ID: 1151687953

View in Genome Browser
Species Human (GRCh38)
Location 17:75660672-75660694
Sequence CTGTTCACTCACATCTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151687953_1151687959 28 Left 1151687953 17:75660672-75660694 CCTACTGAGATGTGAGTGAACAG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1151687959 17:75660723-75660745 CTGCATGCTGCCCCATCCTGGGG 0: 1
1: 0
2: 5
3: 24
4: 296
1151687953_1151687957 26 Left 1151687953 17:75660672-75660694 CCTACTGAGATGTGAGTGAACAG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1151687957 17:75660721-75660743 GACTGCATGCTGCCCCATCCTGG 0: 1
1: 0
2: 2
3: 17
4: 198
1151687953_1151687955 -9 Left 1151687953 17:75660672-75660694 CCTACTGAGATGTGAGTGAACAG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1151687955 17:75660686-75660708 AGTGAACAGGACTATGTTAAAGG 0: 1
1: 0
2: 0
3: 6
4: 135
1151687953_1151687958 27 Left 1151687953 17:75660672-75660694 CCTACTGAGATGTGAGTGAACAG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1151687958 17:75660722-75660744 ACTGCATGCTGCCCCATCCTGGG 0: 1
1: 1
2: 0
3: 27
4: 204
1151687953_1151687961 30 Left 1151687953 17:75660672-75660694 CCTACTGAGATGTGAGTGAACAG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1151687961 17:75660725-75660747 GCATGCTGCCCCATCCTGGGGGG 0: 1
1: 0
2: 0
3: 11
4: 246
1151687953_1151687960 29 Left 1151687953 17:75660672-75660694 CCTACTGAGATGTGAGTGAACAG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1151687960 17:75660724-75660746 TGCATGCTGCCCCATCCTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151687953 Original CRISPR CTGTTCACTCACATCTCAGT AGG (reversed) Intronic