ID: 1151683688

View in Genome Browser
Species Human (GRCh38)
Location 17:75634828-75634850
Sequence ACTTTCAACTCAGGCTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151683684_1151683688 -4 Left 1151683684 17:75634809-75634831 CCAGGAACCTGGAGGACTGACTT 0: 1
1: 0
2: 0
3: 24
4: 215
Right 1151683688 17:75634828-75634850 ACTTTCAACTCAGGCTCAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 164
1151683677_1151683688 25 Left 1151683677 17:75634780-75634802 CCCTCTGGTGATGAGCCTTGAAC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1151683688 17:75634828-75634850 ACTTTCAACTCAGGCTCAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 164
1151683680_1151683688 10 Left 1151683680 17:75634795-75634817 CCTTGAACACCAAACCAGGAACC 0: 1
1: 0
2: 2
3: 15
4: 151
Right 1151683688 17:75634828-75634850 ACTTTCAACTCAGGCTCAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 164
1151683683_1151683688 1 Left 1151683683 17:75634804-75634826 CCAAACCAGGAACCTGGAGGACT 0: 1
1: 0
2: 1
3: 9
4: 189
Right 1151683688 17:75634828-75634850 ACTTTCAACTCAGGCTCAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 164
1151683678_1151683688 24 Left 1151683678 17:75634781-75634803 CCTCTGGTGATGAGCCTTGAACA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1151683688 17:75634828-75634850 ACTTTCAACTCAGGCTCAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151683688 Original CRISPR ACTTTCAACTCAGGCTCAGG TGG Intronic
904277908 1:29396197-29396219 ACTTTCTTCTCAGGGTCATGGGG + Intergenic
904535987 1:31199664-31199686 CATTTCAACTCATGCTCAGATGG - Intronic
909550455 1:76894029-76894051 ATTTTCAAATCAGTCCCAGGTGG + Intronic
909623437 1:77689968-77689990 CCTTCCACCTCAGGCTCAGCTGG - Intergenic
911852675 1:102838861-102838883 TCTTTGCACTCAGGCTCAGCTGG - Intergenic
912615118 1:111091894-111091916 ACCTTTAACACAGCCTCAGGAGG - Intergenic
912735841 1:112148868-112148890 ACAATGAACTCAGGCTGAGGTGG + Intergenic
914387818 1:147188798-147188820 ACTGACTACTCAGGTTCAGGAGG + Intronic
917183792 1:172328775-172328797 ACTTTTATTTTAGGCTCAGGGGG - Intronic
917891175 1:179439757-179439779 TCTTTGCACTCAGGCTCAGCTGG + Intronic
922189229 1:223302533-223302555 TCTCTAGACTCAGGCTCAGGAGG - Intronic
923845573 1:237727841-237727863 ACATTCAAGTCTGGCTTAGGTGG + Intronic
1064084702 10:12336599-12336621 ACTTTTAATTTAGGCTCAGGTGG - Intergenic
1067327606 10:45284616-45284638 TCTTTGCACTCAGGCTCAGCTGG - Intergenic
1067555398 10:47266185-47266207 ACTTTTATTTCAGGTTCAGGGGG - Intergenic
1068327607 10:55514873-55514895 ACTTTCTACTCTAGCTTAGGTGG + Intronic
1068679192 10:59800772-59800794 AATTTCAACTTAGGTTCTGGTGG - Intronic
1071469795 10:85975710-85975732 TCTTTCAACTCAGCTCCAGGAGG + Intronic
1071749393 10:88457667-88457689 AGTTTTAACTCAGACCCAGGAGG + Intronic
