ID: 1151685718

View in Genome Browser
Species Human (GRCh38)
Location 17:75645528-75645550
Sequence TTGGTTCCCAAACCTGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151685718_1151685721 29 Left 1151685718 17:75645528-75645550 CCATGAACAGGTTTGGGAACCAA 0: 1
1: 0
2: 3
3: 10
4: 149
Right 1151685721 17:75645580-75645602 ACTGACGGAGCTGCACGCAAAGG 0: 1
1: 0
2: 0
3: 0
4: 120
1151685718_1151685720 14 Left 1151685718 17:75645528-75645550 CCATGAACAGGTTTGGGAACCAA 0: 1
1: 0
2: 3
3: 10
4: 149
Right 1151685720 17:75645565-75645587 TAAGCATCTGACTTAACTGACGG 0: 1
1: 0
2: 0
3: 14
4: 120
1151685718_1151685722 30 Left 1151685718 17:75645528-75645550 CCATGAACAGGTTTGGGAACCAA 0: 1
1: 0
2: 3
3: 10
4: 149
Right 1151685722 17:75645581-75645603 CTGACGGAGCTGCACGCAAAGGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151685718 Original CRISPR TTGGTTCCCAAACCTGTTCA TGG (reversed) Intronic
900611930 1:3547927-3547949 TTGGGTCCCACACCTTCTCAAGG - Intronic
901369794 1:8787253-8787275 ATGGCTCCCTAGCCTGTTCAAGG + Intronic
908672476 1:66563398-66563420 TTGGTGACCAAATCTGTTAAAGG - Intronic
910464210 1:87479352-87479374 CTGGTTTCCAAACCTGTTTCTGG + Intergenic
910804697 1:91178877-91178899 TTGCTGCCCAAAGTTGTTCATGG + Intergenic
911099469 1:94083252-94083274 TTGTATTTCAAACCTGTTCAAGG - Intronic
911124603 1:94329508-94329530 TTCATTCCAAAACCTCTTCAAGG - Intergenic
914359031 1:146914442-146914464 CTGGTTTCCAAACCTGTTTCTGG + Intergenic
914494714 1:148185434-148185456 CTGGTTTCCAAACCTGTTTCTGG - Intergenic
915850528 1:159316894-159316916 TTTTTTCAAAAACCTGTTCATGG + Intergenic
918909662 1:190550201-190550223 TTGGTTCCCTTACATGTTTATGG - Intergenic
920822422 1:209393394-209393416 TTTGTTCCAAAATGTGTTCAAGG - Intergenic
1063919403 10:10917135-10917157 TTTGTTCCCCAACCTGTTTATGG - Intergenic
1067668305 10:48297224-48297246 TTGCTCCCCAAACCTATTTATGG + Intergenic
1069558870 10:69415798-69415820 TGGCTTCCCAAATCTGGTCATGG - Intronic
1069629860 10:69890846-69890868 TTGGTTTCCACACCTGTCAAAGG - Intronic
1069981939 10:72258825-72258847 AGGGTTCCCAAACCTGTTCAAGG + Intergenic
1070889155 10:79929316-79929338 GTGGTTCCCAGCCCTTTTCAAGG - Intergenic
1072547242 10:96449158-96449180 TTTGTTTCCTAATCTGTTCATGG - Intronic
1075607471 10:123823272-123823294 TTGGTTCCCAGGCCTCTACATGG - Intronic
1077678076 11:4215041-4215063 TTGCTTCCCCAAGCTCTTCATGG + Intergenic
1078535130 11:12167097-12167119 CTGATTCCCAATCCTGTCCAGGG + Intronic
1079776072 11:24529568-24529590 TTGATTCCTAACCCTGATCATGG - Intronic
1081399611 11:42627443-42627465 TAGGTCCCCAAAGATGTTCATGG + Intergenic
1086817226 11:91387397-91387419 CTAGTTCACAAAACTGTTCATGG - Intergenic
1086950652 11:92887202-92887224 TTTGTTTCTCAACCTGTTCATGG + Intronic
1087247666 11:95858632-95858654 TTGGTTCCTAAATCTTTTCTAGG - Exonic
1088595908 11:111440016-111440038 GTAGTTCAGAAACCTGTTCAGGG + Intronic
1088861217 11:113801388-113801410 CTGGTTGCCAAACCTTTTTAAGG - Intronic
1092022963 12:5217274-5217296 CTGGTTCCCCAGCCTGTTCATGG + Intergenic
1098397194 12:70031894-70031916 ATGCTCCCCAAACCTTTTCAGGG + Intergenic
