ID: 1151683687

View in Genome Browser
Species Human (GRCh38)
Location 17:75634825-75634847
Sequence CTGACTTTCAACTCAGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151683680_1151683687 7 Left 1151683680 17:75634795-75634817 CCTTGAACACCAAACCAGGAACC 0: 1
1: 0
2: 2
3: 15
4: 151
Right 1151683687 17:75634825-75634847 CTGACTTTCAACTCAGGCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 150
1151683684_1151683687 -7 Left 1151683684 17:75634809-75634831 CCAGGAACCTGGAGGACTGACTT 0: 1
1: 0
2: 0
3: 24
4: 215
Right 1151683687 17:75634825-75634847 CTGACTTTCAACTCAGGCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 150
1151683678_1151683687 21 Left 1151683678 17:75634781-75634803 CCTCTGGTGATGAGCCTTGAACA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1151683687 17:75634825-75634847 CTGACTTTCAACTCAGGCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 150
1151683677_1151683687 22 Left 1151683677 17:75634780-75634802 CCCTCTGGTGATGAGCCTTGAAC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1151683687 17:75634825-75634847 CTGACTTTCAACTCAGGCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 150
1151683683_1151683687 -2 Left 1151683683 17:75634804-75634826 CCAAACCAGGAACCTGGAGGACT 0: 1
1: 0
2: 1
3: 9
4: 189
Right 1151683687 17:75634825-75634847 CTGACTTTCAACTCAGGCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151683687 Original CRISPR CTGACTTTCAACTCAGGCTC AGG Intronic
901744859 1:11365602-11365624 CTGGGTTTCATCTCTGGCTCTGG + Intergenic
902328958 1:15721137-15721159 CTGCCTCTCAGCTCAGGCGCTGG - Intronic
902781400 1:18707288-18707310 CTGACTTTCAGATCCTGCTCTGG + Intronic
904541767 1:31238539-31238561 CTGCCCTTCAAATCAGGCCCTGG - Intronic
904888415 1:33759624-33759646 CTGACTTGAAACTCAAGCTCTGG - Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
908440064 1:64144325-64144347 CTGAAGTTCAAGTCAGGGTCTGG + Intronic
908734742 1:67264119-67264141 CAGGCTATCAACGCAGGCTCAGG + Intergenic
908786926 1:67744375-67744397 GAGAATTTCATCTCAGGCTCTGG - Intronic
909921218 1:81382674-81382696 CTGACTTTCAGCTCAGGCGGTGG - Intronic
912461309 1:109833657-109833679 CTGACTTTAAAAGCAGGCTTAGG - Intergenic
913126566 1:115795849-115795871 CTGACTGTAAACTCAGACTTGGG + Intergenic
914979872 1:152404600-152404622 CGGACTCTCAACTCAGTGTCAGG - Intergenic
916115611 1:161482570-161482592 CTGACTTTCCACACATGCTTTGG + Intergenic
917134600 1:171777376-171777398 CTGGCTTTTAGCTCTGGCTCTGG + Intergenic
917212776 1:172647022-172647044 CTGGCTTGCAAATAAGGCTCAGG + Intergenic
918783818 1:188737517-188737539 CTGCCTTTGAACTCAGGCTTTGG + Intergenic
920494444 1:206444731-206444753 CTCTCTTTGAACTCAGGATCCGG + Intronic
922002590 1:221494999-221495021 CTGGGTTTCAACTCAGGGACTGG - Intergenic
922357752 1:224792636-224792658 GTGAGATTCTACTCAGGCTCAGG - Intergenic
922989011 1:229889232-229889254 CTCTCTTTCAATACAGGCTCTGG - Intergenic
923160455 1:231310374-231310396 CCCACTCTCAACTCAGGCTCAGG - Intergenic
923676979 1:236088636-236088658 CTGAGTTCCCACCCAGGCTCTGG - Intergenic
1070785441 10:79159762-79159784 TAGAATTTGAACTCAGGCTCTGG - Intronic
1071056774 10:81520493-81520515 CTCACTTTCCACTCAGACTATGG - Intergenic
1072528715 10:96298087-96298109 CTTAGTGCCAACTCAGGCTCTGG + Intergenic
1075080823 10:119382346-119382368 CTGGGCTTCAGCTCAGGCTCTGG - Intronic
