ID: 1151694064

View in Genome Browser
Species Human (GRCh38)
Location 17:75705181-75705203
Sequence GCCACTGAGGGCAGCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 393}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151694064_1151694073 13 Left 1151694064 17:75705181-75705203 CCTCCAGAGCTGCCCTCAGTGGC 0: 1
1: 0
2: 4
3: 64
4: 393
Right 1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1151694064_1151694072 12 Left 1151694064 17:75705181-75705203 CCTCCAGAGCTGCCCTCAGTGGC 0: 1
1: 0
2: 4
3: 64
4: 393
Right 1151694072 17:75705216-75705238 TACCTATTAGGTCCCACGTTAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1151694064_1151694070 0 Left 1151694064 17:75705181-75705203 CCTCCAGAGCTGCCCTCAGTGGC 0: 1
1: 0
2: 4
3: 64
4: 393
Right 1151694070 17:75705204-75705226 TCGCCTGGGTGCTACCTATTAGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151694064 Original CRISPR GCCACTGAGGGCAGCTCTGG AGG (reversed) Intronic
900120494 1:1046714-1046736 GCCAGTGGGGGTGGCTCTGGGGG + Exonic
900143077 1:1146615-1146637 GACACTGGGGGCTGCTCTGGAGG + Intergenic
900280047 1:1861168-1861190 GCCACTGTGCGCAGCTGTGCTGG - Intronic
900294343 1:1941341-1941363 GATGCTGAGGGCAGCTCTGGGGG + Intronic
900534183 1:3168926-3168948 GCCACAGGGGTCAGCTCAGGTGG - Intronic
900780377 1:4614035-4614057 GGCCCTGAGGGCAGCTGGGGAGG + Intergenic
901043127 1:6378160-6378182 GGCACCCAGGGCTGCTCTGGTGG - Intronic
901668510 1:10839970-10839992 GCCAGTGTGGCCAGCCCTGGGGG + Intergenic
901876091 1:12167713-12167735 TCCACTGAGGGCACAGCTGGAGG + Intronic
902794643 1:18793246-18793268 GTCACGGAGGGCAGCTAAGGTGG - Intergenic
903067370 1:20708118-20708140 GCAACTGAGGACAGATCAGGAGG - Intronic
903185505 1:21626685-21626707 GGCACTGAGGGTTGCTGTGGAGG + Intronic
903262822 1:22140594-22140616 GCCAGGAATGGCAGCTCTGGGGG - Intronic
903366259 1:22807095-22807117 GCCACTTGGGGCACCTCTGAGGG + Intronic
905763870 1:40584003-40584025 GCCACTGCGCCCAGCTCTGGGGG - Intergenic
906202644 1:43970090-43970112 CCCCCTGAGGGCTGCTCTAGAGG + Exonic
906281713 1:44559176-44559198 ACCACTGAAGGAAGTTCTGGAGG - Intronic
907149526 1:52270496-52270518 GCCAAGGAGGGCAGATCAGGAGG - Intronic
907424988 1:54373932-54373954 CACACTGACCGCAGCTCTGGTGG - Intronic
911598832 1:99825682-99825704 GCTACTCAGGGCAGCTGAGGTGG + Intergenic
913198185 1:116475278-116475300 GCCTCTGAAGGCAGGGCTGGTGG - Intergenic
913539765 1:119807575-119807597 GCCACAGAAGGCAGCTCTGCAGG + Intronic
915354971 1:155250520-155250542 GCAGCTGCGGGCAGCTGTGGGGG + Exonic
915361080 1:155286773-155286795 AACACTGAGGGCAGCCCTGAAGG - Intronic
917033561 1:170721620-170721642 GCCCCTGAGGGTAGATCAGGAGG + Intronic
917295800 1:173517972-173517994 GCCACTGCGCCCAGCCCTGGTGG - Intronic
919165332 1:193885134-193885156 GCCATGAATGGCAGCTCTGGAGG - Intergenic
919388676 1:196954374-196954396 GCCCATGAGAGCAGCCCTGGGGG - Intronic
920253340 1:204637463-204637485 GGCACTCAGGGCAGCCCTGTGGG - Intronic
920902580 1:210125968-210125990 GCCGAGGAGGGCAGCTCAGGAGG + Intronic
922338069 1:224633743-224633765 CCCACTGAGTGCAGTCCTGGTGG - Intronic
922667157 1:227480366-227480388 GCAAATGAGGACATCTCTGGGGG + Intergenic
922785150 1:228278961-228278983 GGCAGGGAGGGCAGCTCTGCAGG + Intronic
923941573 1:238832844-238832866 GCCCCTGAAAGCAGCTGTGGTGG + Intergenic
924186635 1:241498477-241498499 GCCATTGGAAGCAGCTCTGGAGG - Intronic
1062765195 10:57190-57212 GCCCATGAGAGCAGCTGTGGGGG - Intergenic
1063623085 10:7666959-7666981 GCCACTGCGGGACGCTCTCGGGG + Exonic
1064061810 10:12144252-12144274 ACTTCTGAGGGGAGCTCTGGAGG + Intronic
1065317157 10:24474106-24474128 GTCACTGTGGGCAGCTCTACAGG + Intronic
1065435658 10:25701829-25701851 GCCACGCAGGGCTGCTCGGGCGG - Intergenic
1066291259 10:34016374-34016396 GCCGCTCAGGGCATCTATGGTGG + Intergenic
1066332720 10:34442456-34442478 GGCACTGAGGGGAGCCCCGGTGG + Intronic
1067024853 10:42836130-42836152 GCCACTGTGGCCAGAGCTGGAGG - Intergenic
1067478356 10:46580299-46580321 CCCACTGGAGGCAGCTGTGGTGG - Exonic
1067616382 10:47761488-47761510 CCCACTGGAGGCAGCTGTGGTGG + Intergenic
1069814797 10:71186940-71186962 GCCTGTGAGGGTAGCTATGGTGG + Intergenic
1069909036 10:71748756-71748778 GCCTCTGATGCCAGCCCTGGTGG - Exonic
