGCTTAGAGG - Intronic
1007753364 6:44083323-44083345 GGTGCCCACAGGAAGCTGGGGGG - Intergenic
1007930888 6:45689783-45689805 TCTGCACACAGGAGGCTGTGGGG - Intergenic
1011143935 6:84191199-84191221 CCTGCCCACAGGTAGCTTTAAGG - Intronic
1012469004 6:99548689-99548711 CCTGCCTACAGGAGGATTATAGG - Intronic
1012909609 6:105104245-105104267 TCTTCCCACAGGAGTCATGGAGG - Intronic
1016402767 6:143698729-143698751 TCTGCCCTTAGGAGGCTTGCAGG - Intronic
1016569061 6:145492377-145492399 CATGCCCTCAGGGGCCTTGGGGG - Intergenic
1018803154 6:167238764-167238786 CCTGCCTAGAGGCTGCTTGGAGG - Intergenic
1019105815 6:169665837-169665859 CCTCCCGACAGAAGGCCTGGTGG + Intronic
1019333867 7:473500-473522 CCTGCCCACAAGAAGCTCTGAGG + Intergenic
1019341802 7:512007-512029 CCTGTCCCCAGGAGCCTTGCCGG - Intronic
1019443040 7:1056958-1056980 GCAGCCCACAGGAGGCTCTGGGG - Intronic
1019498347 7:1351968-1351990 CCCGGCCACTGGAGGCTGGGAGG + Intergenic
1019854681 7:3592926-3592948 CCTGCCCTCTGCAGGCTTGCAGG + Intronic
1022467889 7:30663634-30663656 CCTTCCCAAAGGAGGCAGGGAGG + Intronic
1022545162 7:31180388-31180410 ACTGCCCAGAATAGGCTTGGGGG - Intergenic
1023550768 7:41367878-41367900 GCTGCCCTCAGGTGGCTTCGTGG - Intergenic
1023818302 7:43966395-43966417 TCTGCCCAGAGGAGGGTGGGAGG + Intergenic
1024059889 7:45689964-45689986 ACTGCCCACAGGGGGCCTGGAGG - Intronic
1025637467 7:63335460-63335482 CCTGCCTACAGGGGCCTTAGAGG + Intergenic
1025645230 7:63412639-63412661 CCTGCCTACAGGGGCCTTAGAGG - Intergenic
1025787635 7:64658126-64658148 CCTGCCCACAGGTGGCATTGCGG + Intergenic
1029742932 7:102501227-102501249 TCTGCCCAGAGGAGGGTGGGAGG + Exonic
1029760922 7:102600388-102600410 TCTGCCCAGAGGAGGGTGGGAGG + Exonic
1033086068 7:138343020-138343042 CCTGCCCAAAGAAGCATTGGAGG + Intergenic
1033394691 7:140962389-140962411 GGTGCACACAGGAGGCTTTGGGG - Intergenic
1034557400 7:151858872-151858894 TCTGCCCCCAGGAGTCTTGATGG + Intronic
1035233098 7:157477972-157477994 CCTGAGCAGAGGAGGCTTGCAGG + Intergenic
1035321927 7:158035515-158035537 TCTGCCCACAGGAGGGCAGGGGG + Intronic
1036656765 8:10681947-10681969 CCTGCCCACAGCAGCCTTGGCGG + Intronic
1037659851 8:20917117-20917139 CCTACCCAAATGAGGCATGGTGG - Intergenic
1038004970 8:23422233-23422255 CCTGCCGACAGAAGGTTTGCTGG + Intronic
1038056077 8:23858998-23859020 CCTTCCCACAGGAGGATCTGGGG + Intergenic
1040301220 8:46188990-46189012 CCTGCCCACAACAGCCCTGGAGG - Intergenic
1040304251 8:46203825-46203847 CCTGCCCAGAGTAGCCATGGGGG - Intergenic
1040823515 8:51591417-51591439 GCTGAACACAGGAGGCTTTGAGG + Intronic
1041558613 8:59188046-59188068 CCAGTCCACAGCAGGCTTCGGGG - Intergenic
