ID: 1151680266

View in Genome Browser
Species Human (GRCh38)
Location 17:75619356-75619378
Sequence AGGAGGCTTGGAGGTGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 338}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151680259_1151680266 -10 Left 1151680259 17:75619343-75619365 CCTTCCTGCCCACAGGAGGCTTG 0: 1
1: 0
2: 1
3: 22
4: 290
Right 1151680266 17:75619356-75619378 AGGAGGCTTGGAGGTGGACCTGG 0: 1
1: 0
2: 1
3: 49
4: 338
1151680252_1151680266 20 Left 1151680252 17:75619313-75619335 CCCTCTGTGTGAGCAGAGGGCAG No data
Right 1151680266 17:75619356-75619378 AGGAGGCTTGGAGGTGGACCTGG 0: 1
1: 0
2: 1
3: 49
4: 338
1151680251_1151680266 21 Left 1151680251 17:75619312-75619334 CCCCTCTGTGTGAGCAGAGGGCA No data
Right 1151680266 17:75619356-75619378 AGGAGGCTTGGAGGTGGACCTGG 0: 1
1: 0
2: 1
3: 49
4: 338
1151680253_1151680266 19 Left 1151680253 17:75619314-75619336 CCTCTGTGTGAGCAGAGGGCAGC No data
Right 1151680266 17:75619356-75619378 AGGAGGCTTGGAGGTGGACCTGG 0: 1
1: 0
2: 1
3: 49
4: 338
1151680256_1151680266 -3 Left 1151680256 17:75619336-75619358 CCTGGGTCCTTCCTGCCCACAGG No data
Right 1151680266 17:75619356-75619378 AGGAGGCTTGGAGGTGGACCTGG 0: 1
1: 0
2: 1
3: 49
4: 338
1151680250_1151680266 22 Left 1151680250 17:75619311-75619333 CCCCCTCTGTGTGAGCAGAGGGC No data
Right 1151680266 17:75619356-75619378 AGGAGGCTTGGAGGTGGACCTGG 0: 1
1: 0
2: 1
3: 49
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151680266 Original CRISPR AGGAGGCTTGGAGGTGGACC TGG Intergenic
900300363 1:1973896-1973918 GGGAGGGGTGGAGGTGGATCTGG + Intronic
900436171 1:2632230-2632252 AGGAGATGTGGAGGTGGAGCTGG - Intronic
900461304 1:2803261-2803283 AGGTGGCGTGGAGGCGGCCCTGG - Intergenic
901918671 1:12520035-12520057 AGGAGGCTTGGATGAGGATGGGG + Intergenic
903603596 1:24559198-24559220 ACAAGGCTTGGAGGTTGTCCAGG - Intronic
904295189 1:29515724-29515746 AGGAGGATGGGAGGAGGAGCAGG - Intergenic
904323563 1:29712248-29712270 AGGATGCAGGGAGGGGGACCTGG + Intergenic
904426447 1:30426615-30426637 CGGAGGCTTGGAGCAGGACAGGG + Intergenic
905471785 1:38197693-38197715 CGGAGGCTTGGAGGAGAGCCAGG + Intergenic
906769521 1:48471867-48471889 AGGAGGTTTGGGGGTGGTTCCGG + Intronic
906786648 1:48622020-48622042 AGGAAGCTTGGATGTGACCCTGG - Intronic
907274630 1:53310343-53310365 AGGAGGGTGGGAGGTGGGCTGGG - Intronic
907458349 1:54590394-54590416 AGGAGGCTGGGCAGTGGCCCTGG + Intronic
907519332 1:55012845-55012867 TGGAAGCTTGGAGGAGGAGCAGG + Intergenic
908640716 1:66220133-66220155 TGGAGGCTTGGAGGTGATCTGGG + Intronic
908742237 1:67341076-67341098 AGGATGCTTGGGGTTGGAACTGG + Intronic
909918061 1:81345271-81345293 CCTAGGCTTGGAGGTGGCCCAGG - Intronic
909972831 1:82010630-82010652 TGGAGGCTTGGAGGAGGATGAGG - Intergenic
913515693 1:119603708-119603730 ACGAGGCTTGGAGGTGGAGTGGG + Intergenic
913675221 1:121133950-121133972 AGGAGGCAGGGAGGTGGATAAGG - Intergenic
914027057 1:143921570-143921592 AGGAGGCAGGGAGGTGGATAAGG - Intergenic
914240618 1:145850366-145850388 AGGAGGCTTTGAGAAGGAACAGG + Intronic
914900577 1:151709154-151709176 GGGAGTCTTGGGGGTGGAACAGG + Intronic
915974624 1:160376867-160376889 AGGAGGCTTGAAGGCTGACTAGG + Intergenic
917980467 1:180266026-180266048 AGGAAGCTGGGAGGTGGAGGGGG + Intronic
920278941 1:204828981-204829003 AGGGGGCTGGGAGCTGGACGGGG - Intronic
920462582 1:206152788-206152810 AGGAGGCAGGGAGGTGGATAAGG - Intergenic
920834275 1:209494036-209494058 AGGAGGCAGGGAGGTGGAAAAGG + Intergenic
922162560 1:223089194-223089216 GGGTGGGTTGGAGGTGGAGCTGG - Intergenic
923144108 1:231185883-231185905 AGGAGGATTTGAGTTGGACGTGG + Intronic
