ID: 1151688200

View in Genome Browser
Species Human (GRCh38)
Location 17:75662277-75662299
Sequence CTTGTTCTGGATCCTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 8, 3: 18, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151688200_1151688209 6 Left 1151688200 17:75662277-75662299 CCTTCCACAGGATCCAGAACAAG 0: 1
1: 0
2: 8
3: 18
4: 194
Right 1151688209 17:75662306-75662328 CTGGTAAGGAGGACAATGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 232
1151688200_1151688206 -5 Left 1151688200 17:75662277-75662299 CCTTCCACAGGATCCAGAACAAG 0: 1
1: 0
2: 8
3: 18
4: 194
Right 1151688206 17:75662295-75662317 ACAAGGAAACCCTGGTAAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 184
1151688200_1151688205 -8 Left 1151688200 17:75662277-75662299 CCTTCCACAGGATCCAGAACAAG 0: 1
1: 0
2: 8
3: 18
4: 194
Right 1151688205 17:75662292-75662314 AGAACAAGGAAACCCTGGTAAGG 0: 1
1: 0
2: 1
3: 12
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151688200 Original CRISPR CTTGTTCTGGATCCTGTGGA AGG (reversed) Intronic
900001667 1:17945-17967 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
900021388 1:188469-188491 CTTGCTCTGGATCCTGTGCGGGG + Intergenic
900464344 1:2817678-2817700 CTTGTCATGGCTCCTGTGGATGG + Intergenic
901422338 1:9159480-9159502 CTTTTTCTGGTTCTTATGGATGG + Intergenic
903688169 1:25147963-25147985 ATTGCTCTGGATGCTGTGGGGGG + Intergenic
904070039 1:27788285-27788307 CTTTTTCTGGTTACTGGGGAGGG - Intronic
904976893 1:34463503-34463525 CATGTGCTGGATTCTGTGGTGGG - Intergenic
905492379 1:38354695-38354717 GTTGTGCTGGGTCGTGTGGAAGG - Intergenic
905669519 1:39782268-39782290 CTTGTAGTGGATGCTGTGGGGGG - Intronic
907509219 1:54945910-54945932 CTTGGCCTGTTTCCTGTGGAGGG + Intergenic
907649985 1:56285923-56285945 CTTTCTCTGGATTCAGTGGAAGG - Intergenic
910098469 1:83551186-83551208 CTTCTTTTGGTTCCTGTTGATGG - Intergenic
910162058 1:84283743-84283765 CTTGTGCTGCATTCTGTGTAAGG + Intergenic
911941165 1:104049411-104049433 TTTCTTTTGGATCGTGTGGAAGG - Intergenic
916458778 1:164999068-164999090 CATGCCCTGGATACTGTGGATGG - Intergenic
916693780 1:167216972-167216994 GTTGTTCTGTATCCTGAGTATGG - Intergenic
917522450 1:175759503-175759525 CTTCCTCTGCAACCTGTGGAGGG + Intergenic
918658174 1:187054730-187054752 CTTGTTCTTAACCCTTTGGAAGG - Intergenic
919589408 1:199481764-199481786 CTTGTGATGCATTCTGTGGATGG - Intergenic
920346593 1:205309789-205309811 CCTGCCCTGGATCCTCTGGATGG - Intronic
921036949 1:211388903-211388925 ATTGTTCTGTATCCTGTTAATGG + Intergenic
923557643 1:235013298-235013320 CTGGTTCTGGGTCCTTTGGAAGG + Intergenic
924936971 1:248780125-248780147 ATTATTCTGGATCATGTTGATGG + Intergenic
1063076784 10:2724744-2724766 CTTTTTCTAGATCTTGTAGAAGG - Intergenic
1064116186 10:12579310-12579332 CTTCTTCTGAATCCTGTGTTGGG + Intronic