1100556578 12:95700493-95700515 TTGGTTCCCAAACCTGGCTGTGG - Intronic
1101212466 12:102548359-102548381 TTGAATCCCAAAGCTGTTAAAGG + Intergenic
1106624757 13:31409244-31409266 TTTGTTCCCAAAGATCTTCATGG + Intergenic
1108716523 13:53084236-53084258 TTGGGCCCTAAACCTGTGCAAGG - Intergenic
1109114796 13:58367984-58368006 TTTGTTCCCCAAGCTGTTCATGG + Intergenic
1110438996 13:75507208-75507230 TTGGATCCCACACCTGCCCAGGG + Intergenic
1111770419 13:92589113-92589135 TTGGTTACCAAATGCGTTCATGG + Intronic
1112914076 13:104524050-104524072 TTGGTCCCCAAACTTGTGAAAGG - Intergenic
1115212463 14:30981352-30981374 TTGGCACCCACACCTGTTAATGG + Intronic
1115277787 14:31626916-31626938 TTGGTTCCCAAACATCATGAAGG + Intronic
1115581760 14:34766658-34766680 TTGGGTTTTAAACCTGTTCAAGG - Intronic
1117314104 14:54557225-54557247 CTGGGTCTCAAAACTGTTCAAGG + Intergenic
1121230236 14:92352192-92352214 TTGCCTCCCACACCTGTTCACGG - Intronic
1121889771 14:97578642-97578664 ATGGCTCCCCAACCTGTTCAAGG - Intergenic
1122283762 14:100639042-100639064 CTGGCTCCCCCACCTGTTCAGGG + Intergenic
1122817206 14:104319648-104319670 TTGGTGCCCCAGCCTGTACATGG + Intergenic
1125343062 15:38693733-38693755 TTGGTTCCCAGAGGTTTTCATGG + Intergenic
1127295072 15:57601977-57601999 TGGGCTCCCTAACCTGTTCATGG + Intronic
1128642653 15:69351104-69351126 TTGCTTCCCTAACCTGTGAAGGG + Intronic
1133470804 16:6073613-6073635 TTGGTGCACAAACATGTTAAAGG + Intronic
1134611216 16:15609890-15609912 GTGGTTCTCAAACATGTTCCAGG + Intronic
1137521803 16:49201323-49201345 TTGCTTCTCAATTCTGTTCAGGG - Intergenic
1138403992 16:56773522-56773544 CTGGTTGCCAAAGGTGTTCAGGG - Intronic
1141528908 16:84632366-84632388 TTTGCTCCCAAAACTGTTCGTGG - Intergenic
1142600488 17:1051334-1051356 TGGGTTCCCAGCCCTGTTCTTGG - Intronic
1142692384 17:1614568-1614590 CTGGTCCCCAACCCTGTTCAAGG - Intronic
1146047745 17:29524262-29524284 TTGGTTTAAAAATCTGTTCATGG - Intronic
1147134387 17:38426862-38426884 TGAGTTCCCAACCCTGATCAAGG + Intergenic
1149137785 17:53390609-53390631 TACTTTCCCAAACCTGTTCGTGG - Intergenic
1151459766 17:74247595-74247617 TTGGTTCCCAAACTTCTTGGGGG + Intronic
1151685718 17:75645528-75645550 TTGGTTCCCAAACCTGTTCATGG - Intronic
1152019905 17:77775575-77775597 TGGGTTTCCAACACTGTTCATGG + Intergenic
1155003782 18:21709967-21709989 GTGGTTCCAAAACCTGTTTTGGG + Intronic
1158814742 18:61081622-61081644 TTGTTGCCCACATCTGTTCAAGG - Intergenic
1158974844 18:62702397-62702419 TCGGTCCCCAAAGCAGTTCAGGG - Intergenic
1165242003 19:34476484-34476506 TTGGTTCCCCAATCTATCCATGG + Intergenic
1166780509 19:45340310-45340332 TTTGTTCACAAAACTTTTCAGGG - Intronic
925909423 2:8563943-8563965 TTGCCTCCCAAACCTGTTGGAGG + Intergenic
926956030 2:18301392-18301414 TTGATTCCCAGACCTCGTCATGG + Intronic
929515176 2:42600426-42600448 TTGGTTTCCAAACTGGTTAAAGG + Intronic
929550062 2:42884536-42884558 TGGGTTCCCAAACCCACTCAGGG + Intergenic
933244262 2:79957547-79957569 TTCTTTCCCATACCTCTTCAGGG + Intronic
933977757 2:87525552-87525574 TTGGGTCCCCAACCTTCTCATGG + Intergenic
936316074 2:111425255-111425277 TTGGGTCCCCAACCTTCTCATGG - Intergenic