1070806352 10:79273250-79273272 GCCTCTGTGGCCAGCTCTGCAGG + Intronic
1071379225 10:85041168-85041190 GCCCCTGAGGGAAGAGCTGGAGG - Intergenic
1071666986 10:87568138-87568160 ACCAATGAGAGCAGCCCTGGGGG + Intergenic
1072401964 10:95111882-95111904 GCCACTGAGTGCAGCTTTCAGGG + Intergenic
1074103771 10:110374205-110374227 GCCAGTGAGGGCAGGTCCGGGGG + Intergenic
1074364291 10:112845611-112845633 GGCACTGAGGGCTGAGCTGGAGG + Intergenic
1075406777 10:122200581-122200603 GCCACTGTGGGCAGGTGAGGTGG - Intronic
1075406786 10:122200626-122200648 GCCACTGTGGGCAGGTGAGGTGG - Intronic
1075406795 10:122200671-122200693 GCCACTGTGGGCAGGTGAGGTGG - Intronic
1075406818 10:122200761-122200783 GCCACTGTGGGCAGGTGAGGTGG - Intronic
1075406882 10:122201076-122201098 GCCACTGTGGGCAGGTGAGGTGG - Intronic
1075406891 10:122201121-122201143 GCCACTGTGGGCAGGTGAGGTGG - Intronic
1075406900 10:122201166-122201188 GCCACTGTGGGCAGGTGAGGTGG - Intronic
1075406919 10:122201256-122201278 GCCACTGTGGGCAGGTGAGGTGG - Intronic
1075406929 10:122201301-122201323 GCCACTGTGGGCAGGTGAGGTGG - Intronic
1075406938 10:122201346-122201368 GCCACTGTGGGCAGGTGAGGTGG - Intronic
1075406949 10:122201391-122201413 GCCACTGTGGGCAGGTGAGGTGG - Intronic
1076600614 10:131654747-131654769 GGCGCAGAGGGCAGCTCTGCAGG + Intergenic
1076664927 10:132081835-132081857 GCCGATGAGGGCTGCTCTGTAGG - Intergenic
1076675335 10:132144640-132144662 GCCACTGCGCCCAGCCCTGGAGG - Intronic
1076680875 10:132170529-132170551 GTCACCGAGGGCAGCTGTGGGGG - Intronic
1076685487 10:132196733-132196755 GCCAGTGAGGGAAGCACTGCGGG + Intronic
1076874773 10:133210749-133210771 GCCCCAGGGGGAAGCTCTGGCGG - Intronic
1077228957 11:1450251-1450273 GCCACGAAGGGCGGCTCGGGGGG - Intronic
1077486036 11:2838843-2838865 GCCAGAGGGGGCAGCTCAGGAGG + Intronic
1079122900 11:17697765-17697787 GCGCCTGAGGTCAGCACTGGAGG - Intergenic
1081325389 11:41738166-41738188 GCCAGTGAAAGCAGCTATGGGGG - Intergenic
1081594006 11:44446765-44446787 TCCACTGGGGGCAGCTGGGGTGG + Intergenic
1081810874 11:45913574-45913596 GGCACTGAGGGCAGGGCTGAGGG - Intronic
1083166516 11:60891423-60891445 GGCACTGAGGGAGGCACTGGGGG - Intronic
1083559949 11:63665416-63665438 ACTACTGAGGACAGCTATGGGGG + Intronic
1083638755 11:64134159-64134181 TCCACTGTGGGAAGCTCTAGTGG - Intronic
1083982419 11:66183760-66183782 GCCACTGAGTGCTGCTCTTGAGG - Intronic
1084403137 11:68956317-68956339 GCCACTGGGGGTCGCTGTGGTGG + Intergenic
1084454174 11:69257886-69257908 CCCACTAAGGGCAGCTTAGGAGG + Intergenic
1086198090 11:84166215-84166237 GCCACTGCGCCCAGCCCTGGGGG - Intronic
1086497878 11:87422583-87422605 GCCACTGGAGACAGCTCTGCTGG - Intergenic
1088188898 11:107205356-107205378 GCCCTTGAGAGCAGCTGTGGGGG - Intergenic
1088708148 11:112482252-112482274 GGCACTGAGGGAAGCTCTCTGGG + Intergenic
1089129303 11:116199544-116199566 GACACTGGGGGCAGCCGTGGGGG + Intergenic
1089282963 11:117387225-117387247 GCCTCTGAGAGCTGCTCTGGGGG - Exonic
1090268003 11:125366305-125366327 GCCACTGTTGGCTGATCTGGGGG - Intronic
1090423505 11:126591585-126591607 GGACCTGAGGTCAGCTCTGGGGG + Intronic
1091121139 11:133058599-133058621 TCCCATCAGGGCAGCTCTGGAGG + Intronic
1091327335 11:134701024-134701046 GCCACTGAGGGCAGTCGCGGTGG + Intergenic
1091533341 12:1381484-1381506 GCCATTGAGGACGGCTGTGGTGG - Intronic
1092180754 12:6445164-6445186 GCCTCTCTGGGCAGCTCTTGGGG - Exonic
1092204797 12:6608146-6608168 GGGACTGAGGGCAGCTCTAGGGG - Intergenic
1095237672 12:39817556-39817578 GCAACTGATGGCAGCTAAGGGGG + Intronic
1097513140 12:60568269-60568291 GCCAATGAGAGCAGCCATGGGGG + Intergenic
1101032281 12:100672164-100672186 GGCCCTGGGTGCAGCTCTGGTGG + Intergenic
1102023991 12:109703063-109703085 GCCTCTGAGGCCAGGTGTGGTGG + Intergenic
1102042130 12:109807847-109807869 TCCCCTGAGGGAAGGTCTGGAGG - Intronic
1102240142 12:111320188-111320210 GCCAGTGATGGCCGCTCCGGGGG - Exonic
1102902044 12:116646548-116646570 GCCCCTGAGCCCAGCTCTGAAGG - Intergenic
1103284168 12:119786427-119786449 ACCACTGAGGGCAGCTGTCCTGG - Intronic
1103321482 12:120095050-120095072 GCCACTCAGCACATCTCTGGAGG + Intergenic
1103933945 12:124465496-124465518 CCCACTGGGGGCAGCTATAGTGG - Intronic
1104585576 12:130045575-130045597 GCCCCGGAGGGCAGCCCAGGCGG - Intergenic
