ID: 1151687953

View in Genome Browser
Species Human (GRCh38)
Location 17:75660672-75660694
Sequence CTGTTCACTCACATCTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151687953_1151687960 29 Left 1151687953 17:75660672-75660694 CCTACTGAGATGTGAGTGAACAG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1151687960 17:75660724-75660746 TGCATGCTGCCCCATCCTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 305
1151687953_1151687958 27 Left 1151687953 17:75660672-75660694 CCTACTGAGATGTGAGTGAACAG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1151687958 17:75660722-75660744 ACTGCATGCTGCCCCATCCTGGG 0: 1
1: 1
2: 0
3: 27
4: 204
1151687953_1151687959 28 Left 1151687953 17:75660672-75660694 CCTACTGAGATGTGAGTGAACAG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1151687959 17:75660723-75660745 CTGCATGCTGCCCCATCCTGGGG 0: 1
1: 0
2: 5
3: 24
4: 296
1151687953_1151687957 26 Left 1151687953 17:75660672-75660694 CCTACTGAGATGTGAGTGAACAG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1151687957 17:75660721-75660743 GACTGCATGCTGCCCCATCCTGG 0: 1
1: 0
2: 2
3: 17
4: 198
1151687953_1151687961 30 Left 1151687953 17:75660672-75660694 CCTACTGAGATGTGAGTGAACAG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1151687961 17:75660725-75660747 GCATGCTGCCCCATCCTGGGGGG 0: 1
1: 0
2: 0
3: 11
4: 246
1151687953_1151687955 -9 Left 1151687953 17:75660672-75660694 CCTACTGAGATGTGAGTGAACAG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1151687955 17:75660686-75660708 AGTGAACAGGACTATGTTAAAGG 0: 1
1: 0
2: 0
3: 6
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151687953 Original CRISPR CTGTTCACTCACATCTCAGT AGG (reversed) Intronic
901693827 1:10991736-10991758 GTGTTCACTGACATGACAGTGGG - Intergenic
903601812 1:24547404-24547426 CTGCTCACTCACATGGCTGTTGG + Intergenic
905222707 1:36459892-36459914 CTTTTCACTCACATCTAATGAGG + Intronic
905373324 1:37499417-37499439 CTGCTGACTGATATCTCAGTAGG - Intronic
906349583 1:45046541-45046563 CTGTTAACAGGCATCTCAGTAGG - Intronic
906551721 1:46671213-46671235 CTGCTCATTCACATCTCTGGAGG - Intronic
909135611 1:71796213-71796235 CTTTCCACTCCCATCTCAGGAGG + Intronic
914412909 1:147448771-147448793 CTGTTCACGAACAACTCAGGTGG - Intergenic
915508059 1:156369772-156369794 CTCTTGTCCCACATCTCAGTTGG + Intronic
915949273 1:160177340-160177362 CTGTTATCTCTCATCTCTGTGGG - Intronic
923047598 1:230367049-230367071 GTGGTCCCTCCCATCTCAGTGGG - Intronic
924074909 1:240323727-240323749 CTCTTCTCTCACATCTCTGCTGG + Intronic
1064089150 10:12368550-12368572 CTCTTCTCTCACATTTAAGTGGG + Intronic
1066511662 10:36105530-36105552 CTGTTCACTTTCCTCTCTGTAGG - Intergenic
1067429439 10:46233378-46233400 CTGTTGACACTCATCTCTGTTGG + Intergenic
1067444300 10:46331018-46331040 CTGTTGACACTCATCTCTGTTGG - Intergenic
1068681908 10:59829133-59829155 CAGTTAACTCACATGTCAGCAGG - Intronic
1069120133 10:64559487-64559509 ACGAGCACTCACATCTCAGTAGG - Intergenic
1069215849 10:65819130-65819152 CTGTTGACTGAAAACTCAGTTGG - Intergenic
1071747413 10:88437769-88437791 ATTTTCCCTCACATCTCATTGGG - Intronic
1071924947 10:90395443-90395465 CTGTTTCCTCACATGGCAGTGGG + Intergenic
