ID: 1151680263

View in Genome Browser
Species Human (GRCh38)
Location 17:75619350-75619372
Sequence GCCCACAGGAGGCTTGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 390}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151680256_1151680263 -9 Left 1151680256 17:75619336-75619358 CCTGGGTCCTTCCTGCCCACAGG No data
Right 1151680263 17:75619350-75619372 GCCCACAGGAGGCTTGGAGGTGG 0: 1
1: 0
2: 5
3: 39
4: 390
1151680250_1151680263 16 Left 1151680250 17:75619311-75619333 CCCCCTCTGTGTGAGCAGAGGGC No data
Right 1151680263 17:75619350-75619372 GCCCACAGGAGGCTTGGAGGTGG 0: 1
1: 0
2: 5
3: 39
4: 390
1151680252_1151680263 14 Left 1151680252 17:75619313-75619335 CCCTCTGTGTGAGCAGAGGGCAG No data
Right 1151680263 17:75619350-75619372 GCCCACAGGAGGCTTGGAGGTGG 0: 1
1: 0
2: 5
3: 39
4: 390
1151680251_1151680263 15 Left 1151680251 17:75619312-75619334 CCCCTCTGTGTGAGCAGAGGGCA No data
Right 1151680263 17:75619350-75619372 GCCCACAGGAGGCTTGGAGGTGG 0: 1
1: 0
2: 5
3: 39
4: 390
1151680253_1151680263 13 Left 1151680253 17:75619314-75619336 CCTCTGTGTGAGCAGAGGGCAGC No data
Right 1151680263 17:75619350-75619372 GCCCACAGGAGGCTTGGAGGTGG 0: 1
1: 0
2: 5
3: 39
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151680263 Original CRISPR GCCCACAGGAGGCTTGGAGG TGG Intergenic
900001084 1:15222-15244 GCCCCGAGGTGGCTGGGAGGTGG - Intergenic
900020799 1:185743-185765 GCCCCGAGGTGGCTGGGAGGTGG - Intergenic
900655458 1:3754660-3754682 GAGAACAGGAGGCTTGGAGCAGG + Intronic
900718799 1:4161731-4161753 GCCCCCATGAGGTTTGGTGGTGG - Intergenic
900940097 1:5793135-5793157 TCCCACAGGAGGCAGGGAGAAGG + Intergenic
900974275 1:6007515-6007537 GCGCAGAGGAGGCGCGGAGGAGG - Intronic
900999512 1:6141792-6141814 GCCACCAGGAGGCTGGAAGGAGG + Intronic
901128086 1:6943273-6943295 GCCCTGAGGAGGCTGAGAGGAGG - Intronic
901791072 1:11654029-11654051 ACCCTCAGGAAGCTGGGAGGCGG + Intronic
901828228 1:11876495-11876517 TCCCAGAGGAAGCTTTGAGGAGG + Intergenic
902396141 1:16133354-16133376 GCCCACAGGAGAGTTTGGGGAGG - Exonic
903069555 1:20720343-20720365 CCTCACGGGAGGGTTGGAGGTGG + Intronic
903085220 1:20851303-20851325 GCTCACAGGAGGTGTGGATGTGG - Exonic
903557940 1:24206725-24206747 GCCAACAGCTGGCTTGGACGGGG + Intergenic
903653240 1:24933564-24933586 GCCCACAGGCTGCCTGGGGGAGG + Intronic
903670660 1:25033677-25033699 GACCAGAGGAGGCTTGGACGAGG - Intergenic
903944597 1:26953866-26953888 GACCACTTGAGCCTTGGAGGTGG + Intronic
904030809 1:27532400-27532422 GCCCAGAGGAGGTTTCGGGGAGG - Intergenic
904289992 1:29478644-29478666 GGCCCCAGGAGGCGTGGAGGAGG + Intergenic
904382102 1:30118594-30118616 GCCCACTGGGCCCTTGGAGGAGG + Intergenic
904413796 1:30342708-30342730 GGCCCCAGGAGGCGTGGAGGAGG - Intergenic
904755237 1:32765329-32765351 GCAGCCAGGAGGCTTGCAGGTGG + Intronic
904805324 1:33127361-33127383 GCCCTCTGGCGGCTGGGAGGAGG + Intergenic
904813081 1:33176480-33176502 GGTCACATGAGGCCTGGAGGGGG + Intronic
905270778 1:36786156-36786178 GCCCAGAGAAGGATTCGAGGAGG - Intergenic
905663038 1:39743058-39743080 ACCCACAGGTGGCTTTGGGGTGG + Intronic
906196797 1:43934742-43934764 ATCCATAGGAGGCTGGGAGGGGG + Intronic
906716810 1:47976109-47976131 GCCCCCAGGAAGCTTACAGGTGG - Intronic
907083802 1:51649985-51650007 GCTCTCAGGAGGCTGAGAGGTGG - Intronic
907519329 1:55012839-55012861 GCACCCTGGAAGCTTGGAGGAGG + Intergenic
909920868 1:81379096-81379118 GTGCACAGGTGGCTTGGTGGTGG - Intronic
912103909 1:106246510-106246532 GCTCACAGAAGGCTTGGAAGTGG + Intergenic
912933696 1:113985088-113985110 GCCCCCAGGAGCCTTGGGGAAGG - Intergenic
913671290 1:121098653-121098675 GCCGACAGCTGGCTGGGAGGGGG + Intergenic
915172087 1:153985439-153985461 GCCCCCAGCAGGCTTGGGGGAGG - Intronic
918327673 1:183425900-183425922 GCCCACACTAGGCTTGAAGGGGG + Intergenic
919536068 1:198789281-198789303 ACCCCCAGCAGGCCTGGAGGGGG - Intergenic
919833337 1:201557028-201557050 CCCCACTTAAGGCTTGGAGGGGG + Intergenic
920329227 1:205193489-205193511 GCAGACAGGAGGCTAGGAGAAGG - Intronic