1104757055 12:131275974-131275996 ACCCCTGAGGGCAGCTCATGGGG - Intergenic
1105256706 13:18748185-18748207 GCCCATGAGGGCACCTGTGGGGG - Intergenic
1105258051 13:18757927-18757949 GCCCATGAGGGCAACTGTGGAGG - Intergenic
1105259378 13:18767546-18767568 GCCCATGAGGGCATCTATGGGGG - Intergenic
1105260708 13:18777232-18777254 GCCCATGAGGGCAACTGTGGAGG - Intergenic
1105261169 13:18780444-18780466 GTCAATGAGGGCAGCTGTAGGGG - Intergenic
1105262060 13:18786868-18786890 GCCCATGAGGGCACCTTTGGGGG - Intergenic
1105263493 13:18797038-18797060 GCCAATGAGGGCAGCTGTGGGGG - Intergenic
1105324251 13:19355758-19355780 ACGGCTGAGGGCAGCTGTGGTGG - Intergenic
1105869013 13:24487646-24487668 ACGGCTGAGGGCAGCTGTGGTGG + Intronic
1106903328 13:34378541-34378563 GCTCCTGAGGGCTGCTCTGCTGG - Intergenic
1111207223 13:85027076-85027098 GCCCCTGAGAGCAGCTATTGGGG - Intergenic
1111536383 13:89607350-89607372 GCCACTGAGCCCAGCTGTGGTGG - Intergenic
1112151125 13:96765304-96765326 GCCAAGGAGGGCAGATCAGGAGG - Intronic
1113522984 13:110953794-110953816 GCCACAGAGGGCCTCACTGGGGG - Intergenic
1113693657 13:112329467-112329489 GCAGCTGAGGGCAGCTCCTGGGG - Intergenic
1113834796 13:113321734-113321756 GTCACCGAGGGCAGCTGTCGCGG + Intronic
1114781303 14:25541058-25541080 GCCACTGAGGGCATTTCAGCAGG + Intergenic
1115134288 14:30090611-30090633 GCCCTTGAGAGCAGCTGTGGGGG - Intronic
1116864149 14:50017810-50017832 GTCTCTGAGGGCAGACCTGGGGG - Intergenic
1117156985 14:52951159-52951181 CCCGCTCAGGGCAGCTCTGCGGG - Intronic
1121009557 14:90512129-90512151 GACAATAAGGCCAGCTCTGGGGG + Intergenic
1121251210 14:92500677-92500699 GCCACTGTGGCCAACTCTTGGGG + Exonic
1121426275 14:93854405-93854427 TCCACTGAGGGCAGCTCCTGGGG + Intergenic
1122846163 14:104500337-104500359 ACCACAGAGGGCAGCTTTGCAGG - Intronic
1123028117 14:105438189-105438211 GCCGCTGTGGGCAGGGCTGGTGG + Intronic
1202834943 14_GL000009v2_random:71002-71024 GCCAATGAGGGCAGCTGTAGGGG + Intergenic
1202835140 14_GL000009v2_random:72300-72322 GCCTATGAGGGCAGCCATGGGGG - Intergenic
1123425487 15:20167586-20167608 GCCACTGTGGCCAGAGCTGGAGG - Intergenic
1123534709 15:21174104-21174126 GCCACTGTGGCCAGAGCTGGAGG - Intergenic
1124422640 15:29536163-29536185 ACCACTGAGGGGAAGTCTGGTGG + Intronic
1126929560 15:53632630-53632652 GCCCATGAGAGCAGCTGTGGGGG + Intronic
1126962505 15:54013387-54013409 CCCTCTGAGGGCAGCTCTGACGG + Exonic
1129182056 15:73883849-73883871 GCCACTGGGGGCAAGTCTTGGGG - Intronic
1131328187 15:91469176-91469198 TCCACTGGGGGCAGCTCTCCTGG + Intergenic
1131865671 15:96706852-96706874 ACCACAGTGTGCAGCTCTGGTGG + Intergenic
1131909136 15:97177369-97177391 GGCACTGAGGGCCGACCTGGGGG + Intergenic
1132674091 16:1114545-1114567 GCCACTGGGGGCAGGGGTGGGGG + Intergenic
1132958988 16:2611919-2611941 ACCACTGAGGCCAGGCCTGGAGG + Intergenic
1132972047 16:2693894-2693916 ACCACTGAGGCCAGGCCTGGAGG + Intronic
1133019433 16:2960713-2960735 GACCCTGAGAGCAGCCCTGGGGG - Intergenic
1133030960 16:3010956-3010978 GCCAGTGCGGGCAGGGCTGGAGG - Intergenic
1133142169 16:3754008-3754030 GACACTGAGGGAGGCACTGGTGG + Intronic
1133750481 16:8721398-8721420 GGCACCGGGGGAAGCTCTGGAGG - Intronic
1134446883 16:14337713-14337735 GCCAGTGTGGGCAGCTGTGAGGG - Intergenic
1135662268 16:24306906-24306928 GACACGGAGGGCAGGTGTGGTGG + Intronic
1136629152 16:31479251-31479273 GTGACTGAGGGAAGCACTGGGGG + Intergenic
1137496670 16:48974624-48974646 GCCACTGTGTGAAGATCTGGGGG - Intergenic
1138264103 16:55647197-55647219 GAAACTGAGGCCAGGTCTGGTGG + Intergenic
1138537427 16:57667379-57667401 GCCACTCGGGCCAACTCTGGAGG - Intergenic
1138678011 16:58665825-58665847 GCCACTGAGGCCAGGCCTGATGG + Exonic
1139485829 16:67256108-67256130 GGTGCTGAGGACAGCTCTGGGGG - Intronic
1139500113 16:67356203-67356225 GCCACTGAGGGTGGCTGTGGTGG - Intronic
1139590221 16:67929134-67929156 CCCACTGAAGGCAGCTGTGGAGG - Exonic
1139796505 16:69486956-69486978 CCCACTGACGCCAGCTCTGCCGG + Intergenic
1141003242 16:80327792-80327814 GCCAATAAGGCCATCTCTGGAGG - Intergenic
1141445663 16:84056282-84056304 GCCACTGACAGCAACTATGGTGG + Intronic
1141698616 16:85632378-85632400 GGCACTGAGGGAAGGGCTGGGGG - Intronic