936654195 2:114465531-114465553 GTGCTACCCTAACCTGTTCAGGG - Intronic
937532795 2:122850478-122850500 TTTCTTTCCAAACCTGTTCTTGG - Intergenic
938317615 2:130340951-130340973 TAGGATTCCAAACCAGTTCAGGG + Exonic
940242670 2:151579559-151579581 TTGCTGCCCAAACCAGTTTAGGG + Exonic
940243628 2:151590110-151590132 TTGCTGCCCAAACCAGTTTAGGG + Exonic
940244584 2:151600663-151600685 TTGCTGCCCAAACCAGTTTAGGG + Exonic
940897758 2:159096994-159097016 TTTGTTCCCAAGCTTGTTTAGGG + Intronic
941033131 2:160535978-160536000 TTGATTCCCACAACTGTTAAAGG + Intergenic
941625244 2:167824223-167824245 TTGGTTCCCAAGGCTCTACATGG - Intergenic
942680192 2:178470407-178470429 TTGGTTCCAAGACCTTCTCATGG - Intronic
945215689 2:207431488-207431510 ATGGTTCCCAAAATTGTTTAGGG + Intergenic
946621503 2:221568755-221568777 TTGGATTCCAGATCTGTTCAGGG - Exonic
1170725912 20:18926533-18926555 TCTGTTCCCAAAACAGTTCAAGG - Intergenic
1172601362 20:36185783-36185805 TTGGTTTCCTCATCTGTTCAAGG + Intronic
1172637061 20:36417087-36417109 TTGTTTTCCAAACCTGACCAGGG - Intronic
1176231379 20:64034780-64034802 TCGGTTTCCACACCTGTACAGGG - Intronic
1176372222 21:6068969-6068991 GTGGTCCCCAAACCTGGCCAAGG - Intergenic
1178749975 21:35293037-35293059 TTGTTTCCTCCACCTGTTCAGGG + Intronic
1179751297 21:43469570-43469592 GTGGTCCCCAAACCTGGCCAAGG + Intergenic
1182622258 22:31624574-31624596 TTTGTTCACAAACCTGTGGATGG - Intronic
1183191522 22:36324626-36324648 CTGGCTCCCAAACCAATTCAAGG + Intronic
1184123082 22:42466454-42466476 TTGATTCCCAAATTTGTTCTTGG + Intergenic
949461338 3:4298125-4298147 TCAGTTCCAAAACCTGTTTATGG + Intronic
950734420 3:14993861-14993883 TTGGCTTCCTCACCTGTTCAGGG - Intronic
951787130 3:26434458-26434480 TTGCTCTCCAAGCCTGTTCATGG - Intergenic
952096073 3:29955961-29955983 TTGCTTCCCAAAACTATTTAAGG - Intronic
956126870 3:66018895-66018917 TTGTTCCCCAGAACTGTTCAAGG + Intronic
956744288 3:72299339-72299361 TTGTTTCCCAAAGATGTCCAAGG - Intergenic
962358345 3:134714152-134714174 GTGGTTCTCAAACTTGTGCATGG + Intronic
967817419 3:193811278-193811300 TGTGTTCTCAAACCTGTTCTTGG + Intergenic
970229342 4:13892713-13892735 TTGGTTCCAAAATTTGTACAAGG + Intergenic
971978519 4:33722589-33722611 TTGGATTCCAAAGCTGTTAATGG + Intergenic
973334851 4:48945490-48945512 ATGCTTCCCAAACTTTTTCAAGG - Intergenic
976206617 4:82628500-82628522 TTATTTCCCAAACCTATCCAAGG - Intergenic
977350649 4:95881246-95881268 TTGATTCCAAAACCTATACAAGG - Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982787854 4:159557404-159557426 TTGGTGCCCACACATGTTGAGGG + Intergenic
983145003 4:164202594-164202616 CTGTTTCAGAAACCTGTTCAAGG + Intronic
983374180 4:166901910-166901932 TTGGTTCAAACACCTGTTGATGG + Intronic
984117864 4:175704778-175704800 ATGTTTCACAAAACTGTTCAAGG + Intronic
985160953 4:187044031-187044053 CTGGTTCCCACACTGGTTCATGG - Intergenic
993726898 5:91379950-91379972 TTGGTTCTGAAATCCGTTCAGGG - Intronic
996619031 5:125477936-125477958 TTGACTCTCAAACTTGTTCAAGG + Intergenic
996770419 5:127079946-127079968 TTTGTTCCCAAACCTGTTTATGG - Intergenic