1066791302 10:39067025-39067047 CTTTTTCTAGAACCTGTGAAGGG - Intergenic
1071118261 10:82249006-82249028 TTTGTTCTGGGTCTTGTGAATGG - Intronic
1071374155 10:84985665-84985687 CTTATTCTGGATTCTATGGGTGG + Intergenic
1071458801 10:85872143-85872165 CTTATTCTGTATCCTGTGTTCGG - Intronic
1077401085 11:2357814-2357836 CTTCTGCTGGGCCCTGTGGACGG - Intergenic
1078636095 11:13051675-13051697 CTTAGGCTGGATCCTTTGGAAGG - Intergenic
1078909847 11:15720713-15720735 CGTGCTCTAGAGCCTGTGGAGGG - Intergenic
1079029910 11:16978979-16979001 CTTGTTCTGGTGGCTGGGGAGGG - Intronic
1080707384 11:34709689-34709711 CATGTCCTTGATCATGTGGAAGG - Intergenic
1081897811 11:46602219-46602241 CTTGTTCTGGATTATTTGGGTGG - Intergenic
1082582564 11:54890972-54890994 CTTGTTCTAGAATCTGTGAAAGG + Intergenic
1082845371 11:57720856-57720878 CTTGTTTTGGATCCCCTGAAGGG - Intronic
1084214991 11:67642315-67642337 ATTGCTCTGGATCCAGCGGAGGG - Intergenic
1084751080 11:71204849-71204871 CGTGGTCAGCATCCTGTGGATGG - Intronic
1085817642 11:79757278-79757300 AATGTGCTGGATCCTGTGTAAGG + Intergenic
1087212001 11:95454167-95454189 ATTGTTCTGGATCATCTGCATGG + Intergenic
1089703950 11:120263834-120263856 CGTGTTCAGGTTTCTGTGGATGG + Intronic
1090439028 11:126711169-126711191 CTTTTTATGGATCCAGTGGGTGG + Intronic
1091374753 12:18067-18089 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
1094696036 12:32819759-32819781 CCTGGTCTGGATTCTGTGGGAGG + Intronic
1095679807 12:44960771-44960793 CTTGTGCTCGGTCCTGTGAAGGG - Intergenic
1098337721 12:69420865-69420887 CCTGTTCTGGATGCTGTACATGG + Intergenic
1098529212 12:71521425-71521447 CTTGTTTTGCCTTCTGTGGAAGG + Intronic
1101311707 12:103586733-103586755 CATCTTCAGGGTCCTGTGGAGGG + Intergenic
1101334005 12:103780147-103780169 CTGATTCTGGATCCTGGGGGAGG + Intronic
1101852268 12:108413152-108413174 CTTTATTTGGATCCTGTGGTGGG + Intergenic
1102077018 12:110067700-110067722 CATGTGCTGGTTCCTGTGGCAGG - Intronic
1102629819 12:114268216-114268238 CCTGTTATGGAGCCTGTTGAGGG + Intergenic
1102858749 12:116317394-116317416 CTTCTTCTAGACCCTTTGGAGGG + Intergenic
1103981993 12:124742595-124742617 CCTGTTAGGGAACCTGTGGATGG + Intergenic
1105666594 13:22565228-22565250 TTTGTTCTGGATCTTGGGGGTGG + Intergenic
1108377941 13:49830509-49830531 CTTGCTGTGGTTCCTGTGAAAGG + Intergenic
1112191378 13:97181192-97181214 ATTGTTCTGGATTATGTGAATGG - Intergenic
1116537570 14:46053438-46053460 CTTTTTATGGATGCTGAGGAAGG + Intergenic
1117159211 14:52972304-52972326 TATTTTCTAGATCCTGTGGATGG + Intergenic
1117986362 14:61389785-61389807 CTGGTTCTGGACCCTGGGCAAGG - Intronic
1118846599 14:69552080-69552102 CTTGTTCTGGACCATTTAGAAGG + Intergenic
1125003150 15:34792545-34792567 ATTGTTCTGGACTCTGGGGATGG - Exonic