1141818749 16:86430864-86430886 GCCTCCGAGCCCAGCTCTGGTGG + Intergenic
1142439462 16:90086125-90086147 GCCCATGAGAGCAGCTGTGGGGG + Intronic
1203120331 16_KI270728v1_random:1530429-1530451 GCCACTGTGGCCAGAGCTGGAGG + Intergenic
1142864502 17:2782420-2782442 GCCACTGAGGGCGGGTCAGGTGG - Intronic
1142897459 17:2991154-2991176 CCCACTGAGGGCAGCTATGGTGG + Intronic
1143039594 17:4023950-4023972 GCCACTGAGGCCAGCTGCTGTGG + Intronic
1144704940 17:17362204-17362226 GCCAGAGAGGGCAGCTCCAGGGG - Intergenic
1144741089 17:17582637-17582659 GGGCATGAGGGCAGCTCTGGGGG - Intronic
1144778715 17:17797407-17797429 GCCAGTGAGGACAACTCTGGTGG + Exonic
1147168100 17:38604003-38604025 GCCACTGGTGGCAGCTGTGATGG - Intronic
1147203728 17:38822000-38822022 GCCACTGCGGGCAGATCATGAGG - Intronic
1147534348 17:41309174-41309196 TCCACTGAGGTGAGCTGTGGAGG - Exonic
1147536350 17:41325203-41325225 GCCACAGAGGGCAGCCACGGGGG - Intergenic
1147833965 17:43316895-43316917 GGCACTAAGGACTGCTCTGGTGG + Intergenic
1147841760 17:43376871-43376893 GGCACTGAGGACTGCTATGGTGG - Intergenic
1148280397 17:46342558-46342580 TCCTCTGAGGGCAGTTCAGGTGG - Intronic
1148302625 17:46560495-46560517 TCCTCTGAGGGCAGTTCAGGTGG - Intronic
1148486725 17:47995479-47995501 GCCACTGAATGCTGCTTTGGGGG - Intergenic
1148896565 17:50842444-50842466 GCCACTGGGAGCATCTTTGGGGG + Intergenic
1149441522 17:56678408-56678430 CGCACTGAGGGCAGCGCAGGGGG + Intergenic
1151694064 17:75705181-75705203 GCCACTGAGGGCAGCTCTGGAGG - Intronic
1152036729 17:77877984-77878006 GGCTCTGAGGGCATTTCTGGGGG + Intergenic
1152039357 17:77892960-77892982 CCCACTCAGGACAGCTCTGAGGG + Intergenic
1152179246 17:78807506-78807528 GACCCCGAGGGCAGCTTTGGAGG + Exonic
1152700994 17:81819761-81819783 CCCAGTGAGGTCAGCTCTGCAGG - Intergenic
1152901104 17:82941630-82941652 GCCAGAGAAGGCAGCTCTGCTGG - Intronic
1152958109 18:57531-57553 GCCCATGAGAGCAGCTGTGGGGG - Intronic
1153630254 18:7062354-7062376 GACACTGAGGGGAACTCTGAGGG + Intronic
1153782273 18:8505137-8505159 GCCCCTGACTGCAGCACTGGTGG - Intergenic
1154425729 18:14270641-14270663 GCCCATGAGGGCAGCTGTGGGGG + Intergenic
1154426629 18:14277250-14277272 GCCCATGAGGGCACCTGTGGGGG + Intergenic
1154427540 18:14283696-14283718 GCCAATGAGGGCAGCTGTGGGGG + Intergenic
1154429371 18:14296842-14296864 GCCCATGAGGGCACCTGTGGGGG + Intergenic
1154430268 18:14303236-14303258 GCCAATGAGGGCAGCTGTGGGGG + Intergenic
1154431646 18:14313190-14313212 GCCCATGAGGGCACCTGTGGGGG + Intergenic
1154432543 18:14319586-14319608 GTCAATGAGGGCAGCTGTAGGGG + Intergenic
1154433418 18:14325882-14325904 GCCCATGAGGGCAGCTGTGGGGG + Intergenic
1154434339 18:14332493-14332515 GCCCATGAGGGCACCTGTGGGGG + Intergenic
1156512866 18:37655727-37655749 GCCTCTGGGGGCAGCCCTGTGGG - Intergenic
1157081396 18:44529296-44529318 GCCAATGTGGGCAGATCAGGAGG + Intergenic
1157387054 18:47266268-47266290 GTCACTGAGGCCAGATGTGGTGG - Intergenic
1158121466 18:54052890-54052912 GCCACTGAAGGCAGAGCTGTAGG + Intergenic
1158648306 18:59266262-59266284 GCCCCGCAGGGCAGCTCTGAGGG - Intergenic
1159301757 18:66581696-66581718 GCCACTGAAGGCTGCACTGTTGG + Intronic
1159892266 18:73964099-73964121 GCCAGTGAAGGCAGCTGTGGGGG - Intergenic
1160717563 19:583309-583331 GCATCCGGGGGCAGCTCTGGAGG + Exonic
1161477026 19:4491799-4491821 GCCACGGAGGGGCCCTCTGGGGG + Exonic
1161676223 19:5651565-5651587 ACCACTGGGGGCAGTTCTAGTGG + Intronic
1161849342 19:6730714-6730736 GACACCCAGGGCCGCTCTGGGGG - Intronic
1161930117 19:7333832-7333854 GCCCCAGAGGGCAGCTACGGAGG - Intergenic
1162330790 19:10027952-10027974 GCCACTGTCTGCAGCTCAGGTGG + Intergenic
1162407087 19:10481355-10481377 GCCAAGGAGGGCAGATCAGGAGG + Intergenic
1162796220 19:13088976-13088998 GCCAGGGTGGGCAGCTCTGGGGG + Intronic
1162904337 19:13814690-13814712 GCCACAGTGGGCGGCCCTGGGGG - Intronic
1163129690 19:15264811-15264833 GACCCTGAGGGCAGCTGTGCCGG - Intronic
1163653385 19:18531892-18531914 GAAACTGAGGCCAGCCCTGGCGG + Exonic
1166864868 19:45829772-45829794 GCAAGTGAGGGCTGCTCTTGTGG - Intronic
1167197609 19:48041509-48041531 GGGACTGAGGGCAGGTCAGGTGG + Intronic
1168265323 19:55220356-55220378 CCAACAGAGGCCAGCTCTGGGGG + Intergenic
1168305428 19:55432809-55432831 GCCCGTGAGGTCAGCGCTGGAGG - Exonic