923191916 1:231627427-231627449 AGGAGGCTGGGAGCGGGACCAGG + Intronic
1062829767 10:597886-597908 AGGAGGTCTGAACGTGGACCTGG + Intronic
1062961353 10:1575831-1575853 AGGAGGGATGCAGGTGGACTGGG - Intronic
1063646255 10:7886326-7886348 AGGGGGTTTGGAGAAGGACCAGG - Intronic
1064328490 10:14372652-14372674 AGGAGGCTGGGAGTTGTCCCAGG - Intronic
1067156895 10:43789726-43789748 AGGGGTCGTGGAGGTGGATCTGG - Intergenic
1067283866 10:44893470-44893492 TGGAGGATTGGATGTGGACCAGG - Intergenic
1067553868 10:47254202-47254224 GGGAGGCATGGGGGTGGACCCGG + Intergenic
1069774764 10:70919861-70919883 AGGAGACCTGGAGGAGCACCAGG + Intergenic
1069875212 10:71558737-71558759 GGGATGATTGGAGGAGGACCTGG + Intronic
1070152711 10:73814915-73814937 AGAAGGCTGGGAGGTGGTCCTGG - Intronic
1070604657 10:77890306-77890328 AAGAGGCTTGGAGGTAGGACAGG - Intronic
1072227469 10:93383839-93383861 GGGAGGCTTGGAGGTGGGGTGGG + Intronic
1073835302 10:107434541-107434563 AGGAGGCTTGGAGATTGAATAGG + Intergenic
1074076293 10:110128958-110128980 AGGGTGATTGGATGTGGACCAGG + Intronic
1074123310 10:110509202-110509224 AGGGGGCTGGGAGGTAGAACAGG + Intronic
1074161616 10:110840776-110840798 AGGATGCTTGGGGGTGCCCCTGG + Intergenic
1075258011 10:120940433-120940455 AGGAGGCTTTGAGGAAGTCCAGG - Intergenic
1075385949 10:122055563-122055585 AGGAGGCTGGGAGGAGGCACAGG + Intronic
1075694620 10:124424561-124424583 AAGAGGGATGGAGGAGGACCAGG + Intergenic
1075872832 10:125783049-125783071 CAGAGGCTTAGAGGTGGACACGG + Intergenic
1076340396 10:129741457-129741479 AGGAGGCTGGGAGGTTCGCCAGG + Intronic
1076546079 10:131246434-131246456 TGGAGGCTGGGAGGTGGGCAGGG + Intronic
1078314676 11:10284400-10284422 AGGAGGGTGGGAGGTGGATGTGG - Intronic
1078339465 11:10488629-10488651 AGAAGGCAGGGAGGTGGGCCGGG + Intronic
1082561814 11:54627864-54627886 TGGAGGTTTGGGGGTGGAGCAGG - Intergenic
1083626949 11:64076827-64076849 AAGAGGCTTGCAGGAGGACCGGG - Intronic
1083663922 11:64264660-64264682 AGGAGGCTTGGGGCTGGGCCAGG + Intronic
1084265784 11:68004471-68004493 AGCAGGCTTGGAGGTGGGGCTGG - Intronic
1084313914 11:68332641-68332663 TGGAGGCATGGAGGTGGTCAGGG + Intronic
1084768372 11:71326794-71326816 GGGAGGCTGGGAGGTGAATCAGG + Intergenic
1084968960 11:72759167-72759189 AGGAGGCTTGGTGGGAGGCCTGG + Intronic
1085312143 11:75523073-75523095 AGGAAGCTTGAAGTTTGACCAGG - Intronic
1089362163 11:117898136-117898158 AGGAGACTTGGAGGTGTCCTGGG + Intergenic
1089809301 11:121118523-121118545 AGGAGCCTTGGAAGTGGAAGAGG - Exonic
1089850025 11:121487796-121487818 AGGAGGCCTGGAGATGGACCGGG - Intronic
1090496254 11:127215469-127215491 AGGGGGATTGGAGCTGGACAGGG + Intergenic
1090571526 11:128052450-128052472 AGGGCACTTGGAGGTGGACTGGG + Intergenic
1091208177 11:133834738-133834760 AAGAGGCTGGGAGGTGGGTCAGG - Intergenic
1091559907 12:1604180-1604202 AGGAGGCTGGGAAGTGCAGCAGG + Intronic
1091666077 12:2419435-2419457 TGGAGGACTGGAGGTGGGCCTGG - Intronic
1092886269 12:12927016-12927038 AGTAGGCTTCGCGGTGGAGCAGG - Intergenic
1093060078 12:14593079-14593101 TGGAGGCTGGGAGGAGGATCAGG - Intergenic
1093079109 12:14789007-14789029 GGCAGACCTGGAGGTGGACCTGG + Exonic
1093637700 12:21491407-21491429 AGTAGGCTTAGAGGTGAAACTGG - Intronic
1094231419 12:28108454-28108476 AGGAGGATGGGAGGTGGCCAAGG + Intergenic
1095515464 12:43000507-43000529 AGGAGACATGGAGGTGTCCCAGG - Intergenic
1096258681 12:50077844-50077866 AGGAGGCTAGGGGGTGGGCTAGG + Intronic
1096848637 12:54421282-54421304 AGGAGCCTTGGTGGGGGACAGGG + Intergenic
1102316233 12:111890076-111890098 AGGAGGCTTGGAAGTATAACCGG + Exonic
1104061222 12:125270276-125270298 AGGATGCATGGTGGTGCACCTGG - Intronic