1073999299 10:109353106-109353128 ACTTTTAATTTAGGTTCAGGAGG + Intergenic
1074104502 10:110378269-110378291 CCTTTAAAACCAGGCTCAGGTGG + Intergenic
1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG + Intergenic
1075261987 10:120970944-120970966 CCTTTCAACCCAGGACCAGGAGG - Intergenic
1080072528 11:28107546-28107568 ACCTACAACTGGGGCTCAGGAGG + Intronic
1080703085 11:34661825-34661847 CCTTTCAACTCAGGCATACGGGG - Intergenic
1083354039 11:62052133-62052155 TCTTTGCACTCAGGCTCAGCTGG + Intergenic
1087115923 11:94524235-94524257 ACTTGAAGCTGAGGCTCAGGGGG + Intergenic
1089766659 11:120772555-120772577 GCCTTCAACTCAGGCTAAGGAGG + Intronic
1090727676 11:129542358-129542380 ACTTTTAATTTAGGTTCAGGGGG + Intergenic
1091577467 12:1751814-1751836 ACTATAAACGCACGCTCAGGCGG - Intronic
1092113477 12:5981544-5981566 AATTTCCACTCAGGCTGAGCTGG + Intronic
1092949395 12:13487364-13487386 TCCTCCAACTCAGGCTAAGGTGG - Intergenic
1096698353 12:53365546-53365568 ACTTTTGACTAAGGCTGAGGAGG - Intergenic
1098141870 12:67457958-67457980 TGTTTCCACCCAGGCTCAGGAGG - Intergenic
1099716352 12:86297705-86297727 ACTATCAACTCATACACAGGTGG + Intronic
1102538404 12:113599749-113599771 AATTTCATCTCAGCCTCAAGTGG + Intergenic
1103047598 12:117750510-117750532 ACTTTCATTTTAGGTTCAGGAGG + Intronic
1105506055 13:21010659-21010681 AATTTCAACTAAGGCCCAGTTGG - Intronic
1106618348 13:31351086-31351108 ACTCACAGCTCAGGGTCAGGTGG + Intergenic
1106895848 13:34301576-34301598 ACTTCCATCTCATGCTCAGTTGG + Intergenic
1109494916 13:63157513-63157535 ACTTTCACTTTAGGTTCAGGAGG + Intergenic
1110596866 13:77329049-77329071 ATTTACAGCGCAGGCTCAGGTGG + Intergenic
1111134321 13:84020516-84020538 ACTTTAAATTCAACCTCAGGTGG - Intergenic
1114248115 14:20933700-20933722 ACCTCCAACACAGGCTCAAGAGG - Intergenic
1114336354 14:21694647-21694669 AATTTCAACTCAAGCTGAAGGGG - Intergenic
1114468215 14:22939937-22939959 ACTTTCATTTTAGGCTCAGGGGG - Intergenic
1114647529 14:24263878-24263900 CCTTTCCACTCAGGCTTGGGTGG + Intronic
1115000885 14:28418657-28418679 TCTTTGCACTCAGGCTCAGCTGG - Intergenic
1115533028 14:34344403-34344425 TCTCTCAACTCTGGCTCAGGAGG - Intronic
1117032386 14:51686724-51686746 AATCTCAACTCAGTCCCAGGAGG - Intronic
1119489883 14:75022298-75022320 ACTTTCATTTTAGGTTCAGGGGG - Intronic
1122446675 14:101774701-101774723 ACTTGTAAGGCAGGCTCAGGAGG + Intronic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1123051090 14:105543388-105543410 CCCTGCTACTCAGGCTCAGGAGG + Intergenic
1123664044 15:22593214-22593236 AATCTCAACTCAGTCCCAGGAGG + Intergenic
1124317875 15:28687652-28687674 AATCTCAACTCAGTCCCAGGAGG + Intergenic
1124383449 15:29186753-29186775 ACTTTCAACTCAGCTTTATGAGG - Intronic
1124565560 15:30809827-30809849 AATCTCAACTCAGTCCCAGGAGG - Intergenic
1125106094 15:35973195-35973217 GCTGGCAACTCAGGCTCACGTGG - Intergenic