1168579874 19:57546292-57546314 GACAGTGAGGGCAGCTCTTCAGG - Intronic
1168688384 19:58362255-58362277 GCCTGTGCGGGCAGCTCCGGAGG + Intronic
1202637761 1_KI270706v1_random:56690-56712 GCCAATGACGGCAGCTGTAGGGG - Intergenic
925714539 2:6772353-6772375 GAGAGAGAGGGCAGCTCTGGAGG - Intergenic
926045654 2:9707903-9707925 GCCACAGAAGGCAGCACTGACGG - Intergenic
926055228 2:9770513-9770535 GCATTTGAGGGCTGCTCTGGGGG - Intergenic
927374680 2:22400329-22400351 GCCACTCAGTGCAGCTCAGTAGG - Intergenic
928355986 2:30614964-30614986 GTCACCGAGGACAGTTCTGGTGG + Intronic
929289258 2:40170506-40170528 GTCACAGAAGGGAGCTCTGGTGG + Intronic
929588766 2:43132147-43132169 GCCTCTGAGGGGAGACCTGGAGG + Intergenic
932475607 2:72003940-72003962 GCCACGGCGGGCAGAACTGGTGG + Intergenic
932500482 2:72178831-72178853 TACACTAAGGGCAGCTCTGGAGG - Exonic
933632677 2:84674796-84674818 GCCACTGAGCGCTGGCCTGGTGG - Intronic
934491761 2:94766001-94766023 GCCCATGAGGGCAGCTGTGGGGG - Intergenic
934493626 2:94779391-94779413 GCCCATGAGGGCAGCTGCGGGGG - Intergenic
936561263 2:113541697-113541719 GAAACTGAGGGCAGCTCGGGCGG + Intergenic
937066455 2:119021492-119021514 GTCACTGAAGTCAGCACTGGTGG + Intergenic
939243655 2:139594853-139594875 GCCTGTGAGAGCAGCTGTGGGGG + Intergenic
939862539 2:147436892-147436914 GCCACCGAGGGGAGTTCTGGGGG - Intergenic
943119851 2:183722239-183722261 ACCACTCATGGCAGATCTGGAGG + Intergenic
946394157 2:219434954-219434976 GCCACTGAGAGCTGGGCTGGGGG - Exonic
946831788 2:223735159-223735181 GCCACTCCTGGCAGCTCTGAAGG - Intergenic
947873137 2:233450687-233450709 GCCACAGGTGGCAGCGCTGGAGG - Intronic
947875839 2:233467805-233467827 GCCAGTCAGGGCAGCTCCTGTGG + Intronic
948135364 2:235632353-235632375 AGTAGTGAGGGCAGCTCTGGGGG + Intronic
948588520 2:239035728-239035750 CCCACTGAGGCCGACTCTGGAGG - Intergenic
949069481 2:242015608-242015630 GCAACTCAGGGCAGCCCAGGAGG + Intergenic
1169423033 20:5474804-5474826 GCCACAGAGGCGAGCTCTGCTGG - Intergenic
1169916293 20:10686948-10686970 TCCACTGGGGGCAGAGCTGGGGG - Intergenic
1169920668 20:10731315-10731337 TCAACTCAGGACAGCTCTGGAGG - Intergenic
1170873687 20:20231622-20231644 GCCTCTGAGGGGAGCCCAGGAGG + Intronic
1171777255 20:29380728-29380750 GCCCATGAGAGCAGCTTTGGGGG - Intergenic
1171818675 20:29812523-29812545 GCCCATGAGAGCAGCTGTGGGGG - Intergenic
1171883439 20:30634289-30634311 GCCCATGAGGACAGCTGTGGGGG - Intergenic
1171883858 20:30637371-30637393 GCCCATGAGGGCAACTGTGGAGG - Intergenic
1171884335 20:30640782-30640804 GCCAATGAGGTCAGCTGTAGGGG - Intergenic
1171899126 20:30840502-30840524 GCCCATGAGAGCAGCTGTGGGGG + Intergenic
1173025818 20:39306356-39306378 GCTACTTAGGGCATCTCTGCAGG + Intergenic
1173457519 20:43215480-43215502 GACCCTGTGGGGAGCTCTGGGGG - Intergenic
1173964194 20:47099255-47099277 GCCGCAGAGGGCAGCCTTGGTGG + Intronic
1175380455 20:58559099-58559121 CCCAGTGAGGGCAGGTTTGGAGG - Intergenic
1175410420 20:58763928-58763950 GCCACTGAGAAAAGCCCTGGTGG - Intergenic
1175466887 20:59195378-59195400 GCCACTGAGGACGGTCCTGGAGG + Intronic
1175827044 20:61942040-61942062 TCCCCAAAGGGCAGCTCTGGGGG + Intergenic
1175929002 20:62484785-62484807 GCCTCTCGGGGCTGCTCTGGTGG + Intergenic
1176296499 21:5076118-5076140 GGCAGCGAGGGCAGTTCTGGTGG + Intergenic
1176843625 21:13859868-13859890 GCCCATGAGGGCAGCTGTGGGGG - Intergenic
1176846297 21:13879188-13879210 GCCCATGAGGGCAGCTGTGGGGG - Intergenic
1176847224 21:13885725-13885747 GCCAATGAGGGCAGCTGTAGGGG - Intergenic
1176848119 21:13892129-13892151 GCCCATGAGGGCACCTGTGGGGG - Intergenic
1176849034 21:13898730-13898752 GCCCATGAGGGCAGCTGTGGGGG - Intergenic
1176861736 21:14014795-14014817 GCCACTGTGGGCAGCGGGGGCGG - Intergenic
1178423438 21:32460151-32460173 GCCACTCAGGGAATCTCTGTGGG - Intronic
1178932107 21:36828098-36828120 GCCACTGAGGCCAGGTATGGTGG - Intronic
1179860550 21:44186003-44186025 GGCAGCGAGGGCAGTTCTGGTGG - Intergenic
1179903224 21:44405833-44405855 GCGACGGGGGACAGCTCTGGGGG + Intronic
1180153487 21:45965287-45965309 GCCCTTGAGAGCAGCTGTGGGGG + Intergenic
1180322120 22:11331897-11331919 GCCCATGAGAGCAGCTGTGGGGG - Intergenic
1180332793 22:11547805-11547827 GCCCATGAGAGCAGCTGTGGGGG + Intergenic