1044303773 8:90615308-90615330 CCTGCTGACAGGGGGCTTAGTGG - Intergenic
1047401668 8:124553457-124553479 CCGGCGGACAGAAGGCTTGGTGG + Exonic
1047731541 8:127732996-127733018 CCTTCCCGCAGGAGCCTTGTAGG - Intergenic
1049449893 8:142654974-142654996 CCTGCCCCAAGGTGGCTTTGAGG + Intergenic
1049519083 8:143079159-143079181 CCTGCCCTCAGGGGTCTTGCAGG - Intergenic
1049526344 8:143128574-143128596 CCTGGCCACAGCAGGCAAGGGGG + Intergenic
1049650144 8:143762565-143762587 CATGTCCACAGGGAGCTTGGTGG - Intergenic
1049689577 8:143952797-143952819 CCTGCCCGGAGCCGGCTTGGGGG - Intronic
1049849601 8:144823669-144823691 GCTGCCCACAGGACACTTGAAGG + Intergenic
1052333666 9:27297679-27297701 CCTGCCCACAGAAGGTTTGCTGG - Intergenic
1052397840 9:27962499-27962521 CTTGCCTACAGCAGGCTTGCCGG - Intronic
1052864041 9:33454193-33454215 CCTGCCCTCAGCAGCCTTTGAGG + Intergenic
1052954235 9:34240970-34240992 GCTGCCCACAAGAGGCTTGTGGG + Intronic
1053347558 9:37389014-37389036 TCTGCCCACAGCAGGCTGGGAGG + Intergenic
1056883580 9:90418910-90418932 CCTGCCCACATCAGACTGGGGGG - Intergenic
1056896830 9:90559121-90559143 CTTGCCCACAGGAGACTGGCTGG + Intergenic
1057822427 9:98342766-98342788 GCTGCTCACAGGTGGCCTGGTGG - Intronic
1059459795 9:114422463-114422485 TCTGCCCCCTGGATGCTTGGAGG - Intronic
1059805058 9:117789893-117789915 CCTGCCCAAATGGGGCCTGGTGG - Intergenic
1060831448 9:126720191-126720213 CCTGGCCAGAGGAGGCATGAAGG - Intergenic
1061276022 9:129569697-129569719 GCTCCCCACAGGTGGCTTGGAGG + Intergenic
1061308715 9:129748570-129748592 TCTGCACACAGGGGACTTGGAGG - Intronic
1061949413 9:133927881-133927903 CCTGCTCACAGGATCCTAGGAGG - Intronic
1062289749 9:135789217-135789239 CATGGCCACAGCGGGCTTGGGGG + Intronic
1062386010 9:136311824-136311846 CCTGCCCACAGCAGGGCTGGGGG - Intergenic
1062404501 9:136388724-136388746 TCAGCCCACAGGAGTCTGGGAGG - Intronic
1062554800 9:137109078-137109100 CCGCCCCGCAGGGGGCTTGGAGG + Exonic
1203736975 Un_GL000216v2:145924-145946 TCTGCCTACAGGAGGCTTTATGG - Intergenic
1189122355 X:38408192-38408214 CCTGCCCTCAAAAGGCTTGCTGG + Intronic
1190112955 X:47606841-47606863 CTTGCCCACAGAAGGATGGGTGG + Intronic
1190176664 X:48156267-48156289 CTTTCCCAAAGGAGGCGTGGGGG + Intergenic
1196187640 X:112761726-112761748 CTTGCACACAGGAGCCATGGAGG - Intergenic
1199983939 X:152937029-152937051 CATGCCCACTGGTGGATTGGTGG - Intronic
1200244520 X:154516008-154516030 CTTGCCCACAGGAGCCTCCGGGG + Exonic
1200301297 X:154979427-154979449 CCTGCCCTCAGGCTCCTTGGTGG + Intronic
1202623837 Y:56837489-56837511 TCTGCCTACAGGGGGCTTTGTGG + Intergenic