1125980089 15:43992791-43992813 ACCTCAAACTCAGGCTCAAGTGG + Intronic
1126152004 15:45531808-45531830 ACTTTTGACACAGCCTCAGGAGG + Intergenic
1127455437 15:59152333-59152355 AGTTTCAAATGAGGATCAGGAGG - Intronic
1129139190 15:73581718-73581740 ACTGTCAACTCAGGCCATGGAGG + Intronic
1131768844 15:95712408-95712430 TCTTTTAAGTCAGGCTAAGGTGG - Intergenic
1132633599 16:931811-931833 ACATGAAACTCAGGCTCACGAGG + Intronic
1143563327 17:7707821-7707843 ACTTTCCACTCAGACAAAGGCGG + Intronic
1147390611 17:40106970-40106992 TCTTTCCACTCAGGCTGAGCCGG - Intergenic
1147478063 17:40733157-40733179 AATCTCCACTCAGGCTCAGAGGG - Intergenic
1147981886 17:44279974-44279996 TCTGTCTACTCAGGCTTAGGTGG + Intergenic
1149632093 17:58134723-58134745 CCTAGCTACTCAGGCTCAGGAGG - Intergenic
1151511976 17:74566311-74566333 GCTCTCAGCTCAGGCTCTGGGGG + Intergenic
1151683688 17:75634828-75634850 ACTTTCAACTCAGGCTCAGGTGG + Intronic
1152337643 17:79707395-79707417 TCTTTCATCTCAGGCACTGGGGG - Intergenic
1152622002 17:81369672-81369694 ATTTTCAAATGAGGCTCAGCAGG + Intergenic
1155424873 18:25696447-25696469 GCTTTTAACTCCTGCTCAGGGGG + Intergenic
1156766083 18:40657158-40657180 ACTTTCATTTCAGATTCAGGGGG - Intergenic
1160399672 18:78601016-78601038 GCTTTCAACTGAGGCTCACTTGG + Intergenic
1162982100 19:14247107-14247129 ACTTTCGCCTCAGCCACAGGGGG - Intergenic
1165765930 19:38351214-38351236 ACTTTCCAATGAGGCTGAGGCGG + Intronic
1168368206 19:55807739-55807761 ACTTTCAGGTCAGGCTCATCAGG - Intronic
926268512 2:11346386-11346408 GCCTCCAACTCAGCCTCAGGGGG - Intronic
929824171 2:45297093-45297115 ACTGTCCACTAAGGCACAGGTGG + Intergenic
930510548 2:52338711-52338733 ACCTACAACACAGCCTCAGGAGG + Intergenic
931124012 2:59253568-59253590 ACTTTCAAATCAGACACAGAAGG - Intergenic
932220227 2:69993493-69993515 ACTGTGATCTCAGGTTCAGGGGG - Intergenic
937391287 2:121488951-121488973 ATTTTAAACTCAGATTCAGGAGG + Intronic
938607126 2:132906633-132906655 ACTTTCTTCTTTGGCTCAGGTGG - Intronic
939786013 2:146514105-146514127 ACTTTTATTTTAGGCTCAGGGGG + Intergenic
1168935059 20:1657865-1657887 ACTTACAAATCAGGCACAGTAGG + Intergenic
1170573891 20:17648254-17648276 ACTTCCCCCACAGGCTCAGGAGG - Intronic
1173085463 20:39911922-39911944 ACTTTTAATTTAGGTTCAGGAGG + Intergenic
1173178492 20:40783618-40783640 ACTTTCAGGACAGGCTTAGGAGG + Intergenic
1174312034 20:49664325-49664347 CCTCCCAACTCAGCCTCAGGAGG + Intronic
1175017704 20:55809731-55809753 ACTTTCAACTAAAACTCAGTAGG - Intergenic
1175788347 20:61725831-61725853 ACTTGCAATTAAGGCTCAGGTGG - Intronic
1179028036 21:37696303-37696325 ACTTCTATCTCTGGCTCAGGTGG - Intronic
1180835077 22:18925761-18925783 CCTGTCACCTGAGGCTCAGGTGG - Intronic
1182083887 22:27548267-27548289 AGGTTCAACTCAGGCTCTGAAGG + Intergenic
1184108521 22:42382374-42382396 ACTGCAAACTGAGGCTCAGGTGG + Exonic