1127979772 15:64026054-64026076 CTGGTTCTAGACCCTGTGGACGG + Intronic
1130360165 15:83176727-83176749 CTTGCTGTGGTTCCTGCGGATGG + Intronic
1132108708 15:99086245-99086267 CTGTTTCTGGATCCTGGTGATGG + Intergenic
1132451842 15:101972995-101973017 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
1132455050 16:17634-17656 CTTGCTCTGGATCCTGTGGCGGG + Exonic
1133127897 16:3658000-3658022 TTTTTTCTGGGTCCTGTGGCAGG - Exonic
1136021835 16:27445415-27445437 CATGTGCTGGACACTGTGGAGGG + Intronic
1137270261 16:46898332-46898354 CTTCTCCTGGAGCCTGAGGAGGG - Intronic
1137366413 16:47863465-47863487 CTTGCCCTGAATCCTGAGGAAGG + Intergenic
1137394693 16:48108598-48108620 CGTGTTGTGGAGTCTGTGGAGGG - Intronic
1137953503 16:52806179-52806201 CTTCTTCTGTGTCCTGTGGATGG - Intergenic
1138823080 16:60285361-60285383 ATTATTCTGGATCATCTGGATGG + Intergenic
1139313030 16:66043053-66043075 CCTGCACTGGATCCTGTGGATGG - Intergenic
1140886696 16:79250567-79250589 CTTGTTCTGGTGCTTGGGGAAGG + Intergenic
1203012427 16_KI270728v1_random:309407-309429 CTTTTTGTAGAACCTGTGGAAGG + Intergenic
1203030762 16_KI270728v1_random:582566-582588 CTTTTTGTAGAACCTGTGGAAGG + Intergenic
1203040959 16_KI270728v1_random:751865-751887 CTTTTTGTAGAACCTGTGGAAGG - Intergenic
1142766470 17:2067271-2067293 CTTGTTCTTGATCCGGTGAAAGG - Intronic
1143297980 17:5885515-5885537 CTTGTCCTGTATCCTTTGGGTGG + Intronic
1143411058 17:6709189-6709211 CCTGTTCTGGATGCTGAGGACGG - Intronic
1144479693 17:15618587-15618609 CTTGGTCTGGTTTCTGTGCAGGG + Intronic
1144795153 17:17886358-17886380 CTCCTTCTGGATTCTGAGGAGGG + Intronic
1144918611 17:18745148-18745170 CTTGGTCTGGTTTCTGTGCAGGG - Intronic
1145010758 17:19366342-19366364 CTTGTCCTGGGTCCTGGGGCAGG + Intronic
1146899982 17:36577870-36577892 CTTATTTTGGATGCTGTAGATGG + Intronic
1147192587 17:38746745-38746767 CATGGTCTGGATCCTGGGGTTGG + Intronic
1147945328 17:44077409-44077431 TTTGTTTTGGATCCTGGGGATGG - Exonic
1148217949 17:45844149-45844171 CTTGTTCTGACTCCTGAGAAAGG + Intergenic
1148856238 17:50580626-50580648 CTTGCTCAGGCTCCTGAGGAAGG + Intronic
1151688200 17:75662277-75662299 CTTGTTCTGGATCCTGTGGAAGG - Intronic
1152072154 17:78139209-78139231 CTGCTTCCGGAGCCTGTGGATGG - Exonic
1152161993 17:78674688-78674710 CTGGTCCAGGGTCCTGTGGAGGG + Exonic
1152377983 17:79928487-79928509 CTTGTTCTTGTCCCTGTGGATGG - Intergenic
1155315682 18:24568136-24568158 CTTATTGTGGTTTCTGTGGAAGG + Intergenic
1155859945 18:30885000-30885022 TTTTTTCTGCATCATGTGGAAGG - Intergenic
1156045531 18:32873088-32873110 ATTGTTCTGGATCATCTCGAAGG + Intergenic
1156716739 18:40021454-40021476 CTGGTACTGGTTCCTGTGAAGGG - Intergenic
1157107518 18:44788450-44788472 CTTGATGGGGACCCTGTGGAAGG + Intronic
1162898441 19:13779385-13779407 CTTGACCTGGATCCAGTGAAGGG - Intergenic