1180842295 22:18965056-18965078 GCCTCTGTGGGCAGTCCTGGAGG - Intergenic
1181008838 22:20028510-20028532 GCCACGACTGGCAGCTCTGGAGG - Intronic
1181032754 22:20156267-20156289 TCCACATAGGGCAGCTCTGAGGG - Intergenic
1181059194 22:20273821-20273843 GCCTCTGTGGGCAGTCCTGGAGG + Intronic
1181257607 22:21573957-21573979 GTCACTGAGGGCAGTGCTGATGG + Intronic
1182642232 22:31777492-31777514 GCCACGGAGGGCAGATCACGAGG - Intronic
1183094129 22:35542053-35542075 GGCCCGGAAGGCAGCTCTGGAGG + Intronic
1183301611 22:37061609-37061631 ACCAGGGATGGCAGCTCTGGGGG - Exonic
1183369534 22:37424666-37424688 GCCACTGAGGGCGGCGGGGGGGG + Intronic
1184026053 22:41857382-41857404 GCCTCTCATGGCAGCCCTGGAGG - Intronic
1184759073 22:46534732-46534754 GGCACTGAGGGTAGCAATGGAGG + Exonic
1185041883 22:48508336-48508358 GCCACATTGGCCAGCTCTGGGGG - Intronic
1185069962 22:48650809-48650831 GCCTCAGAGGGCAGCCCTGGGGG - Intronic
950273917 3:11642572-11642594 GCCGCCGAGGGCATCTCCGGGGG - Intronic
950457066 3:13099165-13099187 ACCACTGAGTGTAGCCCTGGGGG + Intergenic
950469320 3:13174761-13174783 GCCAGCGAGGGCAGCTCTGAGGG - Intergenic
950667634 3:14506806-14506828 GCCACCGAGGGTGGCTTTGGGGG - Exonic
952964407 3:38612147-38612169 GCCACTTGTGGGAGCTCTGGGGG + Intronic
953369430 3:42374919-42374941 GCCACTCAGGGGAGCTGAGGTGG - Intergenic
953627327 3:44581343-44581365 GGCGCTGAGGGCAGCTGTGGCGG - Intronic
954644932 3:52125465-52125487 GACAATGAGGCCAGCCCTGGAGG - Intronic
957087822 3:75698925-75698947 GCCCATGAGAGCAGCTGTGGGGG + Intergenic
959214756 3:103437393-103437415 GCCCTTGAGAGCAGCTGTGGGGG - Intergenic
959323060 3:104903966-104903988 GTCCCTGGGGGCAGGTCTGGAGG + Intergenic
960658992 3:120038275-120038297 GCCACTGAGGCCAGGCATGGTGG + Intronic
961798268 3:129425345-129425367 GCCAGTGAAGGCAGCTTTGTAGG - Intronic
964504799 3:157387559-157387581 ACCATTTAGGGCAGCTCTGTAGG + Intronic
965233933 3:166090928-166090950 GCCAGTGAAAGCAGCCCTGGGGG - Intergenic
966593584 3:181706241-181706263 ACCACTGATGGCAGCTCTTCAGG + Intergenic
968081745 3:195851086-195851108 GACAGTGTGGGAAGCTCTGGGGG + Intergenic
968618726 4:1594019-1594041 GCCGCTGGGGGCAGCTCCCGGGG + Intergenic
968653865 4:1770430-1770452 GCCACCGCGGGCAGCCCAGGCGG + Intergenic
968742275 4:2337319-2337341 GGGGCAGAGGGCAGCTCTGGGGG - Intronic
968754815 4:2409707-2409729 ACCCCTGCGGGCAGCTCTGTGGG + Intronic
968903445 4:3441501-3441523 CCCACAGACGGCAGCACTGGGGG - Intergenic
968912536 4:3483462-3483484 GCCACTGATGTCAGCTCTGCTGG + Intronic
969205073 4:5637679-5637701 GCAACTGAGGGCAGGTGTGAAGG + Intronic
971545419 4:27879760-27879782 GCCCATGAGAGCAGCTGTGGGGG - Intergenic
971741290 4:30525277-30525299 GCCCATGAGAGCAGCTGTGGGGG - Intergenic
972325649 4:38013025-38013047 GCCAAGGAGGGCAGATCAGGAGG - Intronic
973367086 4:49216561-49216583 GCCCATGAGGGCAGCTGTGGGGG - Intergenic
973367518 4:49219642-49219664 GCCCATGAGGGCAACTGTGGAGG - Intergenic
973393324 4:49574016-49574038 GCCTATGAGGGCAGCCATGGGGG - Intergenic
976719830 4:88158893-88158915 GCCACTGCGTTCAGCTCTGGCGG - Exonic
980968831 4:139550161-139550183 GGCACTGAGGCCAGGTGTGGTGG - Intronic
981696472 4:147564033-147564055 GCAGCTGAGGGCAGCTATGAGGG - Intergenic
984163800 4:176284754-176284776 GGCACTCAGGGCAGATCTGAAGG + Intergenic
984761260 4:183364770-183364792 CCCACTGGCGGCAGCCCTGGGGG - Intergenic
984778638 4:183505021-183505043 GGGAGTGAGGGCTGCTCTGGGGG + Exonic
984879092 4:184394840-184394862 GCCACTTTGGGAAGCTCTGGCGG - Intronic
985443166 4:189999894-189999916 GCCCATGAGAGCAGCTATGGGGG - Intergenic
1202764803 4_GL000008v2_random:140903-140925 GCCTATGAGGGCAGCCATGGGGG + Intergenic
1202765081 4_GL000008v2_random:142547-142569 GCCAATGAGGGCAGCTGTAGGGG - Intergenic
985476469 5:82054-82076 TCCACTGAAGGCAGGGCTGGTGG + Intergenic
985539303 5:480481-480503 GCCCTGGAGGGCGGCTCTGGCGG - Intronic
985563505 5:603744-603766 GCTGCGGAGGGGAGCTCTGGAGG - Intergenic
986367079 5:7043106-7043128 GCCATTGAGGGCCGCACGGGTGG - Intergenic
988155040 5:27439621-27439643 GAAACTGAGGGCAGCGCCGGTGG + Intergenic
988159612 5:27502753-27502775 GCCCATGAAGGCAGCTGTGGGGG - Intergenic
989096565 5:37787356-37787378 GCCTCACAGGGCTGCTCTGGTGG - Intergenic
989106873 5:37871102-37871124 GCCCCAGATGGCAGCTCAGGGGG - Intergenic