1203285166 22_KI270734v1_random:151060-151082 CCTGTCACCTGAGGCTCAGGTGG - Intergenic
949584325 3:5423187-5423209 ACTTTCAAAGCACGCTGAGGAGG - Intergenic
951274025 3:20663296-20663318 TCTTTGAACTTCGGCTCAGGTGG + Intergenic
953803579 3:46048488-46048510 TCTTTGCACTCAGGCTCAGCTGG + Intergenic
953846427 3:46430588-46430610 TCTTTGCACTCAGGCTCAGCTGG - Intergenic
953983774 3:47426262-47426284 CCTTTCAACACAGGGGCAGGAGG - Intronic
954296060 3:49674985-49675007 GCTGTCAGCTCAGGCTCTGGAGG + Intronic
957708162 3:83816988-83817010 AAATTCAACTCAGACACAGGTGG + Intergenic
959061628 3:101621537-101621559 ACTTTTATTTTAGGCTCAGGGGG + Intergenic
960347497 3:116552400-116552422 ACTTTCAACACAAGGTCAAGAGG + Intronic
962200646 3:133398833-133398855 ATTCTCAACTCAACCTCAGGAGG - Intergenic
964886880 3:161493674-161493696 ACTTTTATTTCAGGTTCAGGGGG + Intergenic
966686114 3:182697753-182697775 ACTTTCAAAGCATACTCAGGAGG - Intergenic
966938722 3:184731693-184731715 ACTTGAAGCTCAGGCTCAGGAGG + Intergenic
970296790 4:14639414-14639436 ACTTTTAACCCAGTCACAGGTGG + Intergenic
970546953 4:17139576-17139598 ACTATCAAGTAAGGCTGAGGAGG - Intergenic
971641638 4:29140680-29140702 CCTTTCAACTCACTCTCAAGGGG - Intergenic
971712882 4:30139787-30139809 TCTTTCAAGTCAGGCTCAAGGGG + Intergenic
975705973 4:77112465-77112487 ACTTTCACCTCTGGCCCAGGAGG - Intergenic
975737403 4:77394602-77394624 TCTTTGCACTCAGGCTCAGCTGG + Intronic
976466255 4:85372164-85372186 ACTTTCATTTTAGGTTCAGGGGG - Intergenic
978284682 4:107061988-107062010 CCTGTAACCTCAGGCTCAGGAGG + Intronic
978314712 4:107422824-107422846 ACTTTCATCTTAGGTTCAGAAGG - Intergenic
980126043 4:128775319-128775341 ACTAGCTACTCAGGCTGAGGTGG + Intergenic
981895694 4:149796280-149796302 ACTACCACCTCAGGCACAGGAGG - Intergenic
982350481 4:154409518-154409540 CCTGTCAGCTCAGGCTCAGGAGG - Intronic
982352178 4:154428029-154428051 TCTTTGAACTCAAACTCAGGAGG + Intronic
986244367 5:5992069-5992091 ACTTTCATTTCAGGCTCTGGGGG + Intergenic
986634564 5:9808761-9808783 ACTTTCACCACAGGCTTATGAGG + Intergenic
987181020 5:15368513-15368535 ACTTTGAATTCACTCTCAGGGGG - Intergenic
988159901 5:27505298-27505320 CCTTTCACCTCAGCCTCAGCTGG - Intergenic
989289774 5:39749660-39749682 ACTTACAAGTCAGCCTCAGTAGG + Intergenic
993439028 5:87932387-87932409 ACTTTTATTTCAGGTTCAGGGGG - Intergenic
993488189 5:88512945-88512967 ACTTCTTACTCAGGCTGAGGCGG - Intergenic
995170608 5:109107336-109107358 ACTTTTATTTTAGGCTCAGGGGG + Intronic
996354069 5:122577420-122577442 CCTTGCATCTCAGGGTCAGGAGG + Intergenic
996876329 5:128244061-128244083 AAGTTCTACTCAGGCTCAAGGGG - Intergenic
998398481 5:141835046-141835068 ACTGTGGTCTCAGGCTCAGGTGG - Intergenic
1000416690 5:160991840-160991862 ATTTTCAACTCACTCACAGGGGG - Intergenic
1000444573 5:161304083-161304105 ACTTTCAAATAAGGCTAGGGAGG + Intronic