1163181062 19:15602400-15602422 CATGTTCTTGATCCAGTTGATGG + Intergenic
1166782203 19:45348636-45348658 CTTGTTCTGGTCCCTGTGGGGGG - Exonic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
925075002 2:1009121-1009143 CTGGTCCTGGATCGTGTGTATGG + Intronic
930037092 2:47093090-47093112 CTTGCTTTAAATCCTGTGGAAGG - Intronic
931345207 2:61439865-61439887 CTGGGTGTGGATTCTGTGGATGG + Intronic
936568056 2:113595463-113595485 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
937088626 2:119189652-119189674 CCTGTGCTGTATCCTCTGGAGGG - Intergenic
939912941 2:148005567-148005589 CTTGTTCTGCCTCCTCTGCAAGG - Intronic
941483332 2:166045844-166045866 ATTCTTCTGGATATTGTGGATGG - Intronic
942677901 2:178448156-178448178 CTTGTTATGTATCTTCTGGACGG + Intronic
942687261 2:178546412-178546434 CTTGTTCTGGATGCTGCAGTTGG - Exonic
946142098 2:217700188-217700210 CTTGTTCTGTATCTTGTGCCAGG - Intronic
948499378 2:238380561-238380583 CTTCTTCTCGAGCATGTGGATGG + Intronic
948811810 2:240482227-240482249 CTTCTTCTTCATCCTGTGGCTGG + Exonic
1170225868 20:13991660-13991682 ATTGTTCTGGATCATGTTGGTGG - Intronic
1173421390 20:42904543-42904565 CTTGTTTTCAATTCTGTGGAAGG - Intronic
1173914415 20:46696290-46696312 CTGGTTCTGGCTTCTGTGGCAGG + Intergenic
1175340085 20:58223065-58223087 CTTGTTTTGGCGGCTGTGGAAGG - Exonic
1175409562 20:58757639-58757661 ATTAGTCAGGATCCTGTGGAGGG - Intergenic
1177057263 21:16321578-16321600 CTTGTTCTGAATAATCTGGAGGG + Intergenic
1179513276 21:41889190-41889212 CTTGTTCAGGATCCTGGTGAGGG + Exonic
1182099150 22:27645730-27645752 GAAGTTCTGGATCCTTTGGAAGG + Intergenic
1182293838 22:29301546-29301568 CTTGGTCTGGCTTCTGAGGAAGG - Intergenic
1183803896 22:40192240-40192262 CATGTTAAGGATCCGGTGGAAGG + Intronic
949492244 3:4600399-4600421 CTTGCTGGGGATACTGTGGATGG + Intronic
949946113 3:9191430-9191452 ATTCTTCAGCATCCTGTGGATGG - Intronic
954283411 3:49600871-49600893 ATTCTTCTGGCTCCTGTGTATGG + Intronic
955221087 3:57023917-57023939 GTTGTTCTGGGTGCTGTGAATGG - Intronic
955465519 3:59233055-59233077 CTTGTGCTGTATTCTCTGGAGGG - Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956034260 3:65073286-65073308 CTCCTTCTGGAGACTGTGGAAGG - Intergenic
956187716 3:66578510-66578532 ATTGTTCAGGATCATGTGGCTGG + Intergenic
956703361 3:71978537-71978559 CTTGCCCTGGATCCTGTGGCTGG + Intergenic
959046965 3:101485081-101485103 CTTGTTTTGGCTGCTGTGGGGGG - Intronic
961201867 3:125051919-125051941 CTTGTCCTGGAGGCTGGGGAAGG - Intronic
963169808 3:142239584-142239606 ATTATCCTGGATTCTGTGGATGG + Intergenic
963812532 3:149792953-149792975 ATTGTTCTGTACCCTGTGGCAGG - Intronic
965202815 3:165681702-165681724 CCTGTTTTGGTTCCTGTGGCTGG - Intergenic
965653688 3:170960988-170961010 ACTGTTCTGGATACTGAGGATGG + Intergenic
966718986 3:183042831-183042853 CTGGTTCTAGATCCTAAGGATGG - Intronic