989812684 5:45696286-45696308 GCCACTAAGGGCAGCGGCGGCGG - Intergenic
990190040 5:53249460-53249482 GCAACTGGAGGCAGCTCCGGTGG - Intergenic
990646864 5:57855119-57855141 TCAACTGAGAACAGCTCTGGGGG - Intergenic
991715664 5:69448732-69448754 GCCAAGGCGGGCAGATCTGGAGG - Intergenic
993005574 5:82425216-82425238 AGCAGTGAGGCCAGCTCTGGTGG + Intergenic
994275607 5:97833070-97833092 GCCACACAGGGAAGCACTGGAGG - Intergenic
994517929 5:100794106-100794128 GACACTGAGGGCAGCTTGGCAGG + Intergenic
995748072 5:115424664-115424686 GGCACAGATGGCAGCTCTGGCGG + Intergenic
995779752 5:115762654-115762676 GCCAGTGAAAGCAGCTGTGGGGG - Intergenic
998353312 5:141514815-141514837 GGCCCTGAGGTGAGCTCTGGTGG + Intergenic
1000575021 5:162966476-162966498 GCCAATGAAAGCAGCCCTGGGGG - Intergenic
1001482179 5:172096004-172096026 GGCACTGAGGGCAGCTAGAGGGG + Intronic
1002304989 5:178277980-178278002 GGCACAGAGGGCTGTTCTGGTGG + Intronic
1002415524 5:179119057-179119079 GCCAAGGAGGGCACATCTGGAGG - Intronic
1003326919 6:5098982-5099004 GTCACTGTGAGCAGCACTGGGGG - Intergenic
1005165981 6:22921178-22921200 ACTACTGAGGGCAGCTCCAGAGG - Intergenic
1006097310 6:31664136-31664158 GATACTGAGGGCAGCCCAGGAGG - Exonic
1006439422 6:34043809-34043831 TCCACCCAGGGCAGCTCTGGGGG + Intronic
1006933046 6:37698882-37698904 GTGACTTAGGGAAGCTCTGGCGG - Intronic
1007788370 6:44295043-44295065 CCCACAGAGGGCAGTCCTGGAGG + Intronic
1012823923 6:104123996-104124018 GCCCTTGAAGGCAGCTGTGGGGG + Intergenic
1012908540 6:105094345-105094367 GCCACAGAGGGCAGCAAAGGAGG + Intergenic
1017041364 6:150310602-150310624 TCCACTCTGGACAGCTCTGGAGG - Intergenic
1017123262 6:151044054-151044076 GCCATGTAGGGCACCTCTGGGGG + Intronic
1017576314 6:155808595-155808617 GCTACTGAAGGCAGGTGTGGGGG + Intergenic
1017879286 6:158548569-158548591 GCCAGTGAGCGCAGGACTGGAGG - Intronic
1017918464 6:158851779-158851801 GCCACTGAGCCCAGCTTGGGGGG - Intergenic
1018575723 6:165258484-165258506 GCCCTTGAGAGCAGCTGTGGGGG - Intergenic
1018717249 6:166543123-166543145 GGCTTTGAGGGCAGCTTTGGTGG + Intronic
1019147217 6:169983146-169983168 GCCACAGAGCACAGCTGTGGAGG - Intergenic
1019520593 7:1459025-1459047 GCCACTGAGGACAGCCTCGGGGG + Intronic
1021586533 7:22214729-22214751 CACTCAGAGGGCAGCTCTGGAGG - Intronic
1022097307 7:27148868-27148890 GGCACAGAGGGCAGCTCTGCAGG + Intronic
1024975261 7:55108328-55108350 GGCACCCAGGGCAGCTCTGGCGG - Intronic
1025784003 7:64627604-64627626 GCCACTGTGGGCCCCTGTGGGGG + Intergenic
1027050302 7:75017591-75017613 TCCGAGGAGGGCAGCTCTGGAGG - Exonic
1029382734 7:100224060-100224082 TCCGAGGAGGGCAGCTCTGGAGG + Exonic
1030243863 7:107359951-107359973 TCCACTGAGGGCTGCACAGGTGG + Intronic
1030276336 7:107725659-107725681 GCCAGTGAGGCCAGGTGTGGTGG - Intergenic
1033174631 7:139112901-139112923 GCTACTGAGAGCAGCTGAGGTGG - Intergenic
1035180374 7:157085040-157085062 GCCACTGGGAGCAGCCGTGGGGG + Intergenic
1036138079 8:6180612-6180634 GCCTCTGATTGCAGCTCTCGTGG - Intergenic
1036642511 8:10593109-10593131 GCCAGGGAGGGCAGCTCTTGAGG + Intergenic
1036770915 8:11577887-11577909 GGCACTGAGTGCAGGCCTGGAGG + Intergenic
1036793896 8:11741920-11741942 GCATCTGTGGGCAGCGCTGGTGG + Intronic
1039241098 8:35557843-35557865 GCCACTGTGCCCAGCCCTGGAGG - Intronic
1040286526 8:46103318-46103340 CCCACTCAGTGCAGCCCTGGGGG + Intergenic
1040316538 8:46263855-46263877 GCCTCTCAGGACAGCCCTGGTGG - Intergenic
1040915550 8:52564322-52564344 GGCACTTGGGGCAGCGCTGGAGG - Intronic
1041179902 8:55236511-55236533 TCCACTAAGGACAGCTCTGTGGG - Intronic
1042020865 8:64370485-64370507 CGAACTGAGGGCAGCTCAGGGGG + Intergenic
1044796103 8:95899339-95899361 GCCACAGTGGGCAGATCTGGAGG + Intergenic
1044927787 8:97224069-97224091 GATACTGAGGGAGGCTCTGGGGG - Intergenic
1046878003 8:119277513-119277535 GCCCTTGAGAGCAGCTGTGGGGG - Intergenic
1047374011 8:124279025-124279047 TCCACCGAGGGGGGCTCTGGAGG - Intergenic
1048329729 8:133463573-133463595 GTCCCTGAGGGAAGCTATGGGGG - Intronic
1049325200 8:142017988-142018010 GCCATGGAGGGCAGCTGGGGTGG - Intergenic
1049363333 8:142224712-142224734 GCCAGGGAGGGGTGCTCTGGGGG + Intronic
1049548067 8:143243850-143243872 GCCTCTGTGGGAAGCTCTGCAGG + Intergenic