1105295407 13:19085074-19085096 AGGAGTCTTGGAGGAGGAATGGG - Intergenic
1106241535 13:27917405-27917427 AGGCGGCTTGGAGGGGGCGCAGG + Intergenic
1107042745 13:35966854-35966876 AGGCGGCTGGGAGGTGGAGGTGG - Intronic
1107129925 13:36884326-36884348 AGGAGGCTTTGTGGGGGATCTGG - Intronic
1107887248 13:44883895-44883917 AGGAGGAGAGGAGGTGGAGCGGG + Intergenic
1110268222 13:73563876-73563898 AGGAGGCTTGGAGGTAAATGGGG - Intergenic
1112152594 13:96780369-96780391 AGGAGGCAAGGAGCTGGACAAGG + Intronic
1113350992 13:109529265-109529287 AGGAGGCTGGCAGGAGGATCAGG - Intergenic
1113634471 13:111910196-111910218 GGGAGGCTGGGAGCTGGCCCAGG + Intergenic
1113710196 13:112458006-112458028 AGCTGGCTTGGAGGTGTCCCTGG - Intergenic
1114769180 14:25409303-25409325 AGGAGGCTTAGAGGATGTCCTGG - Intergenic
1115382472 14:32756344-32756366 CTGAGTCATGGAGGTGGACCTGG + Intronic
1115651619 14:35405959-35405981 TGCAGGCTTGGAGGTGGAGGTGG - Intergenic
1117922001 14:60734798-60734820 AGGGGGCTTGTAGGTGGCTCTGG + Exonic
1118836270 14:69480216-69480238 AGGAGGCTTGGAGGAGGGAAAGG + Intergenic
1119671117 14:76518924-76518946 GGGAGGCTGGCAGGTGGCCCAGG - Intergenic
1119703303 14:76769309-76769331 AGAAGACTTGGAGGAGGACCCGG + Intronic
1121011971 14:90525094-90525116 AGGAGACTTGGGGGTGGAGGGGG - Exonic
1121122012 14:91381888-91381910 AGGAGGCAGGGAGGTGGGCTCGG - Intronic
1121645175 14:95513591-95513613 AGGAAGCTAGGAAGTGGACGGGG - Intergenic
1122440269 14:101727020-101727042 AGGAGGCCTGGAGGTGGGGTTGG - Intergenic
1122599769 14:102915451-102915473 AGGAGGAGTGGAGGTGGAGGCGG + Intergenic
1122613383 14:103000855-103000877 GGGAGGCTTGGGGATGGGCCCGG + Intronic
1122883385 14:104699986-104700008 ACCAGGCTTGGTCGTGGACCAGG + Intronic
1122967794 14:105139335-105139357 AGGAGGTGTGGAGGTGGCCTAGG + Intergenic
1123634630 15:22291503-22291525 AGGAGCCTTGCAGGTGTACATGG + Intergenic
1124399247 15:29333986-29334008 AGGAAGCTAGGAGGGAGACCTGG + Intronic
1124789488 15:32714222-32714244 AGGAGGGGAGGAGGTGGATCAGG - Intergenic
1128242562 15:66110933-66110955 AGGAGGTTTGGAGGGGGAGGAGG - Intronic
1128763504 15:70236083-70236105 TGGAGGCTTGGAGAAGGAGCTGG + Intergenic
1132408718 15:101561047-101561069 AGGGGGATTGGAGGAAGACCAGG + Intergenic
1132665675 16:1080384-1080406 AGCAGCCTTGGACGGGGACCCGG - Intergenic
1132736578 16:1388988-1389010 AGGAGTTCTGGAGGTGGACGCGG - Intronic
1132776250 16:1596195-1596217 AGGAGGCTGGGAGGGGGATGGGG - Intronic
1132942950 16:2517337-2517359 AGGAGGCTGGGACCTGGGCCAGG - Intronic
1134253076 16:12588403-12588425 GGGAAGATTGGAGGTGGAACAGG - Intergenic
1134334236 16:13281803-13281825 AGGAAGGTGGGAGGTGGCCCAGG - Intergenic
1136233789 16:28902727-28902749 GGGTGGCATGGAGGTGGCCCTGG + Intronic
1136374870 16:29859398-29859420 AGGAGGATGGGAGGGGGATCTGG - Intronic
1137708294 16:50549571-50549593 AGGAGGCCAGGAGGTGGGGCAGG - Intronic
1137845340 16:51682617-51682639 AGCAGGCCTGGAGTTGGAGCTGG + Intergenic
1138926376 16:61596472-61596494 AGCAGTCCTGGAGGTTGACCTGG - Intergenic
1139530748 16:67541591-67541613 GAGAGGCTTGGAGGAGGGCCAGG + Intronic
1139637701 16:68268194-68268216 AGGAGGCTTGGATTTGTGCCAGG + Intronic
1139665517 16:68452692-68452714 ATGAGGCTGGGATGTGGATCGGG + Intergenic
1141469709 16:84230023-84230045 AGGAGGCAGGGAGGTGGAAATGG + Intronic
1141530512 16:84643402-84643424 AGGAGGCTGGGAGGAGGAGGAGG - Intergenic
1141577632 16:84974780-84974802 AGGGGGTTTGGAAGTGGACTTGG - Intronic
1141827136 16:86488418-86488440 AGGGGGCTTGGATTTGAACCTGG + Intergenic
1142291019 16:89193585-89193607 AGGAGGCGGGGAGGAGGACCAGG + Exonic