1006228554 6:32561945-32561967 TCTTTTCACTCAGGCTCAGCTGG + Intronic
1007941232 6:45783263-45783285 ACAGTCAACTCTGGCTCATGTGG + Intergenic
1011411096 6:87067289-87067311 ACTTTCAGCTCATGCTCTGGAGG - Intergenic
1014567568 6:122969130-122969152 ACTTTTATTTCAGGTTCAGGGGG + Intergenic
1015441270 6:133249776-133249798 ACGTTCAACTCAGACTCTGGAGG - Intronic
1017514961 6:155147944-155147966 CCATTCAACTCAGGTTCAGAGGG - Intronic
1022204315 7:28148861-28148883 ACATGCAACTCAGGGTCTGGAGG + Intronic
1024120293 7:46229963-46229985 ATTTTCACCTCTGGCTCAGTGGG + Intergenic
1027443582 7:78246268-78246290 ATCTTCAACTCAGGCACTGGTGG - Intronic
1032435823 7:131899574-131899596 ACATTTAACTCAGGCGGAGGGGG + Intergenic
1033499951 7:141937488-141937510 AGTTTCAGCTCAGCCACAGGAGG + Intronic
1035254901 7:157619957-157619979 ACTTTCAGCTCAGCATCAGGCGG - Intronic
1036506768 8:9364056-9364078 ACCTACAACTCAGGCTCTGCTGG + Intergenic
1037439684 8:18903120-18903142 CCTAGCAGCTCAGGCTCAGGGGG + Intronic
1038452923 8:27651391-27651413 ACATTCAAACCAGGCTCAGAAGG - Intronic
1038525380 8:28268497-28268519 ACTGTGGACTCAGGCTCAGAAGG - Intergenic
1038647124 8:29371329-29371351 TCTTTCATCTCACGCACAGGTGG - Intergenic
1039333906 8:36569043-36569065 ACTTTCAGCACAGGATCAGCAGG - Intergenic
1040345213 8:46485852-46485874 TCTTTGCACTCAGGCTCAGCTGG + Intergenic
1040577562 8:48667169-48667191 ACTTTCATTTCAGCCTCAAGTGG - Intergenic
1042375603 8:68047631-68047653 TCTCTCAACTCAGCCTCAGTAGG + Intronic
1043941692 8:86203474-86203496 ACTTTCACCTCAGGGTCACGAGG + Intergenic
1045060450 8:98406305-98406327 GCTTTCATCTTAGGTTCAGGGGG + Intronic
1046030518 8:108777878-108777900 CCTTTCAACTCATGGACAGGAGG - Intronic
1048116581 8:131530951-131530973 ACTTTCAACTCCAGCTATGGTGG + Intergenic
1050620986 9:7451741-7451763 ACTTTCATTTTAGGTTCAGGGGG + Intergenic
1052978066 9:34426641-34426663 ACTTTAAAATCTGCCTCAGGAGG + Intronic
1056696232 9:88856384-88856406 ACTTTCAACTCCCACTCAGATGG + Intergenic
1057560503 9:96124627-96124649 ACTTTCAATTCAACCTCAGAGGG + Intergenic
1058935454 9:109765865-109765887 CATTGCATCTCAGGCTCAGGAGG - Intronic
1058942047 9:109822381-109822403 ACTTTCATTTCAGGTTCAAGGGG + Intronic
1060522116 9:124299912-124299934 ACGCCCAACTCAGGGTCAGGGGG - Intronic
1187038358 X:15566220-15566242 ACTTTCATCTAAGGGTGAGGGGG - Intronic
1187684027 X:21798695-21798717 TCTTTCACCTCAGACTCAAGGGG + Intergenic
1188336537 X:28941712-28941734 ACTTTCTTCTCATGCTCAAGAGG + Intronic
1190722290 X:53159688-53159710 TCTTTGCACTCAGGCTCAGCTGG + Intergenic
1190957326 X:55208351-55208373 ACTTTCATTTTAGACTCAGGGGG + Intronic
1191140045 X:57107037-57107059 TCTTTGTACTCAGGCTCAGCTGG - Intergenic
1193656365 X:84203034-84203056 ACTAACAACTCAGGCTCAATGGG - Intergenic
1200018734 X:153184276-153184298 ACTTTCCAATCCTGCTCAGGTGG - Intergenic