997508409 5:134436496-134436518 TTGGTTTCCAGAGCTGTTTAGGG - Intergenic
998327839 5:141297813-141297835 CTGTTTCCCCAACCTCTTCAAGG - Intergenic
998471417 5:142386749-142386771 TTGGTTCCCGAATCTGTCCCAGG + Intergenic
1000445571 5:161314632-161314654 TTGATTCCCAAAGCTGTTCATGG + Intronic
1001110798 5:168894560-168894582 TTAGTTCACAAGCCTGTTCTAGG - Intronic
1001850927 5:174964449-174964471 TTGGCTCCCTAACCTTTTAAGGG + Intergenic
1002905456 6:1445354-1445376 GGGGTTCCCTATCCTGTTCATGG - Intergenic
1003447819 6:6200767-6200789 TTGCTTCCCACATCTGTCCAGGG - Intronic
1003727731 6:8784597-8784619 TTGGTATACAAACCTGTTCTCGG - Intergenic
1005496525 6:26392651-26392673 TTGGTTTCCAAACATCTCCAGGG - Exonic
1008580572 6:52903182-52903204 ATAGTTGCCAGACCTGTTCAGGG + Intronic
1012390424 6:98731742-98731764 CTGGTTCCCAAAACCATTCATGG + Intergenic
1016926826 6:149359378-149359400 TTGGATTCCACACCTGTGCATGG + Intronic
1018123930 6:160663724-160663746 TTGGTTCCTTGACCTGTTCATGG - Intronic
1018766780 6:166939932-166939954 TTGGTTCTCAAAACTCTGCAAGG + Intronic
1020514534 7:9100343-9100365 TTTGTTCACTAACTTGTTCATGG + Intergenic
1021556343 7:21922527-21922549 CTGGATCTCAAACTTGTTCAGGG + Intronic
1032529244 7:132606401-132606423 TTGTTACCCTAACCTGCTCAAGG - Intronic
1035586725 8:781351-781373 TTGATTCCTAAAGCTATTCATGG + Intergenic
1038018407 8:23533434-23533456 GTGCTTCCCAAACCTTTTCCTGG + Intronic
1040704288 8:50106916-50106938 TTTGTCTCCAAACCTGTTTATGG - Intronic
1041778604 8:61553034-61553056 TTTGTTCCCAACCCTCTGCATGG + Exonic
1043163259 8:76872167-76872189 TTCCTTCCAAATCCTGTTCACGG - Intergenic
1044870876 8:96618733-96618755 TTGGTTCTCAAACCTCAGCAGGG + Intergenic
1044898096 8:96914482-96914504 ATATTTCCTAAACCTGTTCAAGG - Intronic
1045966950 8:108035883-108035905 GTGGTTCCCAAACCTGAAAATGG - Intronic
1047451571 8:124969755-124969777 TTGGTATCCAAACCTGTGGAAGG + Intergenic
1048372865 8:133794918-133794940 TTGGTTCCCAAATCCTTGCAGGG - Intergenic
1049992705 9:1005107-1005129 TTGGGTCACAGACCTGTTCAAGG - Intergenic
1051532990 9:18126249-18126271 TGGGTACACAAACATGTTCACGG - Intergenic
1052374206 9:27699394-27699416 TTGGTTGCCAACCCTGTACCAGG + Intergenic
1055002733 9:71471268-71471290 TTGGTTTCTAATGCTGTTCAAGG + Intergenic
1055246533 9:74251531-74251553 TGGGTTGCCAAAACTGTCCAGGG + Intergenic
1058473306 9:105303554-105303576 TTAATTCCCACACCTGCTCAAGG + Intronic
1058844686 9:108945201-108945223 TTGGTTCCCAGACCTCCCCAAGG + Intronic
1059734072 9:117084449-117084471 TTGGCTCCAAAGACTGTTCATGG - Intronic
1060053771 9:120395669-120395691 TTTGTTCCCAAACTTGTTTATGG + Intronic
1188797806 X:34486764-34486786 TTGTTTCCCAAAGAAGTTCATGG - Intergenic
1192924174 X:75738106-75738128 CTGGTTTGCACACCTGTTCATGG + Intergenic
1194240690 X:91443683-91443705 TTGGTTCCCAAACAAGTCTATGG + Intergenic
1196241834 X:113351560-113351582 TGGGCTGCCATACCTGTTCATGG + Intergenic
1197835646 X:130690912-130690934 TTTCTTCCCAAACATTTTCAGGG - Intronic
1198359622 X:135883537-135883559 TTGGTTTCCATATCTATTCAAGG - Intronic
1198805309 X:140488378-140488400 TGGGTTCCCACACATGGTCAGGG - Intergenic