968919650 4:3515840-3515862 CTTGGTGCGGGTCCTGTGGATGG - Intronic
969952736 4:10854474-10854496 TTTGTTAGGGATCCTGGGGATGG + Intergenic
971482359 4:27125988-27126010 CTTGTTATGTCTCATGTGGAGGG - Intergenic
971914408 4:32850117-32850139 ATTGTTCTGGATCCTATCCAAGG - Intergenic
972264349 4:37444672-37444694 CTTGTTTTTGATGCTGCGGAGGG - Exonic
974349275 4:60723711-60723733 CTTGTTCTGGGACCTATAGAGGG - Intergenic
974480860 4:62441295-62441317 CTTCTTCTGGATCCTCCAGAAGG - Intergenic
977675873 4:99746192-99746214 CTTTTTCTGTATCCTGGGGATGG - Intergenic
979410902 4:120378175-120378197 CTTTTCCAGGATCCTGTGGTAGG - Intergenic
986097870 5:4577932-4577954 CTTGTACTGGTTACTGTGGTAGG + Intergenic
986796704 5:11219590-11219612 TTTGTTCTGGATTATCTGGATGG + Intronic
986944171 5:12994842-12994864 GTTGTTCTGGTTACTGGGGATGG - Intergenic
988660783 5:33265711-33265733 CTTGTTCTGTATTCTGTGCTTGG - Intergenic
989492716 5:42076747-42076769 ATTGTTGGGGATCCTGGGGATGG - Intergenic
990649103 5:57878177-57878199 CTAGATGTAGATCCTGTGGAGGG - Intergenic
992283103 5:75202788-75202810 CTTGTTCTGAATACTCTGAAAGG + Intronic
993574498 5:89585064-89585086 TTTGTTCTGGATTCTGGAGAAGG + Intergenic
993594206 5:89832230-89832252 CTTATTCTGACTCCTCTGGATGG + Intergenic
998367002 5:141638121-141638143 CTTGTTTCAGATCCTGAGGACGG + Exonic
999423896 5:151469236-151469258 CTCATTCTAGATCCTGTGAATGG + Intronic
1001217144 5:169866557-169866579 CCTGTTCTGGCTGCTGAGGAAGG + Intronic
1001501029 5:172234594-172234616 CTTTTTAATGATCCTGTGGAGGG - Intronic
1002336242 5:178480375-178480397 CTCCTTCTGGCTCCTGCGGAGGG - Intronic
1003938713 6:11002698-11002720 GTTGTTCTTGCTCCTGTTGATGG + Intronic
1003958753 6:11190297-11190319 CTTGTTCTGGGGCTTGTTGATGG + Exonic
1004118829 6:12798662-12798684 CTTGTCCTGTATGCTTTGGATGG + Intronic
1005077097 6:21919120-21919142 CCTGTTCTGGATCATGTGCCAGG - Intergenic
1008351324 6:50494327-50494349 TTTGTCCTGGATGCTGTGCAAGG - Intergenic
1010661704 6:78578943-78578965 CATGTTTTGGATGCTGTGCAGGG + Intergenic
1011545801 6:88480251-88480273 TTTGTTCTGGATTATCTGGATGG - Intergenic
1015299419 6:131635529-131635551 CTTGTTCTGGACTTTGTGTAAGG - Intronic
1016895397 6:149046394-149046416 CTTGTTCTGGATCATCTGCTAGG + Intronic
1017543411 6:155426295-155426317 CCTGTTCTAGGCCCTGTGGATGG + Intronic
1022019872 7:26388288-26388310 CTTGTTCTGCTTCCTGTGGACGG - Intergenic
1026013942 7:66657885-66657907 CTTTTTCTAGATCCTTTAGAGGG - Intronic
1026336321 7:69397037-69397059 CTTTCTCTGGGTCCTGTGTAAGG - Intergenic
1028743010 7:94297790-94297812 ATTGCTATCGATCCTGTGGAGGG - Intergenic
1030361090 7:108596107-108596129 CTAGGTATGGATACTGTGGAAGG + Intergenic
1030934839 7:115572606-115572628 ATTGTGCCAGATCCTGTGGAAGG + Intergenic