1143376308 17:6469616-6469638 AGGAGGCTTGGAGTAGGACAGGG - Intronic
1143462419 17:7112456-7112478 AGGAGGCTTGGAGAGAGGCCAGG - Intronic
1143514869 17:7414525-7414547 GGGAGTCTGGGAGGTGGGCCTGG + Intronic
1143585441 17:7848212-7848234 AGGGGGCCTGGGGGTGGCCCCGG - Exonic
1144068110 17:11642132-11642154 GGAAGGTTTGGAGGTGTACCAGG + Intronic
1144573448 17:16415182-16415204 AGGAGGCTGGGAGAAGGTCCTGG + Intergenic
1144665269 17:17098256-17098278 AGGGGCCTTGGAGGTGGAGTGGG - Intronic
1145014443 17:19387320-19387342 AGGGGGCTGGGAGGTGGGGCTGG + Intergenic
1146060136 17:29600609-29600631 ATGAGGCTGGGAAGGGGACCAGG + Intronic
1146064396 17:29623125-29623147 AGGACGCTTGGAGAGGGAACGGG + Intergenic
1146930872 17:36777027-36777049 GGGAGGGTTGGAGGTGGACAAGG - Intergenic
1147914595 17:43878939-43878961 AGGTGGGCTGGAGGTGGGCCAGG - Intronic
1148719070 17:49737834-49737856 AGGAGGCTTGGATTTAGATCTGG - Intronic
1148809437 17:50280610-50280632 AGGAGGATTGGAGGTAGAACTGG + Exonic
1150064960 17:62101233-62101255 AGAATGCCTGCAGGTGGACCTGG + Intergenic
1150813088 17:68372091-68372113 AAGAGGTTCAGAGGTGGACCTGG + Intronic
1150813312 17:68373832-68373854 AGGAGGACTGGAGGTGGATGGGG + Intronic
1151383246 17:73739924-73739946 AGAAGGCTGGGAGGTTGCCCAGG - Intergenic
1151680266 17:75619356-75619378 AGGAGGCTTGGAGGTGGACCTGG + Intergenic
1151977414 17:77490491-77490513 AGGGTGCTTGGAGCTGGCCCTGG + Intronic
1152589886 17:81206434-81206456 AGGAGGCTTGTAGGGGGTCCTGG - Intronic
1152935848 17:83136293-83136315 AGGAGGCCTGGAGGTGACGCCGG - Intergenic
1152935860 17:83136337-83136359 AGGAGGCCTGGAGGTGACACCGG - Intergenic
1153959514 18:10128859-10128881 AGGAGGCTTGAAGGCAGCCCAGG - Intergenic
1154283708 18:13031991-13032013 CGGAGGCTAGGAGGTGAAGCTGG + Intronic
1155073812 18:22338290-22338312 GGGAGGATGGGAGGTGGCCCAGG + Intergenic
1159209581 18:65299634-65299656 AGGTGGAATGGAGGTGGAACAGG - Intergenic
1159657690 18:71052335-71052357 CAGAGGCCTGGAGGTGGGCCTGG - Intergenic
1160443688 18:78911854-78911876 TGGAGGCTTGGAGTGGGATCTGG - Intergenic
1160518590 18:79491628-79491650 GGGAGGCTGGAAAGTGGACCCGG - Intronic
1160676287 19:393088-393110 AAGAGGCTGGGAGGTGGTCCTGG + Intergenic
1160716203 19:577937-577959 AGGTGGCGTGGATGTGGACGCGG - Exonic
1161026959 19:2041333-2041355 AGGGGGCTGGGAGCCGGACCAGG + Intronic
1161313513 19:3607458-3607480 AGGAGGCTCGGAGGTGGCTTTGG + Intergenic
1161687806 19:5712037-5712059 CTGAGGCTGGGAGCTGGACCCGG + Intronic
1161726481 19:5932274-5932296 AGGAGGCTTGGGGCTGGAGACGG + Intronic
1161750548 19:6092977-6092999 GGGAGGCGAGGAGGTGGCCCCGG + Intronic
1161886190 19:6997900-6997922 AGGAGTCTTGTGGGTGGACACGG + Intergenic
1162107397 19:8378331-8378353 AGGAAGCTGGGATGTGAACCTGG + Intronic
1162130462 19:8522873-8522895 AGGAGGATTTGAGGAGGACTTGG + Intronic
1162136054 19:8555892-8555914 AGGAGGAATGGAGGTGGGGCGGG - Intronic
1162361716 19:10224368-10224390 AGCAGGCCTCGAGGTGGCCCAGG + Exonic
1163482122 19:17562989-17563011 AGGAGGCAGAGAGGTGGATCTGG + Intronic
1165326528 19:35117341-35117363 AGGTGGCTTGGAGGAGCCCCTGG + Exonic
1166981681 19:46635197-46635219 AGGAGGCTTTGAGGTGACCAGGG - Intergenic
1166993996 19:46710672-46710694 CGGAGCCTAGGAGGTGGAGCTGG - Intronic
1167527722 19:49995365-49995387 AGGAGACTTGGAGGCGGTCTGGG - Intronic
1167571618 19:50292420-50292442 AGGAAGCTGGGAGGTGGGCAAGG + Intronic
1167650080 19:50724229-50724251 AGGAGGCATGGCCGTGGACCTGG - Intronic
1168228749 19:55015210-55015232 ATGTGGCTTGGAGGGGGTCCTGG - Intronic
1168257557 19:55175030-55175052 AGGAGGCATGGATGTGGAGCCGG - Intronic
925376482 2:3389421-3389443 ACGGGGCTTGTAGCTGGACCAGG + Intronic