1049865738 8:144934343-144934365 GGCACGTAGGGCAGCTCTGTGGG - Intronic
1049891429 9:73642-73664 GAAACTGAGGGCAGCTCGGGCGG - Intergenic
1052879569 9:33592969-33592991 GCCCATGAGGGCAGCTGTGGGGG + Intergenic
1053496412 9:38551264-38551286 GCCCATGAGGGCAGCTGTGGGGG - Intronic
1053663458 9:40300640-40300662 GCCCATGAGGGCAGCTGCGGGGG + Intronic
1053663961 9:40304537-40304559 GCCCATGAGGGCAGCTGCGGGGG + Intronic
1053664928 9:40310743-40310765 GCCCATGAGGGCAGCTGCGGGGG + Intronic
1053665369 9:40313846-40313868 GCCCATGAGGGCAGCTGTGGGGG + Intronic
1053732852 9:41074716-41074738 GAAACTGAGGGCACCTCGGGCGG - Intergenic
1053913966 9:42931181-42931203 GCCCATGAGGGCAGCTGTGGGGG + Intergenic
1053914503 9:42935793-42935815 GCCCATGAGGGCAGCTGCGGGGG + Intergenic
1053914957 9:42938893-42938915 GCCCATGAGGGCAGCTGTGGGGG + Intergenic
1054376087 9:64450771-64450793 GCCCATGAGGGCAGCTGCGGGGG + Intergenic
1054376520 9:64453876-64453898 GCCCATGAGGGCAGCTGTGGGGG + Intergenic
1054519246 9:66062438-66062460 GCCCATGAGGGCAGCTGTGGGGG - Intergenic
1054519686 9:66065541-66065563 GCCCATGAGGGCAGCTGCGGGGG - Intergenic
1054520653 9:66071748-66071770 GCCCATGAGGGCAGCTGCGGGGG - Intergenic
1054521156 9:66075645-66075667 GCCCATGAGGGCAGCTGCGGGGG - Intergenic
1054695578 9:68356838-68356860 GAAACTGAGGGCAGCTCGGGCGG + Intronic
1056974649 9:91240747-91240769 GCCACTGAGAGAGTCTCTGGGGG + Intronic
1057300217 9:93874220-93874242 GCCTATGAGAGCAGCCCTGGGGG - Intergenic
1057676327 9:97138803-97138825 GCCCATGAGGGCAGCTGTGGGGG - Intergenic
1058454669 9:105128022-105128044 GCCAATTAGGGCAGCTGTAGAGG - Intergenic
1058910709 9:109517782-109517804 GCCACAGAAGGCAGCTGTGCAGG - Intergenic
1059867075 9:118527261-118527283 GCCACAGAGGGCTGTTCTGTAGG - Intergenic
1059868580 9:118545494-118545516 GCCAGTGGGGGCTGCTCTGATGG - Intergenic
1061142871 9:128779226-128779248 GCCAGTGAGGGCAGATCACGAGG + Intergenic
1061300619 9:129702906-129702928 GCCTCTGAGGGCAGCTGTTCTGG - Intronic
1061887409 9:133598867-133598889 GCCACTGAAAGGAGCCCTGGGGG - Intergenic
1061946943 9:133913811-133913833 GCCATTGGGGGCAGCCATGGTGG + Intronic
1062273321 9:135719587-135719609 GCCACTGAAGCCACCACTGGAGG + Intronic
1062339105 9:136086054-136086076 GCCACGCAGGGCAGCTCCGACGG + Intronic
1062552644 9:137096969-137096991 GCCAGTGAGGGCTGCTGTGCAGG + Intronic
1062590755 9:137273454-137273476 GCCGCTGAAGGCAGCACTGCTGG - Exonic
1062740055 9:138167070-138167092 GCCCATGAGAGCAGCTGTGGGGG + Intergenic
1203370331 Un_KI270442v1:297789-297811 GCCCATGAGAGCAGCTGTGGGGG - Intergenic
1203545552 Un_KI270743v1:125791-125813 GCCTATGAGGGCAGCCATGGGGG + Intergenic
1203545829 Un_KI270743v1:127436-127458 GCCAATGAGGGCAGCTGTAGGGG - Intergenic
1187533245 X:20115441-20115463 GCCACGGAGGGTCGTTCTGGTGG + Intronic
1187874540 X:23793300-23793322 GCCATTGATGTCAGGTCTGGGGG - Intergenic
1188490936 X:30738588-30738610 TCTACTGAGGGCAGTTCTGTTGG + Intergenic
1189417986 X:40831786-40831808 GTCCCTGAGGGCAGCTGTGCCGG + Intergenic
1190325338 X:49203891-49203913 GCCACTGAGGCCAGATCAGGTGG - Intergenic
1192235932 X:69296107-69296129 CCCACTGAGGCCAGCCCTGGAGG + Intergenic
1192559222 X:72114626-72114648 TCAACTCAGGGCAGCTCTGTGGG - Intergenic
1192937022 X:75870937-75870959 GCCCTTGAGAGCAGCTGTGGTGG + Intergenic
1197532381 X:127645654-127645676 GCCAAGGAGGGCAGATCAGGAGG + Intergenic
1197640230 X:128959403-128959425 GCCCTTGAGAGCAGCTGTGGTGG - Intergenic
1198567220 X:137916738-137916760 TGCAGTGAGGGCAGCTCTGGTGG + Intergenic
1199980491 X:152917890-152917912 GCCACTCAGAGCAGCTGTGTAGG - Intronic
1200181901 X:154155779-154155801 GCAGCTGAGGGCAGCTTTGGTGG - Intronic
1200187550 X:154192893-154192915 GCAGCTGAGGGCAGCTTTGGTGG - Intergenic
1200193200 X:154230033-154230055 GCAGCTGAGGGCAGCTTTGGTGG - Intronic
1200198955 X:154267837-154267859 GCAGCTGAGGGCAGCTTTGGTGG - Intronic
1200211043 X:154346693-154346715 GCCCCTGAGGACAGCCCTGGCGG - Intergenic
1200219809 X:154385399-154385421 GCCCCTGAGGACAGCCCTGGCGG + Intergenic
1200239495 X:154486402-154486424 GCCCCCGAGGGCAGCTCTCCCGG + Intronic
1201515875 Y:14818408-14818430 GCCACAGATGGCTGCTCTGAAGG - Intronic
1201620585 Y:15952686-15952708 GCCACTAAGGCCAGATGTGGTGG - Intergenic