921005347 1:211087709-211087731 GCCCACAGATGGCATGGAGAAGG - Intronic
924064174 1:240207246-240207268 GACCACAGAAGGGATGGAGGTGG - Exonic
924247863 1:242102559-242102581 GCCCACATCAGGGCTGGAGGTGG + Intronic
924707686 1:246512407-246512429 GCCCACAGGAGGCACAGACGGGG - Intergenic
1065814371 10:29470911-29470933 GCACGCAGGAGGCTGGAAGGTGG - Intronic
1065845962 10:29743597-29743619 GCCAACAGGAGGCTGGAAGGAGG - Intergenic
1067042152 10:42960696-42960718 GCTCAGAGGAGCCTGGGAGGAGG - Intergenic
1067830553 10:49609323-49609345 GCCCACCCGGGGCTTGGAGGAGG + Intronic
1068089140 10:52411087-52411109 GCCCAGAGGAGGAGAGGAGGGGG + Intergenic
1069911530 10:71762617-71762639 GCCCTCAGGGCACTTGGAGGAGG + Intronic
1069996459 10:72344857-72344879 GCCCACAGGCAGATGGGAGGTGG + Intronic
1071098639 10:82009794-82009816 GCCCAAAGGAGGCATGGCTGGGG - Intronic
1071891948 10:90018915-90018937 ACTCACAGGAGGCTGGGAAGAGG - Intergenic
1073329394 10:102660864-102660886 GCCCAGAGTTGGCTTGGGGGGGG + Intergenic
1074772601 10:116743120-116743142 TCCCGCAGGCGGCCTGGAGGCGG - Intergenic
1074874359 10:117602650-117602672 AACCTCAGGTGGCTTGGAGGGGG + Intergenic
1075419165 10:122288183-122288205 GCACACAGTAGGCATGCAGGAGG - Intronic
1076006339 10:126950657-126950679 GGCCACATGATGCCTGGAGGTGG + Intronic
1076057971 10:127390993-127391015 GCCCACATGCGGCTGGGAAGCGG + Intronic
1076724035 10:132405098-132405120 GCCCGCAGGAGGCTGGGCAGCGG + Exonic
1076890056 10:133279009-133279031 GCCCACTGTAGCCCTGGAGGTGG + Exonic
1077317756 11:1926962-1926984 GCCAACAGGAAGGTGGGAGGTGG + Intronic
1077323275 11:1952001-1952023 ACCCACAGGGGGCAGGGAGGAGG - Intronic
1077330965 11:1983624-1983646 GCCCACATGAGGCCTGGGGAAGG - Intronic
1077590938 11:3490570-3490592 GACCACAGGAAGCTAGGAAGAGG + Intergenic
1077976470 11:7252592-7252614 GCCCCCAGGAGCCTTGGCGATGG - Intronic
1078339460 11:10488623-10488645 TCCCACAGAAGGCAGGGAGGTGG + Intronic
1078390485 11:10931821-10931843 GCAAAGAGGAGGCTTTGAGGAGG + Intergenic
1079077493 11:17393201-17393223 GCCCTCCTGCGGCTTGGAGGAGG + Intronic
1080323522 11:31043379-31043401 GCCTTCAGGAGGCTTGAAGAAGG - Intronic
1080694194 11:34586693-34586715 GTCCTCAGGAGGCTTGGGGGTGG + Intergenic
1081068760 11:38582463-38582485 CCCCACTGTAGGATTGGAGGTGG - Intergenic
1081670268 11:44938681-44938703 CCCCCCAGGAAGCTTGGATGTGG - Intronic
1081754211 11:45533018-45533040 GCCCAAGGGAGGCAGGGAGGAGG - Intergenic
1081781931 11:45719060-45719082 GTCACCAGGAGGCTTTGAGGAGG - Intergenic
1082833645 11:57637675-57637697 GCCCACAAGGGGCTCTGAGGTGG - Intergenic
1083272542 11:61579723-61579745 GCCCCCAGGAGGCTGGCAGGAGG + Intronic
1083479782 11:62936419-62936441 GTCCTCAGGAGGCTTGGAGTGGG + Intronic
1083593800 11:63909721-63909743 GCCCACAGTGGGCCTGGCGGAGG - Exonic
1083753779 11:64778302-64778324 GCCCAAAGGAGGCTTCGAGCCGG - Exonic
1084100488 11:66944884-66944906 GGCCCCAGGAAGCTTGTAGGTGG - Intronic
1084423650 11:69072719-69072741 GCCCAGAGGAGGCTGGGAGCAGG - Intronic
1084566115 11:69930123-69930145 GCCCAGAGGAGGGTGGGAAGGGG - Intergenic
1085282501 11:75340428-75340450 CCCCAGAGGGGCCTTGGAGGAGG - Intronic
1085348274 11:75781992-75782014 GCCCCCATGCAGCTTGGAGGAGG - Intronic
1086091444 11:83008804-83008826 GTCCACAGTAGGCTGGGTGGGGG - Intronic
1088760537 11:112924908-112924930 GCCGACAGAAGGTTTGGTGGAGG - Intergenic
1088906093 11:114156498-114156520 GGCCACAGCAGGCTCTGAGGAGG - Intronic
1089061304 11:115628248-115628270 ACCCCCAGCAGGGTTGGAGGTGG - Intergenic
1089114518 11:116083453-116083475 GCCCTCAGGGAGCTTGGAGCTGG - Intergenic
1089496152 11:118909596-118909618 CCCCACAGTAGGGTGGGAGGGGG + Intronic
1089660188 11:119980639-119980661 GCCTAGGGAAGGCTTGGAGGGGG + Intergenic
1089708759 11:120299928-120299950 CCCAACAGGAGGCTGGGAAGGGG - Intronic
1090492232 11:127174996-127175018 GCCCTCAGGATGCTTGTAGATGG + Intergenic
1090761211 11:129838252-129838274 GGCCACAAGAGGCTTGGTTGTGG + Intronic
1091030895 11:132186853-132186875 CCCCACAGGGGGCTCGGAAGCGG - Intronic