927275973 2:21262774-21262796 AGGAGCCTTGGAGATGAAGCTGG + Intergenic
927504560 2:23604555-23604577 AGGAGCCCTGGAGGTGGCCTTGG + Intronic
928162184 2:28938872-28938894 AGGAGGCTTGGGAGGTGACCTGG + Intronic
928983055 2:37156197-37156219 AGGATGCTTGGCTGTGCACCAGG + Intronic
929114968 2:38436357-38436379 CATAGGCTTGGGGGTGGACCTGG - Intergenic
929543960 2:42843673-42843695 GGGTGGCTTGGATCTGGACCTGG + Intergenic
929592014 2:43153651-43153673 GGGAGGGTGGGAGGTGGCCCAGG + Intergenic
929666580 2:43838547-43838569 AGGAGGCATGGAGGATGCCCAGG + Exonic
929776309 2:44933112-44933134 AGGGTGCTTGGGGGTGGTCCGGG - Intergenic
931220019 2:60280723-60280745 AGGAGGCTTTGTGGTGATCCGGG + Intergenic
931731988 2:65161298-65161320 AGCAGGCTTGGGGGTAGATCAGG + Intergenic
931749293 2:65316763-65316785 ATGAGTCGTGGAGGTGGCCCAGG + Exonic
933636442 2:84713558-84713580 AGGAGGAGTGGCTGTGGACCAGG - Intronic
934153889 2:89176473-89176495 AGGAGTCTTGGAGGCTGGCCTGG + Intergenic
934213345 2:90005462-90005484 AGGAGTCTTGGAGGCTGGCCTGG - Intergenic
935054342 2:99552652-99552674 AGGTGGCTAGGAGGTTGGCCAGG + Intronic
935675642 2:105592971-105592993 AGGAGACGTGGAGGTGGGCATGG - Intergenic
936021507 2:108998506-108998528 AGGAGGATTAGTGGTGGTCCTGG - Intergenic
936492271 2:112982532-112982554 AGGAGACTTTGAGGTGGTCTAGG + Intronic
937299973 2:120833082-120833104 AGGAGGCCTGGAGGTGGGCTGGG - Intronic
937936433 2:127249272-127249294 GGCAGACCTGGAGGTGGACCTGG - Intergenic
938241290 2:129744341-129744363 AGGAGGCTGCGTGGTGGCCCAGG - Intergenic
938448252 2:131393964-131393986 AGGAAGCTGGGGGGTGAACCAGG + Intergenic
940341449 2:152586056-152586078 AGGCTGCTGGGAGGTGCACCTGG + Intronic
946195415 2:218029980-218030002 AGATGGCTTGGATGTGGACGAGG - Intergenic
946302007 2:218829865-218829887 AGGGGGCTTGCAGGGGCACCTGG + Intronic
946843511 2:223839469-223839491 AGGAGGCCTAGAGGTGGGCAGGG + Intergenic
948693437 2:239720971-239720993 AGGAGGTTTGGAGGGGAACTGGG + Intergenic
948695681 2:239732077-239732099 AGGAGGGTTGGGGGTGGAGTGGG - Intergenic
948809308 2:240466716-240466738 TGGAGGCTGGGGGGTGGGCCAGG - Exonic
948866120 2:240775715-240775737 CTGAGGCTGGGAGGTGAACCTGG - Intronic
1169506144 20:6213389-6213411 AGGAGGCTAGAAGGAGGAGCTGG + Intergenic
1170562560 20:17569852-17569874 AGGAGGCTAGAAGGCGGACTGGG - Exonic
1171010909 20:21508990-21509012 GGGAGCCCGGGAGGTGGACCCGG - Intergenic
1172019723 20:31905458-31905480 GGGAGGTTTGGAGAAGGACCAGG + Intronic
1172345049 20:34191470-34191492 GGGAGGCCTGGAGCAGGACCTGG + Intergenic
1172668986 20:36620950-36620972 AGTAGTCGTGGAGGTGGATCTGG + Intronic
1173800209 20:45890567-45890589 AGGAGGGTTGGAGGTCGGCTGGG + Exonic
1174096333 20:48092457-48092479 AGGAGGCTGGGAGGTGGCCATGG + Intergenic
1174349403 20:49956271-49956293 ATGGGGCATGGAGGTGGACAAGG - Intergenic
1174378074 20:50139437-50139459 AGGAGTCTTGGGGGTCGACTGGG - Intronic
1174595542 20:51680469-51680491 GGGAGGGATGGAGGAGGACCAGG - Intronic
1174754589 20:53145262-53145284 AAGAGAGTTGGAGGAGGACCAGG + Intronic
1174976430 20:55340683-55340705 ATGAGCCTTGGAGTTGGACCAGG + Intergenic
1175268274 20:57715482-57715504 AGGATACTTGGAGGTGGAGAGGG - Intergenic
1181178547 22:21051781-21051803 CGCAGGCTTGGAGCTGGGCCTGG - Intronic
1181875634 22:25938426-25938448 AGGAGTCTTTGGGGTGGCCCAGG + Intronic
1182041145 22:27239838-27239860 AGGAGGCATGGAGGTCAACAGGG - Intergenic
1183316736 22:37141229-37141251 TGGAGGCTTGGGTTTGGACCAGG - Intronic
1183378994 22:37481390-37481412 AGGAGGCTGAGTGATGGACCAGG + Intronic
1184406700 22:44304615-44304637 AGGAGGCTGGGAGGAGGCCCAGG - Intronic
1184673517 22:46027929-46027951 AGGAGGAGTGGAGGTGGAATCGG - Intergenic