1075416933 10:122271223-122271245 CCAGGTTTCAACTCAGGCTCGGG - Intergenic
1076701253 10:132274551-132274573 CTGACATTCACCTGAGGCTTGGG + Intronic
1078146838 11:8727436-8727458 CTGGCTTTCAACTAACTCTCTGG + Intronic
1088062975 11:105679932-105679954 CTGACTTTAAACACAGGTTATGG + Intronic
1088760644 11:112926054-112926076 CTGTCTTAGCACTCAGGCTCAGG + Intergenic
1093277299 12:17145978-17146000 CTGACTTTCAGCTATGGCACTGG + Intergenic
1094008119 12:25777249-25777271 ATGGCTTTGAAGTCAGGCTCGGG + Intergenic
1097346822 12:58502513-58502535 CTCACTGTCCACTCAGGCTCTGG - Intergenic
1099094536 12:78356663-78356685 CTTACTTTCCAATCTGGCTCTGG - Intergenic
1101051364 12:100867400-100867422 CTGCCTTTGGACTCAGACTCAGG - Intronic
1103081461 12:118027215-118027237 CTGACCTTCAAGTCAGGGTAAGG + Intronic
1103722467 12:122982091-122982113 CTGACTTACACCACAGGATCTGG + Intronic
1106230767 13:27819652-27819674 CTGACTTCCCACTCATGCTTTGG - Intergenic
1107812860 13:44216857-44216879 CTGTTTTCTAACTCAGGCTCTGG - Intergenic
1112672511 13:101656457-101656479 CTTACTTTCCACTCTGACTCAGG - Intronic
1113982765 13:114290079-114290101 CTGACCATGAACTCTGGCTCAGG - Intronic
1114401301 14:22413367-22413389 GTGACTCTCAGCTCAGCCTCTGG + Intergenic
1115249727 14:31332702-31332724 CAGAAGTTCAAATCAGGCTCAGG + Intronic
1117764386 14:59065179-59065201 CTCACTCTCACCTCAAGCTCTGG + Intergenic
1118476536 14:66122339-66122361 CTGACTTTGAAGACAGGCCCTGG + Intergenic
1120830600 14:88994477-88994499 TTGACTTGCAACTCAGGCGGAGG + Intergenic
1122797339 14:104212613-104212635 CAGACGTTTAGCTCAGGCTCAGG + Intergenic
1124142563 15:27089513-27089535 CTGCCTTTCAACTCTGAGTCTGG - Intronic
1132985279 16:2763157-2763179 CTAGATTTCAACTCAGGGTCAGG - Exonic
1133610729 16:7431047-7431069 CTGGCTTTCTACTAAGGCACAGG + Intronic
1135229538 16:20692753-20692775 CTTACTTTCCAATCAGACTCTGG - Intronic
1142840236 17:2622967-2622989 CTGACGTACAGCTCAGGCTGTGG - Intronic
1144957875 17:19028622-19028644 CTGACCCTGAACCCAGGCTCCGG + Intronic
1144977283 17:19145898-19145920 CTGACCCTGAACCCAGGCTCCGG - Intronic
1148339542 17:46865134-46865156 CTCCCTCTCCACTCAGGCTCGGG - Intronic
1148540064 17:48473227-48473249 CTGAACTTCAACCCTGGCTCAGG - Intergenic
1148651256 17:49251723-49251745 CTGATTTTCAGCTGAGGCTAGGG + Intergenic
1148751190 17:49946840-49946862 CTGCCTCTCACCTCAGGCTAGGG + Intergenic
1149284146 17:55143414-55143436 CTGACATTCAACTCTGGGTTAGG - Intronic
1149570979 17:57672136-57672158 GTGACTTTGAGCTGAGGCTCCGG + Intronic
1150222682 17:63506175-63506197 CTGGTTTTCAGATCAGGCTCAGG + Intronic
1150424098 17:65063383-65063405 TGTACTTTGAACTCAGGCTCTGG + Intergenic
1150578710 17:66453177-66453199 CTGACTTGGAACAGAGGCTCTGG + Intronic
1151162030 17:72173901-72173923 CTGACTTGACACTCAGGCCCAGG - Intergenic
1151683687 17:75634825-75634847 CTGACTTTCAACTCAGGCTCAGG + Intronic
1155581681 18:27315472-27315494 CTGACTTTCAAATAAGGCATGGG + Intergenic
1159497769 18:69227842-69227864 CTTAATTTAAACTCAGTCTCAGG + Intergenic
926227760 2:10980588-10980610 CTCAGTTTCAGCTCAGGCACTGG + Intergenic
926843981 2:17113307-17113329 CAGACTTTCAACACAGGAGCAGG + Intergenic
928581627 2:32713772-32713794 TTGACTTTTAACTTAGGCTCAGG + Intronic
929180600 2:39033898-39033920 CTGAATTTCATTACAGGCTCAGG + Intronic
931418175 2:62100976-62100998 CTTACTTTCCAATCAGACTCTGG - Intronic