1075008268 10:118846047-118846069 CTGTCCTCACAGATCTCAGTGGG - Intergenic
1076000480 10:126908797-126908819 CTTTTCTCTCACAGCCCAGTAGG + Intronic
1078414463 11:11154116-11154138 AAGTTCACTCACATCGCTGTTGG + Intergenic
1081360417 11:42170661-42170683 CTTTTCACACAGAGCTCAGTGGG - Intergenic
1084841650 11:71856244-71856266 CTGATCACTCACCTCTCTATTGG + Intergenic
1091126503 11:133104075-133104097 CTGCTCAGTCACAGCCCAGTGGG + Intronic
1091203703 11:133802479-133802501 CTATTCTCTCACATCTCTGGAGG + Intergenic
1092462002 12:8695326-8695348 CTGTGGACTCACATCTCCTTTGG - Intronic
1094354120 12:29559374-29559396 CTGTTCATTTACATGGCAGTGGG - Intronic
1097423519 12:59412646-59412668 CTAGACACTCACCTCTCAGTTGG + Intergenic
1100047412 12:90399418-90399440 CAGCTCACTCACATCTCTGGGGG + Intergenic
1103225484 12:119283841-119283863 ATTTTCACTCACAAGTCAGTGGG + Intergenic
1103981534 12:124739884-124739906 GTGTTAACTCACATCTCCCTTGG - Intergenic
1110056101 13:70974232-70974254 CTTTTGACTCACAGCTCAGGTGG - Intergenic
1114863210 14:26553470-26553492 CTGGTATCTCACCTCTCAGTTGG + Intronic
1118476232 14:66120039-66120061 CTGTTCTCACACAACTCAGGAGG + Intergenic
1122705004 14:103615366-103615388 ATGTTCACTCACAGCTCAGCCGG + Intronic
1125455666 15:39856542-39856564 CTGTTCACCCACATGGCTGTTGG + Intronic
1125737328 15:41935908-41935930 CCCTTTACTCACATCTCAGCTGG + Intronic
1128100293 15:64993049-64993071 CTCTTGACTCAGATCTCTGTGGG + Intergenic
1128137211 15:65272742-65272764 CTGTGGAATCAGATCTCAGTTGG + Intronic
1128538921 15:68511448-68511470 CTGTTCACCCACATCCCATTTGG - Intergenic
1128543277 15:68551417-68551439 CTCTTCACCCACAGCCCAGTGGG - Intergenic
1131580554 15:93638776-93638798 AGGTTCATTCACATGTCAGTGGG + Intergenic
1131771722 15:95745205-95745227 CTGCTCCCTCTCATCTCAATGGG + Intergenic
1132680785 16:1140889-1140911 CTGGTTACTGACATCTCACTGGG + Intergenic
1133912297 16:10077211-10077233 CTGGTCACCCACATCTCACTGGG - Intronic
1136734937 16:32458188-32458210 CTCTTTCCTCACATGTCAGTGGG - Intergenic
1138790680 16:59900287-59900309 CAGTTCACTGACATCTTAGTTGG + Intergenic
1203018140 16_KI270728v1_random:371404-371426 CTCTTTCCTCACATGTCAGTGGG + Intergenic
1203036475 16_KI270728v1_random:644562-644584 CTCTTTCCTCACATGTCAGTGGG + Intergenic
1149052257 17:52319962-52319984 CAGTACTCTCAAATCTCAGTGGG - Intergenic
1150996296 17:70321850-70321872 TTTTCCACTCACATTTCAGTAGG + Intergenic
1151687953 17:75660672-75660694 CTGTTCACTCACATCTCAGTAGG - Intronic
1153960322 18:10134681-10134703 CTGATCTCTGGCATCTCAGTAGG + Intergenic
1153961620 18:10144992-10145014 CTGATCTCTGGCATCTCAGTAGG + Intergenic
1160322235 18:77906466-77906488 CTGTTAACGCCCATCCCAGTGGG + Intergenic
1161353633 19:3807047-3807069 CTGTTCCTGTACATCTCAGTGGG + Intronic
1166347360 19:42175088-42175110 CTGTCCACACCCTTCTCAGTGGG + Intronic
1167651089 19:50729387-50729409 CTGATCGCTCTCATTTCAGTGGG - Intergenic
927242401 2:20930436-20930458 CTGTTCACACCCATGTCAGCTGG + Intergenic
930708361 2:54526290-54526312 CTGCTCACTCTTATCCCAGTTGG + Intronic
933837136 2:86255209-86255231 CTCTTCACTCACATCCAAGAAGG + Intronic
933941655 2:87250101-87250123 CTGATCACTAACATCCTAGTGGG + Intergenic
935205731 2:100895357-100895379 CTGTTCTCTCACTTTGCAGTTGG + Intronic