1091175677 11:133555208-133555230 GCCCACTGGAGACTTGGACTAGG - Intergenic
1202806263 11_KI270721v1_random:7196-7218 ACCCACAGGGGGCAGGGAGGAGG - Intergenic
1202813945 11_KI270721v1_random:38803-38825 GCCCACATGAGGCCTGGGGAAGG - Intergenic
1091374173 12:15337-15359 GCCCCGAGGTGGCTGGGAGGTGG - Intergenic
1091587045 12:1822416-1822438 GGGCACAGGAGGCTTGGCTGGGG - Intronic
1091852864 12:3714367-3714389 GCCAACAGGTGGCTTAGAGAGGG - Intronic
1092417224 12:8299567-8299589 GACCACAGGAAGCTAGGAAGAGG + Intergenic
1093800613 12:23367461-23367483 GCCAAAGGGAGGCTGGGAGGAGG + Intergenic
1094403993 12:30094889-30094911 GTGCAGAGGAGACTTGGAGGAGG - Intergenic
1102023893 12:109702264-109702286 GCCCAGGGGAGGGTAGGAGGAGG + Intergenic
1102033687 12:109759143-109759165 GCAGTCAGGAGACTTGGAGGTGG - Intronic
1103933582 12:124463490-124463512 GCTCCCAGGAGGCGGGGAGGCGG + Intronic
1104041259 12:125132794-125132816 CCCCATAGAAGGCTTGGTGGTGG + Intronic
1104398832 12:128459086-128459108 TCCCACTGCAGCCTTGGAGGAGG + Intronic
1104676857 12:130716991-130717013 GGCCACTGGAGGCTTGGGGTGGG - Intergenic
1104837296 12:131799909-131799931 GACCGCAGGAGGCGTGGAGACGG - Intergenic
1105071105 12:133235228-133235250 GCCTGCAGGGGCCTTGGAGGAGG + Exonic
1105206608 13:18231048-18231070 GCCCACTGGAGGGTGGGAGGTGG - Intergenic
1105255519 13:18741926-18741948 GCCCTCAGGAGAATGGGAGGAGG + Intergenic
1105541610 13:21321181-21321203 GCCCCCAGGAGCCAAGGAGGGGG - Intergenic
1106205909 13:27594369-27594391 GCAAACAGGAGGCTTGGGAGAGG - Intronic
1106505913 13:30370379-30370401 GCCCATAGGATGTTTGGGGGTGG - Intergenic
1107129927 13:36884332-36884354 GCCAGCAGGAGGCTTTGTGGGGG - Intronic
1107312362 13:39092986-39093008 GAACACAGGATGCTTGGAGAGGG + Intergenic
1109845459 13:67983921-67983943 TCCAACAGGAGGCCTGGAAGTGG + Intergenic
1111993458 13:95139304-95139326 GCCCAAAGGAGGGATGAAGGAGG + Intronic
1112414103 13:99190139-99190161 GCCCACAGGCGCCATCGAGGAGG - Intergenic
1113597799 13:111547023-111547045 GCCCACAGGAAGTGTGGATGTGG + Intergenic
1113766129 13:112882110-112882132 GCCCCCAGCAGGCAAGGAGGGGG + Exonic
1114528385 14:23380144-23380166 GCCCACAGGACGCAGGGAGAGGG + Intergenic
1117724849 14:58662862-58662884 AACCACAGGAGGCTTGCAGGGGG - Intergenic
1118834535 14:69467547-69467569 GACCACTTGAGGCTAGGAGGTGG + Intergenic
1120190439 14:81435807-81435829 GCCCAGAGGCGGCCTGGACGTGG - Intronic
1120323326 14:82993616-82993638 GCCTACTGGAGGGTGGGAGGTGG - Intergenic
1121275950 14:92667760-92667782 GCATAGAGGAGGTTTGGAGGTGG + Intronic
1121283296 14:92714840-92714862 GGCCACAGGAGGCCTGGAGGGGG - Intronic
1122114246 14:99520024-99520046 GCCCAGTGGAGGGTGGGAGGTGG - Intronic
1122406740 14:101505321-101505343 CTCCACAGCAGGCTTGGAGATGG + Intergenic
1122491299 14:102117585-102117607 GCCCCGAGGAGACCTGGAGGAGG - Intronic
1122967793 14:105139329-105139351 GCACTCAGGAGGTGTGGAGGTGG + Intergenic
1124021693 15:25931262-25931284 GCCTAGAGGAGGCTTGGTGCTGG + Intergenic
1124492580 15:30167317-30167339 GCCTCCAGGAGTCTTGGGGGTGG - Intergenic
1124750954 15:32371008-32371030 GCCTCCAGGAGTCTTGGGGGTGG + Intergenic
1125665806 15:41429164-41429186 GCTCACAGGTGGCTTACAGGTGG - Intronic
1126839923 15:52708009-52708031 AACCTCAGGAGGCTTGGAGATGG + Intronic
1128391679 15:67186836-67186858 CCCCACAGGAAGCTTGGCAGAGG - Intronic
1128458039 15:67843912-67843934 GGCCAGAGCAGGGTTGGAGGAGG + Intergenic
1128532463 15:68463954-68463976 GCCCACAGGCGGCTGTGGGGTGG + Intergenic
1128687634 15:69698650-69698672 GCCCAAAGAAGGCCTGGAAGAGG + Intergenic
1129276211 15:74447401-74447423 GCCCATGGGAGGCTTTAAGGAGG - Intronic
1129785144 15:78304790-78304812 GCAGACAGGAGGCCTGGAGAGGG - Intergenic
1130371466 15:83288456-83288478 GCCCACCAGTGGCCTGGAGGAGG + Intergenic
1131055205 15:89370870-89370892 GGCCAGAGGAGGCTTGGGGAAGG - Intergenic
1132011154 15:98277715-98277737 GGCCAGAGGAGGTTAGGAGGAGG - Intergenic
1132780224 16:1620213-1620235 TGCCTCAGGAGACTTGGAGGTGG + Intronic
1133356315 16:5139603-5139625 GACCACAGGAAGCTAGGACGAGG + Intergenic