1185248919 22:49789471-49789493 GGGAGGCTAGGAGGTGGAAGAGG - Intronic
1185341027 22:50291188-50291210 AGGGGGCCTGGAGGTGGTCAGGG - Intronic
949895374 3:8764306-8764328 GGGATGCTTGCAGGTGGAGCAGG - Intronic
949915398 3:8959319-8959341 AGGAGGCTTGGAGTAAGAGCTGG - Intronic
950467470 3:13163696-13163718 AAGATGCTTGGTGGTGGGCCCGG - Intergenic
950495678 3:13333024-13333046 AGGAGCCTGGGAGGTGGAACGGG - Intronic
951758966 3:26124201-26124223 GGGAGGGTGGGAGGTGGACATGG + Intergenic
951775929 3:26310170-26310192 AGTATGCTTGGAAGTGGTCCAGG - Intergenic
954638561 3:52084836-52084858 AGGTGGCATGGAGGTGGACAGGG + Intronic
954798791 3:53175129-53175151 TGGTGGCTGGGAGGAGGACCTGG + Intronic
954997243 3:54892877-54892899 AGGATGCTGGGAGGTGTACCTGG + Intronic
955115318 3:55992796-55992818 AGGAGGCTTGGAGGTGAGGAAGG + Intronic
956768107 3:72501689-72501711 AGGAGGCTTGTAGGTGGGAGAGG + Intergenic
959016724 3:101143192-101143214 AGGAGGATTGGAGGAGAACCAGG - Intergenic
959241764 3:103806058-103806080 AGGAGGGTCGGAGGAGGACAAGG - Intergenic
961404626 3:126669242-126669264 AGGAGCCTGGGAGGTGGAACCGG + Intergenic
961636232 3:128334882-128334904 AGAAGGCTGGGAGGTGGAATGGG - Intronic
962289221 3:134117675-134117697 AGGAGGTTTGGAGGGGGATGAGG - Intronic
963103616 3:141626873-141626895 AGGAGGCTTGCAGGATGACCCGG - Intergenic
963266882 3:143248780-143248802 AGGAGGCTGAGAGATGGAGCAGG + Intergenic
963467424 3:145701180-145701202 CGTAGGGGTGGAGGTGGACCAGG + Intergenic
965093157 3:164187651-164187673 AGGAGGCTTGGTTGTGGAAGTGG - Intergenic
966734523 3:183178820-183178842 GGGATGCTGGGAGGCGGACCGGG + Exonic
967197629 3:187042518-187042540 AGGTGGCCAGGAGGTAGACCAGG + Intronic
968231560 3:197007648-197007670 AGGAGGCTGGGTGGGGGAGCTGG + Intronic
968599995 4:1504255-1504277 AGGAGGCCTGGACCTGGAGCTGG + Intergenic
968650256 4:1757614-1757636 GGGAGGCGTGGACGTGGAGCTGG - Intergenic
969342039 4:6548348-6548370 AGGAAGCTTGGAGGTGGAGAAGG - Intronic
969342367 4:6550208-6550230 AGGAAGCTTGGAGGTGGAGAAGG - Intronic
969375468 4:6760717-6760739 AGGAGCCCAGGAGGTGGAGCAGG - Intergenic
969430029 4:7148625-7148647 ATGGGGAATGGAGGTGGACCGGG + Intergenic
969673818 4:8603974-8603996 AGGAGGCCTGGAGGCTGACGAGG + Exonic
970885439 4:20983372-20983394 AGGAGGTGTGGGGGTGAACCCGG - Intronic
971369442 4:26004017-26004039 AGGAGGCTTGAGGGTGCAGCAGG - Intergenic
972897430 4:43640696-43640718 AGGAGGCATGGACATGGAGCTGG + Intergenic
973620612 4:52722227-52722249 AGGTGGCTGGGAGGTGGGCGCGG - Intergenic
973961158 4:56111184-56111206 AGGAGGTATGGATGTGGACGGGG + Intergenic
974855255 4:67453458-67453480 AGGAGGAAAGGAGGTGGAGCGGG + Intergenic
976765148 4:88591848-88591870 GGGAGGCTGGAGGGTGGACCCGG - Intronic
977115800 4:93025858-93025880 AGAAAGCTTGGAGGTAGCCCAGG - Intronic
978532566 4:109729918-109729940 AGGAGGCGTGGATATGGAGCTGG - Exonic
981108733 4:140911192-140911214 GGGAGCCTTGCAGGTGGTCCAGG - Exonic
981534153 4:145782110-145782132 ACGAGGCTTGGAGTTGGGCGTGG - Intronic
985636259 5:1037284-1037306 AGGAGGGGTGGAGCTGGATCAGG + Intronic
988331955 5:29852758-29852780 AGGAAGCATGGAGATGGATCAGG + Intergenic
990709521 5:58564804-58564826 AGGTGGCTGGGAGGTGGAGGTGG + Intergenic
991022153 5:61990682-61990704 AGGAGGCTTGGAGGTTCACATGG + Intergenic
992014823 5:72565168-72565190 CGGAGGCTGGAAAGTGGACCAGG - Intergenic
992192808 5:74310636-74310658 AGGAGAGGTGGAGCTGGACCGGG + Intergenic
992801649 5:80300921-80300943 AGGCGGCTGGGAGGTGGAGGTGG - Intergenic
996544397 5:124662511-124662533 AGGAGTCTTGGAGGTTGACTTGG - Intronic
997857342 5:137384028-137384050 ATGTGGCTTGGAGCTGGACTGGG - Intronic