935388255 2:102523807-102523829 CTGTTCTCTCACCTCTAAGGTGG + Intronic
936013974 2:108943944-108943966 CTGCTCACTCATTTCTCAGAGGG + Intronic
936338570 2:111611468-111611490 CTGATCACTAACATCCTAGTGGG - Intergenic
936650523 2:114421319-114421341 CTGTTTTCTCACATCTCAACTGG - Intergenic
936957045 2:118032929-118032951 TTTTTCACTCAAATATCAGTAGG + Intergenic
941358917 2:164527940-164527962 TTGTTCATTCTCATGTCAGTGGG - Intronic
942364793 2:175213980-175214002 CTTTTCATACACTTCTCAGTTGG + Intergenic
943625691 2:190197038-190197060 CTGTGGCCTCACATGTCAGTAGG + Intronic
943723979 2:191233750-191233772 CCTTTCACTCCCATCTGAGTGGG + Intergenic
947173801 2:227339470-227339492 TTGCTCACTCACATGTCACTTGG + Intronic
1171247682 20:23625841-23625863 CTGTGGGCTCACTTCTCAGTGGG - Intergenic
1175549394 20:59807026-59807048 CCGTTCACTCACTGCTCACTCGG - Intronic
1176074351 20:63241715-63241737 CTGTTTGCTGACATCTCAGTGGG + Intronic
1177885517 21:26741495-26741517 CTGTTTACTCAGATCACAGCTGG + Intergenic
1178335126 21:31735636-31735658 TTGTGCATTCAAATCTCAGTAGG - Intergenic
1179558830 21:42199543-42199565 CTGTTCCCTCACAAGTCACTGGG - Intergenic
1179991538 21:44950733-44950755 CTGTTTCCTCCCATCTTAGTGGG + Intronic
1180097777 21:45567705-45567727 CTGTTAATTCACACCTCACTGGG - Intergenic
1183420955 22:37710885-37710907 CTGTACACTCACCTTGCAGTGGG + Intronic
952522899 3:34179848-34179870 CTATTCTCTCACATTTCAGAAGG - Intergenic
952622885 3:35367566-35367588 CTGTGAACTCAAATCTCAATGGG - Intergenic
955480472 3:59384779-59384801 CTCATCACTCACCTCTCAATGGG - Intergenic
956776071 3:72566616-72566638 CTGCTCACTCACATGGCTGTGGG + Intergenic
960084676 3:113577918-113577940 CTGTTCAGTGACATCACAATGGG - Intronic
960883784 3:122373613-122373635 CTGTTCAAGCACAACTCATTTGG + Intronic
964696691 3:159516120-159516142 CTGTTCCCTGAACTCTCAGTGGG + Intronic
965673664 3:171173020-171173042 CTGTTCACTCACTTTTCTGTGGG + Intronic
968503970 4:963555-963577 CTGTTCACACGCAGCTCAGTGGG - Intronic
968882327 4:3307727-3307749 CTGTCCACACACTTCACAGTGGG - Intronic
969090583 4:4691205-4691227 CTGTATACTCACCTCTGAGTGGG - Intergenic
969782748 4:9422277-9422299 CTGATCACTCACCTCTCTATTGG + Intergenic
974295226 4:59989363-59989385 CTTTTGGCTGACATCTCAGTGGG - Intergenic
980191237 4:129527889-129527911 CTATTCACTCACATCTCAACTGG + Intergenic
980376134 4:131951338-131951360 CTGTTTACTCTCATCTCCTTAGG + Intergenic
982999086 4:162388945-162388967 CTGTGCACTCACATGGCAGGAGG + Intergenic
983013865 4:162584313-162584335 TTGTCCACTCACATCTCATGTGG - Intergenic
983107581 4:163708269-163708291 CTGTTCACTCAGACCTCGGGAGG + Intronic
984196243 4:176660992-176661014 CTGTCCACTCAAATCTGTGTGGG - Intergenic
986299862 5:6469929-6469951 GTGTTCACTCTCATCACAGAGGG - Intronic
986596310 5:9425949-9425971 CTGTTCACTCACCTTTAAATGGG + Intronic
989400631 5:41004298-41004320 CTGTTCACTCACTTCTGGGGAGG + Intronic
994117898 5:96081487-96081509 CTGTTCTCTCACACCACACTGGG - Intergenic
995550645 5:113277821-113277843 CTGTTCACTCACAATGCAGATGG - Intronic
997298805 5:132787226-132787248 CTGGTCACTGAGATCTCAGGGGG - Intronic
998541345 5:142984535-142984557 CTGTGCATTCATCTCTCAGTGGG + Intronic
999531404 5:152467067-152467089 ATTTTCACTCAAATCTCTGTTGG - Intergenic