1134039083 16:11054080-11054102 GCCCACAGGAGGATGTGATGAGG + Intronic
1134645714 16:15863998-15864020 GACCACTTGAGCCTTGGAGGCGG + Intergenic
1135994630 16:27238718-27238740 GACAAAAGGAAGCTTGGAGGTGG + Intronic
1136011053 16:27363612-27363634 GCCCTCAGGGGGGTTGTAGGGGG - Exonic
1136024551 16:27461337-27461359 GCCCACAGGGGTCCTAGAGGTGG + Exonic
1137770303 16:51011115-51011137 GCCTACAGCTGGCTGGGAGGGGG + Intergenic
1138582866 16:57952963-57952985 GCCCCCAGGAGGCGTGGTGCAGG + Intronic
1139510887 16:67428018-67428040 GCCAAGAGGAGGCATGGTGGGGG + Intergenic
1141386445 16:83626095-83626117 GACCATTGGAGCCTTGGAGGTGG - Intronic
1141422736 16:83927187-83927209 GACCACAGGAGGCTCGGACTGGG - Intronic
1142169870 16:88616051-88616073 GATCCCAGGAGGCTTGGAGAGGG + Intronic
1142507317 17:372871-372893 GCCCCCAGCAGGATTGGAAGTGG + Intronic
1142851397 17:2706511-2706533 GTCCACTGCAGGCTTGGAGAGGG - Intronic
1142868777 17:2807534-2807556 GCCCACAGAAAGGATGGAGGGGG + Intronic
1142876962 17:2857009-2857031 GGCCACGGGAGGCCTGGAGCAGG + Intronic
1144487000 17:15674871-15674893 GCCCACAGGAGGGTATGAGCTGG + Intronic
1144914028 17:18707429-18707451 GCCCACAGGAGGGTATGAGCTGG - Intronic
1145392671 17:22467995-22468017 GCCCACAGGTGGCCTGCAGCAGG + Intergenic
1145905107 17:28511975-28511997 GCCCACAGGAGGCTGGGGGTGGG + Intronic
1145909833 17:28536071-28536093 GGCCACAGGAGGTTTGGAACGGG + Intronic
1146683443 17:34824714-34824736 GCCCAGAGGAGGGTGAGAGGTGG + Intergenic
1147423453 17:40334058-40334080 GCTCATTGGAGGGTTGGAGGTGG + Intronic
1148456815 17:47815607-47815629 GCACACAGAGGGCTTGGAGTGGG - Intronic
1148469332 17:47883764-47883786 GCCCCCAGGTGCATTGGAGGTGG - Intergenic
1149658974 17:58324632-58324654 GAGCACGGGAGGCTTGGAGGTGG + Intronic
1150056826 17:62024685-62024707 GTCCAGTGGAGGCTGGGAGGAGG - Intronic
1151475686 17:74343251-74343273 GCTCACAGTAGGCATGCAGGAGG - Intronic
1151680263 17:75619350-75619372 GCCCACAGGAGGCTTGGAGGTGG + Intergenic
1151916328 17:77120878-77120900 CCCCACAGGAGACTTGGACTCGG + Intronic
1151981233 17:77510478-77510500 GCCCACAGTAGGGGTGGGGGTGG + Intergenic
1152044678 17:77928124-77928146 GCAGACAGGAGGCCTGGATGGGG + Intergenic
1152103596 17:78316489-78316511 TGCCACAGGAGGCTTGGAATGGG - Intergenic
1152597270 17:81243864-81243886 GCCGGGAGGAGGCTGGGAGGGGG - Intergenic
1152610779 17:81314147-81314169 CCCCACAGGAGGCCTGGATGGGG - Intronic
1154032361 18:10765124-10765146 GCCCGCAGGAGGCATGTGGGAGG + Intronic
1155626124 18:27836667-27836689 GACATCAGGAGTCTTGGAGGTGG - Intergenic
1157802067 18:50628729-50628751 GCCCACAGGAGGAATGTGGGTGG - Intronic
1158243647 18:55406102-55406124 GCCAGCAGGAGGCTGGGAGGTGG + Intronic
1158505638 18:58044282-58044304 GCGCAGAGGAGGCTCGGAGGGGG + Intergenic
1159875968 18:73811526-73811548 GACCACTGGGGGCTGGGAGGTGG + Intergenic
1160175730 18:76592555-76592577 GCCCAGAGGGGGCTGGGGGGTGG - Intergenic
1160226337 18:77014309-77014331 GAGCACAGGAGGGTGGGAGGAGG + Exonic
1160536459 18:79597080-79597102 GACCACAGGAGGTGTGGAGTGGG + Intergenic
1160867252 19:1261355-1261377 TCAGACAGGAGGCTAGGAGGAGG + Intronic
1160988700 19:1851941-1851963 GAGCACAGGAGCCTGGGAGGCGG + Intergenic
1161220261 19:3115083-3115105 GGCCACAGCAGGCGGGGAGGGGG + Intronic
1161659970 19:5539915-5539937 CCCCACAAGGGGCATGGAGGGGG + Intergenic
1161754956 19:6125891-6125913 CCCGACAGGAGCCTTGGATGAGG + Intronic
1161990329 19:7681004-7681026 CCCCTCAGGAGGCTGCGAGGAGG + Intronic
1162333052 19:10042191-10042213 GCCTATAGGAGACTTGGAGTAGG - Intergenic
1162936509 19:13984122-13984144 GACCACAAGGGGCTTGGAGTGGG + Intronic
1163323619 19:16588937-16588959 GCCCGCTGGATGCTGGGAGGGGG + Intronic
1163548569 19:17952778-17952800 GCGCACAGTAGGCTGGCAGGTGG - Intronic
1163561733 19:18023371-18023393 GCCCTTAGGGGGCTTGTAGGTGG - Intergenic
1163611521 19:18304370-18304392 GCCCAGAGGAGGAGAGGAGGAGG + Intergenic
1163630435 19:18415556-18415578 GCCCAGGGAAGGCTTGGAGGAGG + Intergenic
1163669147 19:18617442-18617464 GACCACAGAACGCTGGGAGGCGG - Intronic