932337224 2:70938223-70938245 CTCACTTCCTCCTCAGGCTCTGG + Intronic
934589283 2:95531594-95531616 CTGAGTTTCAACTGAGTCACTGG - Intergenic
937343019 2:121104019-121104041 CTGTCTTTCGCCTCAGGCTCTGG - Intergenic
939562548 2:143750053-143750075 CTGGTTTTCCACTCTGGCTCAGG - Intronic
943790813 2:191930611-191930633 CTGAAATTTAACTCATGCTCTGG + Intergenic
943955460 2:194183266-194183288 CTGACTTACGCCTCAGGCACTGG + Intergenic
944740217 2:202604890-202604912 CTCACGTTCAACTAAGGCCCAGG - Intergenic
947043195 2:225948284-225948306 ATGCCTTTTAACTCAGGGTCAGG + Intergenic
947137757 2:226992196-226992218 CTGGCTGTCCACTCAGTCTCAGG - Intronic
948130960 2:235600345-235600367 CTCAGTAGCAACTCAGGCTCAGG + Intronic
1169043837 20:2519768-2519790 CACACTTTCAACTAAGGTTCAGG - Intronic
1170777726 20:19392181-19392203 TAGAATTACAACTCAGGCTCAGG - Intronic
1172505452 20:35458412-35458434 ATGAATTTCAACTCAGTATCAGG - Intronic
1173607492 20:44341995-44342017 CTGACTGTCAAGTCAGATTCCGG + Intronic
1175004541 20:55668095-55668117 CTGCCTTTGAACTCTGCCTCTGG - Intergenic
1177190743 21:17848430-17848452 CTGACTGTCAGCTGAGGCTATGG + Intergenic
1179460600 21:41532304-41532326 CTGACTTTCCAATCTGACTCTGG - Intergenic
1179649621 21:42799147-42799169 CTGACTTTCCAATCTGACTCTGG - Intergenic
1181181285 22:21070233-21070255 CTGACTGTCCATGCAGGCTCTGG - Intergenic
1183200570 22:36383264-36383286 CTTACTTCCAACTCTGGCTCTGG - Intronic
1183991233 22:41598366-41598388 CTAACTGTAAACTCAGGCTCAGG - Exonic
1184016370 22:41788813-41788835 GTGACATTCAACTCTGCCTCTGG + Intronic
951529531 3:23685747-23685769 CTGCCTCTCAACTCAGTCTTGGG + Intergenic
952107336 3:30085478-30085500 CTGACTTTCCAATCTGCCTCTGG + Intergenic
953458492 3:43062791-43062813 CTGACATTCCACTCAGGGTGGGG - Intergenic
953905654 3:46867178-46867200 CGGACCTTCAACCCAGACTCCGG + Intronic
955235301 3:57134080-57134102 CTGACTTTAAACTAAGAATCGGG + Intronic
958553624 3:95645934-95645956 CAGACCTTCAACTGAGGGTCCGG + Intergenic
964094369 3:152914543-152914565 CTCACTTTCTAGGCAGGCTCTGG + Intergenic
964747069 3:160022401-160022423 CTCACCCTCCACTCAGGCTCAGG + Intronic
965333483 3:167406502-167406524 CTGGTCTTGAACTCAGGCTCAGG - Intergenic
966750542 3:183317507-183317529 CTGACCTTCAACTCAGGACAGGG + Intronic
966754068 3:183352162-183352184 GTGACTTTCCACTCAGGATGAGG - Intronic
969277066 4:6143040-6143062 CTGAAGTTCAACACAGACTCTGG + Intronic
970676462 4:18455691-18455713 CTGACTTTCCCCTCAGGATAAGG - Intergenic
972715270 4:41639898-41639920 GTGACTTGAAACTGAGGCTCAGG - Intronic
973533207 4:51853569-51853591 CTGACTCTCAACTCAATCCCTGG - Intronic
973764884 4:54153911-54153933 CTGCCCTTGACCTCAGGCTCAGG + Intronic
973832298 4:54773897-54773919 CTGGGTTTGAATTCAGGCTCTGG + Intergenic
978425160 4:108574491-108574513 CAGACTTTCAACTCACAGTCTGG - Intergenic
979593366 4:122505818-122505840 CTGACCTTGAACTCAGCCTTTGG + Intergenic
979754625 4:124325543-124325565 GTGACTTTCACATCAGGCACAGG + Intergenic
980033293 4:127855275-127855297 GTGCTTTTCAACTCAGGATCTGG - Intergenic
983577247 4:169271783-169271805 CGGACTTCCAACCCAGGCTCGGG + Intergenic
983626001 4:169802685-169802707 CTTACTTTCCAATCAGACTCTGG - Intergenic
985799250 5:1992997-1993019 CTGCCTTTCAAGTCAGGCTCAGG - Intergenic
986244364 5:5992066-5992088 CCAACTTTCATTTCAGGCTCTGG + Intergenic