1032076713 7:128839472-128839494 ATTTTTCTGGATTCTGTGGCAGG + Intronic
1033617347 7:143029340-143029362 CTTGTTCTGGCCCCTGTGCATGG - Intergenic
1034655205 7:152723672-152723694 CTGGTTCTGGATTTTGTGGGGGG - Intergenic
1038461668 8:27722513-27722535 CATGTTGTGGATACTATGGATGG - Intergenic
1039728899 8:40253206-40253228 CCAGTTCTGGGTCCTGTGGCCGG - Intergenic
1041311218 8:56518884-56518906 TCTGCTCTGGAGCCTGTGGAGGG + Intergenic
1041806702 8:61858561-61858583 CTTGTTTTTCATCCTGTTGAAGG - Intergenic
1044526765 8:93261155-93261177 CTTGCTCTGGATACTATAGACGG + Intergenic
1045400305 8:101809480-101809502 ATTGTACTGGATGCTGTTGATGG - Intronic
1045485061 8:102624495-102624517 CTTTTTCTGTTTCCTGTGAATGG + Intergenic
1045861739 8:106821084-106821106 TTTGTGTTGGATTCTGTGGAGGG + Intergenic
1048332124 8:133477992-133478014 CTAGTTCTGGAAGCTGTAGAGGG - Intronic
1048566420 8:135602900-135602922 CTTGTTATGGTTCCTCTGTATGG - Intronic
1049884475 9:18058-18080 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
1052790320 9:32869561-32869583 CTTCTTCTTGATCCTGTTTATGG + Intergenic
1055689377 9:78812663-78812685 CCTGTTCTGGGTCCTGTTGCGGG + Intergenic
1056318626 9:85415965-85415987 CTTCTTATGGCTCCTGGGGAAGG - Intergenic
1059346278 9:113631190-113631212 CTCCTTCTGGATCATCTGGAGGG - Intergenic
1060397618 9:123327033-123327055 CTTGTTGTGGAGCCTTTGGGAGG + Intergenic
1060585563 9:124783161-124783183 CTTTTTCTGCAGCCTGCGGAGGG - Intronic
1061766178 9:132882800-132882822 TTTGTTCTGGAGGCAGTGGAGGG + Intronic
1188023649 X:25186075-25186097 CCTGTACTGGATCTTGTGGAGGG + Intergenic
1188135134 X:26485230-26485252 CTTAATCTGGCTCCTGGGGAGGG - Intergenic
1189285155 X:39847022-39847044 TTTACTCTGGCTCCTGTGGATGG - Intergenic
1189561192 X:42192986-42193008 ATTATTCTGGATTCTGTGGGTGG + Intergenic
1191580048 X:62750764-62750786 CTTCTTCTGGAAACTGTGAAAGG - Intergenic
1193822981 X:86188942-86188964 CATGTGCTAGATGCTGTGGAGGG - Intronic
1194810464 X:98381780-98381802 CTGGTTCTCTAGCCTGTGGATGG - Intergenic
1196468572 X:115998101-115998123 CTTGTTCTGCTTACTGTGAACGG + Intergenic
1196920426 X:120579756-120579778 CTTATTCTTGATCCTTTGTATGG - Intergenic
1197304238 X:124820980-124821002 CTTGTGGTAGATGCTGTGGAGGG - Intronic
1198119587 X:133578930-133578952 CTTGGTCTTGATCCTGTAGCAGG - Intronic
1198478477 X:137018387-137018409 CTCATTCAGGATCCTGTGGTTGG + Intergenic
1198666215 X:139026020-139026042 CTAGTTCTGAATCCTGTGGCAGG - Intronic
1198691437 X:139289243-139289265 CTTGTTCAGCATCCTATGGCTGG - Intergenic
1200243025 X:154507648-154507670 CTTGGTCTGGAGGCTGTGGGAGG - Intronic
1200401331 X:156022093-156022115 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
1201579890 Y:15500209-15500231 CTTTTTCTGGGTGCTGTGGAGGG + Intergenic
1202057447 Y:20849820-20849842 CCTGTTGTGGATCCTGGGGTGGG + Intergenic