1164514543 19:28922661-28922683 GTGCACATGAGACTTGGAGGGGG - Intergenic
1164947578 19:32309480-32309502 GCCCACAGGGCTCTTGGATGGGG - Intergenic
1165245419 19:34495782-34495804 GCCCACAGGAGGCTGGCAGCTGG + Intronic
1165384216 19:35500978-35501000 CCCCACAGGGTGCTTGAAGGAGG + Intronic
1165407222 19:35638208-35638230 CCCCAGAGGAGACTTGGGGGTGG - Intergenic
1165993376 19:39828222-39828244 GCCAACGGGAGGCTTAGGGGCGG - Intronic
1166059383 19:40316138-40316160 GCCCAAAGGAGGGGTGGAGGTGG + Intergenic
1166323736 19:42036463-42036485 CCACTCAGGAGGCTGGGAGGTGG - Intronic
1166378001 19:42338568-42338590 GCCTACCTGAGGGTTGGAGGAGG - Intronic
1167106435 19:47432431-47432453 GCCCACAGGGGACGAGGAGGAGG - Exonic
1167506292 19:49872849-49872871 GCCCGCAGGAGGCTTTGTCGGGG - Intronic
1167538130 19:50068445-50068467 GTCCCCGGGAGGCTGGGAGGTGG - Intergenic
1167586789 19:50379885-50379907 GCCCAGGGGAGGCTTCGGGGAGG + Intronic
1168228752 19:55015216-55015238 GCCCAGATGTGGCTTGGAGGGGG - Intronic
925157692 2:1660176-1660198 GGCCACAGGAGACATGGAGAAGG + Intronic
925298435 2:2793214-2793236 GCCCAGAGAAGTCTGGGAGGAGG + Intergenic
925327739 2:3036359-3036381 ATCCACAGGAGTCCTGGAGGAGG - Intergenic
925576742 2:5368192-5368214 GCCCTGAGGAGGCTTTGAAGAGG + Intergenic
926152883 2:10434593-10434615 CCCCACAGGAGGGGTGGCGGGGG + Intergenic
927519252 2:23689256-23689278 GGCCACAGGAGGCATGGCTGTGG - Intronic
928932554 2:36639010-36639032 GCCTACAAGAGGGTAGGAGGAGG + Intronic
930015907 2:46970438-46970460 GCCCTCTGGAGGCTTGGGGCTGG + Intronic
931179517 2:59885517-59885539 GCCCACTGGAGGCTCGGTCGGGG - Intergenic
932449581 2:71800850-71800872 CCCCACTGGAGGCTTTGGGGAGG - Intergenic
934059881 2:88283897-88283919 GCCCCCAGGAGCATTGGAGCAGG - Intergenic
934654230 2:96108935-96108957 GGCAACAGGAGGCTTGGAGGAGG + Intergenic
936155877 2:110047259-110047281 CCCCACAGCAGCCCTGGAGGTGG + Intergenic
936188811 2:110324169-110324191 CCCCACAGCAGCCCTGGAGGTGG - Intergenic
937230621 2:120396253-120396275 GCCCTCAGGAGCCCTGGCGGAGG + Intergenic
937339586 2:121082612-121082634 ACCCACAGGAAGCTTGGGGAGGG + Intergenic
938727995 2:134123561-134123583 GGCCCTAGGAGGCATGGAGGAGG + Intronic
939369193 2:141276446-141276468 GCCTACTTGAGGCTGGGAGGTGG - Intronic
940145624 2:150542408-150542430 GCCCACAGCAGGTCTGGTGGGGG + Intergenic
940809766 2:158229248-158229270 GCCCAGAGGATGATTGGAAGTGG - Intronic
944247639 2:197547749-197547771 GCCCTCAGGAGGACTGGATGAGG + Intronic
945775352 2:214100533-214100555 GCCCACATGAGGGTGGAAGGTGG - Intronic
946168153 2:217877902-217877924 CCCACCAGGAGACTTGGAGGAGG - Intronic
948109120 2:235440380-235440402 CGCCACGGGAGGCTGGGAGGTGG + Intergenic
948253748 2:236551325-236551347 CCCCACTGGTGGCTTGGAGCTGG + Intergenic
948387662 2:237591607-237591629 TCTCAGAGGAGGCTTGGACGTGG - Intronic
948461702 2:238132810-238132832 GCCCACAGGGACTTTGGAGGTGG + Exonic
949051984 2:241902452-241902474 TGGCACAGGAGGCTTGGAGGCGG - Intronic
1169264172 20:4157616-4157638 GCCCACAGAAGGTTTTGAGCAGG + Intronic
1170390272 20:15865761-15865783 ACCAACAGGAAGCCTGGAGGTGG + Intronic
1170578076 20:17679919-17679941 GGCCAGTGGAGGCCTGGAGGAGG - Intronic
1173005551 20:39137269-39137291 GAACACAAGAGGTTTGGAGGAGG + Intergenic
1174374076 20:50113682-50113704 GGCCAGAGAAGGCTTGGAGTGGG + Intronic
1175714983 20:61249437-61249459 GACCACAGCTGGCCTGGAGGAGG - Intergenic
1175815550 20:61881521-61881543 GACCACTGGAGGCTCTGAGGCGG - Intronic
1175867041 20:62184393-62184415 GCTCACAGGAGGATTTGAGGAGG + Intronic
1176010798 20:62893904-62893926 TCCCACAGGAGGCTGGGCAGGGG + Exonic
1178480224 21:32973993-32974015 CTCCTCAGGAGGCTGGGAGGTGG + Intergenic
1179101019 21:38355640-38355662 GCCAGCAGGAGACTTGAAGGTGG + Intergenic
1179104311 21:38384282-38384304 GCTGCAAGGAGGCTTGGAGGAGG + Intronic
1179959402 21:44759617-44759639 GCTCACAGGGGGCTGGCAGGAGG - Intergenic
1180069586 21:45429763-45429785 GCCCAGAGGAGGTGGGGAGGGGG - Intronic
1180140203 21:45888618-45888640 GCACACAGGAGGCTGGCGGGAGG - Intronic
