ID: 1151685257

View in Genome Browser
Species Human (GRCh38)
Location 17:75642435-75642457
Sequence CAGGCCACACTGGCAATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151685246_1151685257 7 Left 1151685246 17:75642405-75642427 CCACACCCCCGCCATTTCCAGCT 0: 1
1: 0
2: 2
3: 40
4: 442
Right 1151685257 17:75642435-75642457 CAGGCCACACTGGCAATAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 156
1151685249_1151685257 1 Left 1151685249 17:75642411-75642433 CCCCGCCATTTCCAGCTGGCAGT 0: 1
1: 0
2: 0
3: 8
4: 142
Right 1151685257 17:75642435-75642457 CAGGCCACACTGGCAATAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 156
1151685252_1151685257 -4 Left 1151685252 17:75642416-75642438 CCATTTCCAGCTGGCAGTCCAGG 0: 1
1: 1
2: 2
3: 19
4: 245
Right 1151685257 17:75642435-75642457 CAGGCCACACTGGCAATAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 156
1151685241_1151685257 18 Left 1151685241 17:75642394-75642416 CCCAGCCCCTGCCACACCCCCGC 0: 1
1: 0
2: 9
3: 127
4: 1056
Right 1151685257 17:75642435-75642457 CAGGCCACACTGGCAATAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 156
1151685242_1151685257 17 Left 1151685242 17:75642395-75642417 CCAGCCCCTGCCACACCCCCGCC 0: 1
1: 1
2: 26
3: 234
4: 2073
Right 1151685257 17:75642435-75642457 CAGGCCACACTGGCAATAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 156
1151685243_1151685257 13 Left 1151685243 17:75642399-75642421 CCCCTGCCACACCCCCGCCATTT 0: 1
1: 0
2: 2
3: 25
4: 307
Right 1151685257 17:75642435-75642457 CAGGCCACACTGGCAATAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 156
1151685245_1151685257 11 Left 1151685245 17:75642401-75642423 CCTGCCACACCCCCGCCATTTCC 0: 1
1: 0
2: 2
3: 23
4: 414
Right 1151685257 17:75642435-75642457 CAGGCCACACTGGCAATAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 156
1151685251_1151685257 -1 Left 1151685251 17:75642413-75642435 CCGCCATTTCCAGCTGGCAGTCC 0: 1
1: 0
2: 1
3: 20
4: 235
Right 1151685257 17:75642435-75642457 CAGGCCACACTGGCAATAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 156
1151685254_1151685257 -10 Left 1151685254 17:75642422-75642444 CCAGCTGGCAGTCCAGGCCACAC 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1151685257 17:75642435-75642457 CAGGCCACACTGGCAATAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 156
1151685250_1151685257 0 Left 1151685250 17:75642412-75642434 CCCGCCATTTCCAGCTGGCAGTC 0: 1
1: 0
2: 1
3: 19
4: 185
Right 1151685257 17:75642435-75642457 CAGGCCACACTGGCAATAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 156
1151685244_1151685257 12 Left 1151685244 17:75642400-75642422 CCCTGCCACACCCCCGCCATTTC 0: 1
1: 0
2: 1
3: 26
4: 322
Right 1151685257 17:75642435-75642457 CAGGCCACACTGGCAATAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 156
1151685248_1151685257 2 Left 1151685248 17:75642410-75642432 CCCCCGCCATTTCCAGCTGGCAG 0: 1
1: 0
2: 1
3: 14
4: 209
Right 1151685257 17:75642435-75642457 CAGGCCACACTGGCAATAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151685257 Original CRISPR CAGGCCACACTGGCAATAGC AGG Intronic