999544386 5:152610931-152610953 TTGTTCACTCACATGTCTGGTGG + Intergenic
1000158214 5:158573074-158573096 GTCTTGACTCACATCTCATTCGG + Intergenic
1001710923 5:173777415-173777437 CTGTACTCTCTCATCTCAGGAGG - Intergenic
1006335379 6:33417857-33417879 CATTTCACTCACACCTCAGGGGG + Intronic
1007253993 6:40515957-40515979 CTGCTCACTCACTCCTCAGGTGG + Intronic
1010230370 6:73529357-73529379 ATTTTCACTCATATCTCTGTTGG + Intergenic
1012852821 6:104467310-104467332 CTCTTGACTGACATCTCAGAGGG + Intergenic
1014144353 6:117980214-117980236 CTGATCACCCAAACCTCAGTGGG - Intronic
1014492465 6:122079570-122079592 CTGTTCACTGACCTCCCAGGAGG - Intergenic
1014584202 6:123179058-123179080 CTGATCACACACATCTAATTTGG + Intergenic
1016920488 6:149288462-149288484 CTTATCATTCACATCTCAGGGGG - Intronic
1017533295 6:155319300-155319322 CTGTTCACTGACAACTCACCTGG - Intergenic
1017804474 6:157931931-157931953 CATTTCACTTACATCTCATTTGG + Intronic
1020285704 7:6678573-6678595 CTGTTCACTCCTATCTCCATAGG - Intergenic
1023922882 7:44643303-44643325 CTGTGCAGTCACATCTCTGGTGG + Intronic
1029344352 7:99967534-99967556 ATGTTTTCCCACATCTCAGTGGG + Intronic
1031319627 7:120307938-120307960 TTCTTCTGTCACATCTCAGTGGG - Intronic
1031797932 7:126200894-126200916 TTGTTCACACATATATCAGTTGG - Intergenic
1035644769 8:1210551-1210573 CTGTACACTCCCCACTCAGTGGG - Intergenic
1036836319 8:12071758-12071780 CTGATCACTCACCTCTCTATTGG - Intergenic
1036858161 8:12318327-12318349 CTGATCACTCACCTCTCTATTGG - Intergenic
1037106615 8:15116436-15116458 CTTTTCACTCACTTCTCATTGGG - Intronic
1037468195 8:19181728-19181750 CTGTACAATCACATCACTGTAGG + Intergenic
1040054337 8:43044382-43044404 AAGTTCACTCACATCACTGTTGG + Intronic
1041391809 8:57353612-57353634 GTGTTCTCTCACATCTCTGCAGG + Intergenic
1041766422 8:61422963-61422985 CTGGTCACTCAGCTCTCTGTAGG - Intronic
1044186004 8:89253235-89253257 GTGTTGATTCTCATCTCAGTAGG + Intergenic
1047118662 8:121874849-121874871 CTTTTCTCTCACATCTCCTTTGG + Intergenic
1047596451 8:126382441-126382463 CAGTTCCCTCACATCGCAGATGG - Intergenic
1051377870 9:16422636-16422658 CTGTTCACTCTCATGATAGTGGG + Intronic
1051432978 9:16999290-16999312 CTTTTAACTCACATTTCTGTAGG - Intergenic
1051791035 9:20802874-20802896 CTGTTCATTAACATATCAGCAGG + Intronic
1053207954 9:36203804-36203826 CAGTCCACTGACATCTTAGTGGG - Intronic
1053641184 9:40082022-40082044 CTGTTTACTCTCATCTCCTTAGG + Intergenic
1053764955 9:41383441-41383463 CTGTTTACTCTCATCTCCTTAGG - Intergenic
1054321925 9:63678314-63678336 CTGTTTACTCTCATCTCCTTAGG + Intergenic
1054543568 9:66294598-66294620 CTGTTTACTCTCATCTCCTTAGG - Intergenic
1055575728 9:77658838-77658860 CTCTGAACTCACATCTCAGGTGG + Intergenic
1059462022 9:114437743-114437765 CTGTTTTCTCACATTTCTGTAGG - Intronic
1059961962 9:119574345-119574367 CTGTTCTCATCCATCTCAGTGGG - Intergenic
1061039788 9:128133570-128133592 CTGTTCATTCATTTATCAGTGGG + Intergenic
1062610823 9:137372684-137372706 CTGTGCCCTGACATCTCTGTTGG + Intronic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1189850137 X:45169553-45169575 CTGTTCCCTCATCTCTCAGGTGG + Intronic
1199544787 X:148996413-148996435 GTGTTCAGTGACATCACAGTTGG - Exonic
1202042533 Y:20700002-20700024 CTGTACACTCAAATTGCAGTTGG + Intergenic