998169632 5:139864885-139864907 AGGAGGCCTGGGTGTGGCCCTGG + Intronic
998890726 5:146742942-146742964 AGGAGGCTAGGAGAGGGGCCTGG + Intronic
1000480180 5:161763643-161763665 AGGACACATGGAGGTGGACCAGG + Intergenic
1001085872 5:168699643-168699665 AAGAGGGCTGGAGGTGGGCCTGG + Intronic
1003908440 6:10722849-10722871 AGGAGACCCGGAGTTGGACCTGG - Intergenic
1004180399 6:13376189-13376211 AGGAGGCAGGGAGGTGGGACGGG + Intronic
1006059689 6:31410963-31410985 GGGAGGCATGGAGGAGGGCCAGG + Intronic
1006072179 6:31506034-31506056 GGGAGGCATGGAGGAGGGCCAGG + Intronic
1006316717 6:33295918-33295940 AGGAGGCTAGGAGCTGGATCAGG + Intronic
1006448632 6:34093221-34093243 AGGAGGGTTGGGGGTGCCCCTGG + Intronic
1006817005 6:36858498-36858520 AGGGGCCTTGGGGGTGGACTTGG - Intronic
1006931665 6:37692517-37692539 AGGAGGCATGGGGGAGGGCCTGG - Intronic
1007378960 6:41474420-41474442 AGCAGTTTTGGAGGTGGAGCAGG - Intergenic
1007509486 6:42364321-42364343 AGGAGGCTAGGAAGGGGGCCGGG - Intronic
1008022438 6:46595589-46595611 AGAAGGGGTGGAGGAGGACCTGG + Intronic
1010793030 6:80086899-80086921 ATGAGGCTTGGTGGGTGACCTGG + Intergenic
1011130476 6:84047002-84047024 TGGATCCTTGAAGGTGGACCAGG + Intronic
1016752308 6:147644304-147644326 AGGAGAGTTGGGAGTGGACCTGG + Intronic
1018172135 6:161151817-161151839 AGCAGCCTGGGAGGTGGAGCGGG + Intronic
1019283262 7:211147-211169 CGGAGGCTGGGAGGAGGCCCAGG - Intronic
1019283295 7:211241-211263 AGGAGGCTGGGGGGAGGTCCAGG - Intronic
1020076155 7:5260332-5260354 AGCAGGCCTGGAGCTGGGCCAGG - Intergenic
1021101428 7:16588787-16588809 AGGAGACTGGGAGGGGGACAAGG + Intergenic
1021474224 7:21042480-21042502 GAGAGGCATGGAAGTGGACCCGG + Intergenic
1022090411 7:27104279-27104301 AGGAGGCTGAGAGGTAGATCTGG + Intergenic
1022495381 7:30850030-30850052 CAGAGGCTTGGAGGTGGGCATGG + Intronic
1022813104 7:33888255-33888277 AAGAGGCTGGGAGTAGGACCTGG - Intergenic
1024076866 7:45825507-45825529 AGGAGGCCGGAAGCTGGACCAGG - Intergenic
1024249934 7:47498376-47498398 AGGAGGCTAGAAGGTGCAGCCGG - Intronic
1025127553 7:56355916-56355938 AGGAGGCCGGAAGCTGGACCAGG + Intergenic
1025202934 7:56973239-56973261 AGCAGGCCTGGAGCTGGGCCAGG + Intergenic
1025602784 7:63015474-63015496 AGGAGGCCGGAAGCTGGACCAGG + Intergenic
1025669010 7:63603687-63603709 AGCAGGCCTGGAGCTGGGCCAGG - Intergenic
1026015821 7:66669858-66669880 AAGAGTCTTGGTGGTGGCCCGGG - Intronic
1026770988 7:73198889-73198911 AGGAGTCTGGGAGGAGCACCAGG - Intergenic
1027011855 7:74752286-74752308 AGGAGTCTGGGAGGAGCACCAGG - Intronic
1027076185 7:75193765-75193787 AGGAGTCTGGGAGGAGCACCAGG + Intergenic
1029259691 7:99293460-99293482 GGGAGCCTTGGGGGAGGACCAGG - Intergenic
1029544006 7:101200906-101200928 TGAAGGCTTGGATGTGGACCTGG + Exonic
1029557860 7:101282810-101282832 AGGAGGCTGGAAGCTGGACCAGG + Intergenic
1032023158 7:128421336-128421358 AGGGGGCAGGGAGGTGGAACGGG + Intergenic
1032192910 7:129774615-129774637 AGGAGGCCTTGAGGAGGAGCAGG + Intergenic
1032390038 7:131549902-131549924 GGGATGGTTGGAGGTGGCCCAGG + Intronic
1033452521 7:141474471-141474493 AGGAGGATTGAAGCTGGAACAGG - Exonic
1034271160 7:149803992-149804014 CGGAGGGTTGGAGGGAGACCTGG - Intergenic
1034489824 7:151387260-151387282 AGGAGGCTTGCTGGGTGACCAGG + Intronic
1035018081 7:155783633-155783655 AGGAGGTTTGGAAGTGGTTCAGG + Intergenic
1035688835 8:1546865-1546887 CCGAGGCATGGAGGTGGTCCAGG + Intronic
1035721637 8:1797302-1797324 AGGATGATGGGAGGGGGACCAGG - Intergenic
1036654015 8:10663874-10663896 ATGAGGTTGTGAGGTGGACCAGG - Intronic
1036668142 8:10761603-10761625 GGGAGGCTTGCAGGTGGAACTGG + Intronic