986658791 5:10040832-10040854 TTGACTTGCAAGTAAGGCTCTGG - Intergenic
989085595 5:37672895-37672917 CTGACTTTTACTTCAGGTTCAGG + Intronic
991255198 5:64605659-64605681 CTGACTATCACCTAAGGCTGAGG - Intronic
992465160 5:76997008-76997030 TGGGCTTTCAACTCAGGCTCTGG + Intergenic
993103810 5:83575216-83575238 CTGACTTTCATATGAGACTCGGG - Intronic
994098108 5:95865459-95865481 CTGAGATTCAAATCAGGATCAGG + Intergenic
1000218937 5:159192966-159192988 CTGAGTCTCAGCTCAGGCTGAGG - Intronic
1000240248 5:159402410-159402432 CTGATATTGAGCTCAGGCTCAGG + Intergenic
1000326289 5:160175270-160175292 TTGACTTTCAGCACAGTCTCTGG + Intergenic
1001089582 5:168727464-168727486 CTGCCTTGGAACTCAAGCTCTGG - Intronic
1003563926 6:7206588-7206610 CTTACTTTCAACTGAGGGTGAGG + Intronic
1013442800 6:110188602-110188624 CTCCCTTTCAGCTGAGGCTCAGG + Intronic
1016751811 6:147638542-147638564 CTGAATTTCAAACCAGGCTCAGG - Intronic
1019107307 6:169678714-169678736 CTGACTTTCCAATCTGACTCTGG + Intronic
1023227823 7:37990162-37990184 CTGTCTTTCAAATCAGAGTCTGG + Intronic
1026569603 7:71517842-71517864 ATAACTTTCATCACAGGCTCAGG - Intronic
1028124798 7:87100433-87100455 CTGACTCATAACTCAGGCTCTGG + Intergenic
1028124835 7:87100806-87100828 CTGACTCATAACTTAGGCTCTGG + Intergenic
1028976493 7:96920601-96920623 CTGATTTTTAACACATGCTCTGG - Intergenic
1029355405 7:100048154-100048176 CTGACTTTTCAACCAGGCTCTGG + Intergenic
1031857793 7:126942937-126942959 CTGAATTTCAACTCAGTATTGGG - Intronic
1035254902 7:157619960-157619982 CTCACTTTCAGCTCAGCATCAGG - Intronic
1038516178 8:28189413-28189435 CTGATTTTTAACTCAAGCTCAGG - Intronic
1039188631 8:34946504-34946526 CAGGCTTTCATCTCAGGCACAGG - Intergenic
1046306801 8:112378645-112378667 CTGCCTTCCAAGTCAGCCTCTGG - Intronic
1046732882 8:117744593-117744615 CTGACTTTCAAATCATGATAAGG - Intergenic
1047515525 8:125551381-125551403 CTGAATTTCAAATCATGTTCAGG + Intergenic
1048031718 8:130639497-130639519 CTGACTGTCAGCGCAGGGTCAGG - Intergenic
1048841197 8:138568147-138568169 CTGACTTACAATTCAAACTCTGG + Intergenic
1052978065 9:34426638-34426660 CTGACTTTAAAATCTGCCTCAGG + Intronic
1056121029 9:83488895-83488917 TTGACAATCAACTCAGCCTCTGG - Intronic
1059282676 9:113148451-113148473 CTGACTTTCAACACAGCCTCCGG + Intergenic
1059707048 9:116835276-116835298 CTTACTTTCCAATCTGGCTCTGG + Intronic
1060012246 9:120054025-120054047 CTGACTGTCTTCTCAGACTCTGG - Intergenic
1061522259 9:131125732-131125754 CTGACCTTCATCTCCCGCTCGGG - Exonic
1062723642 9:138058790-138058812 CTGACTCTCCACTCAGCCTCAGG - Intronic
1186456970 X:9717380-9717402 CTGGCTTTCCCCTCAGCCTCAGG + Exonic
1187044270 X:15630668-15630690 CTGACTTTCAACCCAGCATTGGG - Intronic
1188745886 X:33842887-33842909 CAAACTTTCACCTCAGGCTGAGG + Intergenic
1192845582 X:74903996-74904018 CTGTCTTTGTGCTCAGGCTCTGG + Intronic
1196594367 X:117526382-117526404 CTTTCTTTTAACTCTGGCTCTGG - Intergenic
1198587661 X:138140586-138140608 CTGACTTTCTACTGTGCCTCAGG - Intergenic
1199937390 X:152588219-152588241 CTAACTTTCCACTGAGGGTCTGG - Intergenic
1200767527 Y:7092933-7092955 CTGGCTTTCCCCTCAGTCTCAGG + Intergenic
1202239790 Y:22754659-22754681 CTGACTTTCACACCAGGCTTGGG - Intergenic
1202392776 Y:24388421-24388443 CTGACTTTCACACCAGGCTTGGG - Intergenic
1202478007 Y:25281696-25281718 CTGACTTTCACACCAGGCTTGGG + Intergenic