1180699372 22:17773378-17773400 ACCCACAGGAGGCTTTGAGATGG - Intronic
1180759336 22:18187656-18187678 GCCTACTGGAGGGTGGGAGGTGG + Intergenic
1180769644 22:18371952-18371974 GCCTACTGGAGGGTGGGAGGTGG + Intergenic
1180776684 22:18490714-18490736 GCCTACTGGAGGGTGGGAGGTGG - Intergenic
1180809411 22:18748080-18748102 GCCTACTGGAGGGTGGGAGGTGG - Intergenic
1180827584 22:18874915-18874937 GCCTACTGGAGGGTGGGAGGTGG + Intergenic
1180897045 22:19343474-19343496 GCCCACTTGAGCCTGGGAGGTGG + Intronic
1181072332 22:20353066-20353088 GCCTACTGGAGGGTGGGAGGTGG - Intronic
1181195403 22:21182000-21182022 GCCTACTGGAGGGTGGGAGGTGG - Intergenic
1181214044 22:21310774-21310796 GCCTACTGGAGGGTGGGAGGTGG + Intergenic
1181269653 22:21651800-21651822 GTTCACAGCAGGCTTGGCGGGGG + Intergenic
1181457534 22:23068226-23068248 GGCCATAGCAGGCGTGGAGGTGG - Intronic
1181492705 22:23270451-23270473 GCTCACAAGAGCCTGGGAGGCGG - Intronic
1182087249 22:27569612-27569634 GTCCACAGGAGGGTGGGAGCAGG + Intergenic
1182518671 22:30873030-30873052 GCTCCCTGGAGGTTTGGAGGTGG - Intronic
1184292446 22:43505302-43505324 CCTCACAGCAGGCTTGGAAGTGG + Intronic
1184398274 22:44258468-44258490 GCCCACTGGAGGCCGGAAGGTGG - Intronic
1184406702 22:44304621-44304643 GCCAGAAGGAGGCTGGGAGGAGG - Intronic
1184546572 22:45173638-45173660 GGCGACAGGAGGCATGCAGGTGG + Intronic
1184567255 22:45299420-45299442 GCCCCCAGGAAGATGGGAGGTGG - Intergenic
1185316539 22:50181608-50181630 CCACAGAGGAGGCCTGGAGGGGG + Intergenic
1203231475 22_KI270731v1_random:113139-113161 GCCTACTGGAGGGTGGGAGGTGG + Intergenic
1203277681 22_KI270734v1_random:100905-100927 GCCTACTGGAGGGTGGGAGGTGG + Intergenic
950407582 3:12814299-12814321 GCACACAGGAGGCTCAGAGGGGG - Intronic
950661233 3:14468289-14468311 GACCCCAGGGGGCTTTGAGGGGG + Intronic
950965436 3:17142736-17142758 GCCCACAGCAGGGCTGGACGGGG - Intergenic
952278856 3:31903964-31903986 GCCCACAGAATCCTTTGAGGAGG - Intronic
954383994 3:50234962-50234984 GGCCACAGGAGGGTGGGATGTGG + Intronic
954422841 3:50427614-50427636 GCCCAGAGAAGGGTGGGAGGAGG + Intronic
956126007 3:66011508-66011530 GCCAACACAAGTCTTGGAGGGGG - Intronic
958807481 3:98829433-98829455 GCCTACTGGAGGGTGGGAGGAGG - Intronic
959083556 3:101827816-101827838 GGCCAGAGGAGGCAGGGAGGGGG - Exonic
959863617 3:111242561-111242583 GCTCACAGGAGACCTGCAGGAGG + Intronic
961292413 3:125858349-125858371 GACCACAGGAAGCTAGGAAGAGG - Intergenic
961663703 3:128483829-128483851 GGGCACAGGTGGCTGGGAGGGGG - Intronic
961796716 3:129414384-129414406 TCACACAGGAGCCCTGGAGGAGG - Intronic
961894772 3:130158058-130158080 GACCACAGGAAGCTAGGAAGAGG + Intergenic
962240184 3:133745753-133745775 TCCCACAGGAAGCTTGAGGGCGG + Intergenic
962753560 3:138451750-138451772 GCCCACGCGAGCCTTGGAGCTGG + Intronic
963290093 3:143478455-143478477 GTCAGCAGGAGGCTGGGAGGTGG + Intronic
964240405 3:154586076-154586098 GCCTAGAGGAGTCTTGTAGGTGG - Intergenic
964847111 3:161056087-161056109 GCCTACAGAAAGGTTGGAGGGGG + Intronic
966974436 3:185071844-185071866 GCCCTCAGGAGGAGTGGAGATGG - Intergenic
967892423 3:194372683-194372705 GCCACCAGGAGTTTTGGAGGAGG + Intergenic
968599993 4:1504249-1504271 GGCCACAGGAGGCCTGGACCTGG + Intergenic
968699217 4:2046886-2046908 CTCCACAGGAGGCCGGGAGGTGG - Intergenic
968747151 4:2365910-2365932 ACCTACAGGAGGGGTGGAGGTGG + Intronic
968968107 4:3779599-3779621 GCCCACAGGAGGCATGGCCTTGG - Intergenic
969342368 4:6550214-6550236 GGGAACAGGAAGCTTGGAGGTGG - Intronic
969496867 4:7531225-7531247 GCTCATAGGAGGCATGGGGGAGG + Intronic
969809029 4:9633575-9633597 GACCACAGGAAGCTAGGACGAGG - Intergenic
970640917 4:18065044-18065066 GTCCACAGGAGGCTTTGAGAAGG - Intergenic
970714836 4:18908817-18908839 GCCCACTTGAGAGTTGGAGGAGG + Intergenic
972796945 4:42430628-42430650 GCCCACCGGAGGGTGGAAGGTGG - Intronic
973705120 4:53573541-53573563 GCCCTCAGGAGACTGGGGGGTGG + Intronic
973730253 4:53816124-53816146 GCTCACAGGATGCTAGGAGCTGG - Intronic
974935411 4:68404947-68404969 GACAACTGGAAGCTTGGAGGGGG - Intergenic