1036690076 8:10939744-10939766 AGGAGGCCTGAAGGTGGGCGAGG - Intronic
1036708578 8:11062793-11062815 AGGAGGCTGGGAGGTGGGGCTGG - Intronic
1038167858 8:25102783-25102805 AGGCGGCTGGGAGGTGGAGGTGG - Intergenic
1041375118 8:57204703-57204725 AGGAGGCTTGGAAGAGGCCCAGG + Intergenic
1041375352 8:57206074-57206096 AGGAGGCTTGGAAGAGGCCCAGG + Intergenic
1041377059 8:57215839-57215861 AGGAGGCTTGGAAGAGGCCCAGG + Intergenic
1041413228 8:57579370-57579392 AGGTGGCTTGCAGGTGGCCTGGG - Intergenic
1043812415 8:84757625-84757647 AAGAGGGATGGAGGTGGAACTGG + Intronic
1048967810 8:139626839-139626861 GGGTGGCTTGGAGGAGGAGCAGG + Intronic
1049160192 8:141092719-141092741 AGAAGCCTTGGAGGTGGCCCTGG - Intergenic
1049224824 8:141445161-141445183 TGGAGCCCTGGAGGTGGCCCCGG - Intergenic
1049249676 8:141581658-141581680 ACGAGGCTGGGAGGCGGAGCAGG + Intergenic
1049321389 8:141998737-141998759 AGCAAGCCTGGAGGTGGAGCTGG - Intergenic
1049341610 8:142115399-142115421 AGGAGGCCTGGACGAGGACAGGG + Intergenic
1049372642 8:142275062-142275084 CGGAGGCCTGGAGGTGGCCCAGG + Intronic
1049446407 8:142633492-142633514 AGCAGTCCTGGGGGTGGACCGGG - Intergenic
1049665579 8:143841209-143841231 AGGAGGCTTGGAGGACGAGGAGG - Intergenic
1049672308 8:143875374-143875396 AGGATGCCTGGAGGAGGCCCGGG - Intronic
1049854252 8:144851639-144851661 AGGGGGCAGGGAGGAGGACCAGG + Intronic
1052850747 9:33377022-33377044 TGAAGGCTTGCAGGTGGACGAGG - Intergenic
1053572065 9:39319536-39319558 ATGAGACTTGGAGGGGGGCCAGG + Intergenic
1054093621 9:60878247-60878269 ATGAGACTTGGAGGGGGGCCAGG + Intergenic
1054115104 9:61154167-61154189 ATGAGACTTGGAGGGGGGCCAGG + Intergenic
1054125080 9:61299475-61299497 ATGAGACTTGGAGGGGGGCCAGG - Intergenic
1054592652 9:67028367-67028389 ATGAGACTTGGAGGGGGGCCAGG - Intergenic
1054781360 9:69168935-69168957 AGGAAGCCTGCAGGTGAACCGGG + Intronic
1056568988 9:87799462-87799484 AGGAGGCTGTGAGGAGCACCAGG - Intergenic
1057726320 9:97571098-97571120 AGCAGGCTTGGCAGTGGCCCTGG + Intronic
1057824396 9:98360957-98360979 GGAAGGCCTGGAGCTGGACCAGG - Intronic
1058165281 9:101611986-101612008 ATGAGGCTGGGAGGTGGGCAGGG + Intronic
1061230936 9:129315507-129315529 AGGGGGCTGGGAGGTGGAGCGGG - Intergenic
1061619683 9:131803796-131803818 AGGAGGTTTGGTGGGGGAACAGG - Intergenic
1062320556 9:135988756-135988778 TGGGGGCTTGGAGGTGGCTCTGG - Intergenic
1062394649 9:136347951-136347973 CTGAGGCTTGAAGGTGGGCCTGG + Intronic
1185480595 X:443566-443588 AGAAGGAGTGGAGGTGGACGAGG + Intergenic
1186042533 X:5496797-5496819 AGCAGCTTGGGAGGTGGACCAGG + Intergenic
1186461354 X:9750958-9750980 GGGAGGCTGGGAGGAGCACCTGG - Intronic
1187446759 X:19367329-19367351 TGGAGGCTGGGAGGAGGATCAGG + Intronic
1191955605 X:66639564-66639586 AGCAGGCTTGGAGTTTGACAGGG + Intergenic
1192209802 X:69120574-69120596 AGGTGGGTTGGAGGTGGAAGGGG - Intergenic
1192942789 X:75930599-75930621 AGAAGGATTGAAGGTGGACTTGG + Intergenic
1193619350 X:83732368-83732390 AAGAGGCTTGAAGGTTGGCCTGG - Intergenic
1196007345 X:110850641-110850663 AGGAGGGCTGGAGGTGGAAGGGG - Intergenic
1198229674 X:134677097-134677119 AGTAGGCTTGGAAGGGGCCCTGG + Intronic
1200184231 X:154171183-154171205 AGGAGGCTTGGGGCTGGCCCTGG - Intergenic
1200189884 X:154208311-154208333 AGGAGGCTTGGGGCTGGCCCTGG - Intergenic
1200195637 X:154246120-154246142 AGGAGGCTTGGGGCTGGCCCTGG - Intergenic
1200201290 X:154283241-154283263 AGGAGGCTTGGGGCTGGCCCTGG - Intronic
1200322914 X:155208502-155208524 AGGAAGTTTGTAGGTGGACATGG - Intronic
1202306183 Y:23473394-23473416 AGGAGCCTTGCAGGTGTACCTGG + Intergenic
1202564626 Y:26197195-26197217 AGGAGCCTTGCAGGTGTACCTGG - Intergenic