975560675 4:75705563-75705585 CCCTACAGGAGGCCTGGAGGAGG + Intronic
979700293 4:123659122-123659144 ACCCAGAGAGGGCTTGGAGGAGG + Intergenic
981019671 4:140012394-140012416 GCATACAGGAGGCTGGGAAGAGG - Intronic
982105610 4:152009371-152009393 GCCCACAGGAAGCCTGGAGGAGG - Intergenic
983008466 4:162515766-162515788 GCCCAGAGGAGGGCTGGTGGGGG + Intergenic
983784607 4:171715768-171715790 GCTCAGAGGAGGCCTGCAGGGGG - Intergenic
984360085 4:178718374-178718396 GCCAAGAAGAGGCTTGAAGGTGG - Intergenic
984387072 4:179074431-179074453 TCCCACTGGAGGGTGGGAGGAGG + Intergenic
986248467 5:6032385-6032407 ACACACAGGAGGGTTGGAGATGG + Intergenic
986264069 5:6177574-6177596 GCCCACTGGAGGGTGGAAGGTGG + Intergenic
991419512 5:66426864-66426886 CACCACTGGGGGCTTGGAGGAGG - Intergenic
992367230 5:76105225-76105247 TCCCTCTGGAGGCTTTGAGGAGG - Intronic
992449835 5:76866169-76866191 GACCACTTGAGGCTGGGAGGTGG - Intronic
995537289 5:113150006-113150028 GCCCACAGGAAGATTTGAAGAGG + Intronic
997593645 5:135091721-135091743 GCTGACAGGAGAGTTGGAGGGGG + Intronic
997618497 5:135269887-135269909 GTCCTCAGGAGGCTCGGGGGTGG + Intronic
998139244 5:139690563-139690585 GGCCATGGGAGGCTTGGGGGTGG + Intergenic
998890723 5:146742936-146742958 GACCACAGGAGGCTAGGAGAGGG + Intronic
999127162 5:149254258-149254280 TCCTATAGGAGGGTTGGAGGAGG - Intronic
1000546674 5:162611175-162611197 TTCAACATGAGGCTTGGAGGGGG - Intergenic
1001302659 5:170547523-170547545 GCCCACCAGAGGGTGGGAGGAGG - Intronic
1001441703 5:171748808-171748830 GACCTCAGAAGGCCTGGAGGGGG + Intergenic
1001529628 5:172453343-172453365 GCCCACATGAGGCCTTGGGGAGG - Intronic
1002428866 5:179191657-179191679 GCCCACACCAGGCTTGGAGCCGG + Intronic
1002575374 5:180171092-180171114 GGCCACAGGATGCCTGGATGGGG - Intronic
1002600918 5:180353472-180353494 GCCCCCAGGAGCCAGGGAGGGGG + Intergenic
1002932963 6:1646958-1646980 GCCCACAGGAGCCATCAAGGTGG - Intronic
1003147747 6:3523168-3523190 TCCCACAGGAGCCTTGGGGATGG + Intergenic
1004027600 6:11834289-11834311 GCCCACAGCCAGCTTGCAGGTGG + Intergenic
1004310011 6:14537002-14537024 GCCCACAATAGGCCTGAAGGTGG + Intergenic
1004866434 6:19857459-19857481 GCCCACAGGGGCCTGGAAGGAGG + Intergenic
1005917848 6:30369654-30369676 GCCTATTGGAGGCTGGGAGGAGG + Intergenic
1006437394 6:34033104-34033126 TCCCACAGCAGGCCTGGTGGAGG + Intronic
1007083954 6:39129605-39129627 TCACTGAGGAGGCTTGGAGGAGG - Intergenic
1007341269 6:41192767-41192789 GCCCTCAGGAGGCTGGGAGGTGG + Intronic
1007623669 6:43229882-43229904 GCCCAGAGGAGGCTTAGACCAGG - Intergenic
1008255508 6:49295157-49295179 GCCTACAAGAGGGTGGGAGGAGG + Intergenic
1010732629 6:79406806-79406828 GCCCACTATAGGCTTGCAGGTGG - Intergenic
1011002608 6:82607864-82607886 GCACACAGGAGCCTTGAAGAAGG - Intergenic
1011540471 6:88422229-88422251 GCACAGAGGAGGCTTCCAGGGGG + Intergenic
1011751895 6:90462033-90462055 GCCCACAAGAGGACTCGAGGTGG - Intergenic
1013290211 6:108713060-108713082 GCCCACAGCTGGATGGGAGGAGG + Intergenic
1013363646 6:109418301-109418323 GCCCCCAGGAAGGTTGGAAGAGG - Intronic
1013587724 6:111594518-111594540 GCCATCTGGGGGCTTGGAGGAGG + Intronic
1014705963 6:124747723-124747745 GCCCACAAGAGAAATGGAGGAGG + Intronic
1016569060 6:145492374-145492396 GCCCTCAGGGGCCTTGGGGGTGG - Intergenic
1018803153 6:167238761-167238783 GCCTAGAGGCTGCTTGGAGGTGG - Intergenic
1018812544 6:167308330-167308352 GCCCACGGGACGATGGGAGGTGG + Intronic
1019267197 7:124496-124518 GCCCCCCCGAGGCTGGGAGGAGG + Intergenic
1019599134 7:1872787-1872809 GCACACAGAAGGCTCGGAGCTGG - Intronic
1020761100 7:12269256-12269278 GCAGACAGGAGGCATGGATGGGG + Intergenic
1021633015 7:22665219-22665241 GCCCGGAGGAGGCGGGGAGGTGG - Intergenic
1023818305 7:43966398-43966420 GCCCAGAGGAGGGTGGGAGGGGG + Intergenic
1024861927 7:53854037-53854059 ACCAACAGGAGGTCTGGAGGTGG + Intergenic
1027239615 7:76318483-76318505 GCTCCCAGGTGGGTTGGAGGCGG + Intergenic
1027567464 7:79814473-79814495 AACCACCTGAGGCTTGGAGGAGG + Intergenic
1029742935 7:102501230-102501252 GCCCAGAGGAGGGTGGGAGGGGG + Intronic
1029760925 7:102600391-102600413 GCCCAGAGGAGGGTGGGAGGGGG + Intronic
1030269166 7:107652130-107652152 TCCCACACCTGGCTTGGAGGAGG - Intergenic
1031180009 7:118402168-118402190 GCCTACAGGAGGGTGGAAGGTGG - Intergenic
1031359323 7:120828431-120828453 GCTCACAGTGGGCTTGGAGAAGG - Intronic
1035570275 8:667956-667978 TCCCAGAGGAGGAGTGGAGGAGG - Intronic
1037583475 8:20260793-20260815 GCTCTCAGGAGGACTGGAGGTGG - Intronic
1037730713 8:21521285-21521307 GCCCGCAGAAGGCTTGGCGATGG + Intergenic
1037828979 8:22177192-22177214 GCCCCCAGGGGTCCTGGAGGTGG - Intronic
1039504483 8:38042107-38042129 GCCTGCAGGACACTTGGAGGGGG - Intronic
1039563031 8:38528363-38528385 CCCCACAGCAGCCTTGGTGGAGG + Exonic
1041558612 8:59188043-59188065 GTCCACAGCAGGCTTCGGGGTGG - Intergenic
1041997120 8:64076258-64076280 GCCCAAAGGAGGACAGGAGGCGG + Intergenic
1043446549 8:80325198-80325220 GCACACCAGAGGCTTGGAGATGG - Intergenic
1043528440 8:81122468-81122490 GGCCACAGGAGAATTGAAGGAGG + Intergenic
1044954531 8:97465682-97465704 GCCCACTGGAGGTCTGGAGAGGG + Intergenic
1045760118 8:105595468-105595490 GCCCACAGAAGGCTTCCAGAAGG + Intronic
1047254858 8:123207255-123207277 GCCCATCACAGGCTTGGAGGAGG - Exonic
1048252912 8:132882073-132882095 GCCCACAGCAGCCTGGCAGGGGG - Intronic
1048929337 8:139298711-139298733 GCCTACTGGAGGGTGGGAGGAGG - Intergenic
1049449894 8:142654977-142654999 GCCCCAAGGTGGCTTTGAGGAGG + Intergenic
1049519082 8:143079156-143079178 GCCCTCAGGGGTCTTGCAGGAGG - Intergenic
1051402158 9:16694789-16694811 GTCCTCAGCAGGCTTGGAGGGGG - Intronic
1052333665 9:27297676-27297698 GCCCACAGAAGGTTTGCTGGAGG - Intergenic
1053144257 9:35701611-35701633 GTACAAAGGAGGATTGGAGGGGG + Intronic
1056189509 9:84171026-84171048 ACCAACAGGAGGCAGGGAGGCGG + Intergenic
1056806517 9:89733160-89733182 GAGCAGAGGAGGCTTGGAGGTGG + Intergenic
1057231049 9:93321482-93321504 TCCCAGCTGAGGCTTGGAGGAGG - Intronic
1057531196 9:95847814-95847836 GGCCACAGGCGGCCTGGAAGAGG - Intergenic
1058172637 9:101701366-101701388 GCCTACTGGAGGGTGGGAGGAGG - Intronic
1059466779 9:114473894-114473916 GCCTGCAGGAGGCATGGAGAAGG + Intronic
1059681574 9:116590934-116590956 GCCCTCAGGAGACTTGAAGTGGG - Intronic
1060224797 9:121784188-121784210 GACCACAGGAAGATGGGAGGTGG + Exonic
1061002920 9:127912539-127912561 GCCCACCGTGGGCTTTGAGGCGG - Exonic
1062083777 9:134638096-134638118 GGCGGCAGGGGGCTTGGAGGAGG + Intergenic
1062276765 9:135735038-135735060 CTCCACAGGAGGGTTGAAGGGGG + Intronic
1062404500 9:136388721-136388743 GCCCACAGGAGTCTGGGAGGAGG - Intronic
1062618351 9:137408010-137408032 GACCACAGGAGGCATGAGGGTGG - Intronic
1185572910 X:1148015-1148037 GCCCACAGGAGGGAGGGAAGAGG - Intergenic
1185666217 X:1767381-1767403 GCCCCCAGGAGGTAAGGAGGAGG + Intergenic
1185864729 X:3613389-3613411 ACCTACAGGTGGCTTGGAGGGGG + Intronic
1186312424 X:8335350-8335372 CCCCACAGGATACGTGGAGGTGG - Intergenic
1186501607 X:10055299-10055321 GACTACAGGAGGCCTGTAGGAGG + Intronic
1186684241 X:11908040-11908062 ACCCACAGGAAGCTGGGAGAAGG - Intergenic
1188482075 X:30646559-30646581 AGCCACTGGAGGCTTAGAGGTGG + Intergenic
1189233723 X:39471822-39471844 TCCCCCAGGAGCTTTGGAGGGGG + Intergenic
1189963006 X:46342824-46342846 ACCTACAGAGGGCTTGGAGGGGG - Intergenic
1190176665 X:48156270-48156292 TCCCAAAGGAGGCGTGGGGGTGG + Intergenic
1192269292 X:69563797-69563819 GCACACAGTAGGCCTGGATGTGG - Intergenic
1197819389 X:130529825-130529847 GTCCCCTGGAGCCTTGGAGGTGG + Intergenic
1199011361 X:142762665-142762687 CTCCTCAGGAGGCTTAGAGGTGG - Intergenic
1199075484 X:143520854-143520876 GCCCCAAGGAGAGTTGGAGGTGG - Intergenic
1199627630 X:149755382-149755404 GCCCAAAGCAGGCATGAAGGGGG + Intergenic
1199980581 X:152918385-152918407 GACCGCAGGAAGCTTGTAGGAGG + Intronic
1200042546 X:153380493-153380515 GCCCAGGGGACGCATGGAGGTGG - Intergenic
1200401922 X:156024826-156024848 GCCCCGAGGTGGCTGGGAGGTGG + Intergenic
1200799226 Y:7370677-7370699 ACCTACAGGTGGCTTGGAGGGGG - Intergenic