ID: 1151694065

View in Genome Browser
Species Human (GRCh38)
Location 17:75705184-75705206
Sequence CGAGCCACTGAGGGCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151694065_1151694073 10 Left 1151694065 17:75705184-75705206 CCAGAGCTGCCCTCAGTGGCTCG 0: 1
1: 0
2: 1
3: 24
4: 253
Right 1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1151694065_1151694070 -3 Left 1151694065 17:75705184-75705206 CCAGAGCTGCCCTCAGTGGCTCG 0: 1
1: 0
2: 1
3: 24
4: 253
Right 1151694070 17:75705204-75705226 TCGCCTGGGTGCTACCTATTAGG 0: 1
1: 0
2: 0
3: 1
4: 33
1151694065_1151694072 9 Left 1151694065 17:75705184-75705206 CCAGAGCTGCCCTCAGTGGCTCG 0: 1
1: 0
2: 1
3: 24
4: 253
Right 1151694072 17:75705216-75705238 TACCTATTAGGTCCCACGTTAGG 0: 1
1: 0
2: 0
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151694065 Original CRISPR CGAGCCACTGAGGGCAGCTC TGG (reversed) Intronic
900681887 1:3920887-3920909 TGAGCCACTGTGCCCAGCTCTGG + Intergenic
903356111 1:22748661-22748683 TGAGCCACTGCGCCCAGCTCTGG + Intronic
903972350 1:27127282-27127304 TGAGCCACTGAGCCCAGCCCAGG + Intronic
904609739 1:31718919-31718941 TGAGCCCCTGAGGGCAGAACAGG - Intergenic
905181671 1:36171130-36171152 AGAGCCCCTCAGGGCAGGTCGGG + Exonic
905218711 1:36429056-36429078 CTCGCCACTGTGGCCAGCTCTGG + Intronic
905490526 1:38340032-38340054 CGAGCCACTGTGGCCAGAGCAGG + Intergenic
905620167 1:39438499-39438521 TGAGCCACTGCGGGTGGCTCCGG - Intronic
905763873 1:40584006-40584028 TGAGCCACTGCGCCCAGCTCTGG - Intergenic
905811003 1:40913180-40913202 TGAGCCACTGAGCCCAGCTGAGG - Intergenic
906421254 1:45669432-45669454 TGAGCCACTGTGGCCAGCCCAGG + Intronic
906529643 1:46516238-46516260 CAGGCCACTGCGGGCATCTCTGG - Intergenic
907879032 1:58526578-58526600 CTAGCCATAGAGAGCAGCTCTGG - Intronic
909937093 1:81564492-81564514 CAAGGCACTGAGGGAGGCTCCGG - Intronic
910281445 1:85505986-85506008 CCAGACACTGTGAGCAGCTCAGG + Intronic
911598831 1:99825679-99825701 CCAGCTACTCAGGGCAGCTGAGG + Intergenic
912563296 1:110565724-110565746 AGAGCCTCTGTGGCCAGCTCTGG + Intergenic
918462927 1:184794978-184795000 CACTCCTCTGAGGGCAGCTCTGG + Exonic
919718725 1:200809452-200809474 TGAGCCACTGAGCCCGGCTCAGG - Intronic
919771114 1:201159245-201159267 CTAGCCACAGATGGCAGGTCAGG + Intronic
919805999 1:201381397-201381419 CCAGCCACTGAGGCCCGCTCTGG - Exonic
921133458 1:212239369-212239391 GGAGCCAGGGAGGGCGGCTCTGG + Intergenic
924616306 1:245614601-245614623 GCAGCCACTGGAGGCAGCTCAGG - Intronic
1063162483 10:3429333-3429355 TGAGCCACTGAGCCCAGCTGAGG - Intergenic
1065555485 10:26911362-26911384 CTATCCACTGAGGTGAGCTCTGG + Intergenic
1065797939 10:29324139-29324161 GGAGACACAGAGGGCTGCTCCGG + Intergenic
1067746993 10:48943470-48943492 CGAACACCTGAGGGCAGCTGTGG - Intronic
1069211680 10:65769614-65769636 TGAGCCACTGTGGCCAGCCCTGG - Intergenic
1070786075 10:79162886-79162908 GGAGCAACTGAGAGCAGCTGGGG + Intronic
1071504068 10:86222370-86222392 CAAGGCTCTGAGGGCAGCTAAGG - Intronic
1072609070 10:97004652-97004674 CGTACCCCTGAGGGCAGCTGGGG + Intronic
1073095789 10:100978938-100978960 CGTGCCACTGAGGAGGGCTCTGG + Exonic
1074493540 10:113959499-113959521 CGTGACACTGGGGGCAGATCAGG + Intergenic
1075083857 10:119401084-119401106 TGAAACACTGAGGGGAGCTCTGG + Intronic
1075263830 10:120984229-120984251 TGAGGGACAGAGGGCAGCTCTGG + Intergenic
1075995037 10:126870210-126870232 TGAGCCACTGTGCCCAGCTCTGG - Intergenic
1076139362 10:128067650-128067672 AGAGGCTCTGAGGGCAGGTCTGG + Intronic
1077228960 11:1450254-1450276 CGGGCCACGAAGGGCGGCTCGGG - Intronic
1077430586 11:2514084-2514106 CCAGGAGCTGAGGGCAGCTCAGG - Intronic
1078932296 11:15921758-15921780 AGAGCCACTGATGCCAGCTCAGG - Intergenic
1081592772 11:44436388-44436410 CCAGCCCTTGAGGGCAGTTCTGG - Intergenic
1081786452 11:45751161-45751183 GGACCCCCTGAGGGCAGCTCAGG + Intergenic
1082789544 11:57337992-57338014 CATGCCACTGGGGGCAACTCAGG + Intergenic
1083250497 11:61463805-61463827 CGAGCCACTGCGTCCAGCTGTGG + Intronic
1083627829 11:64080853-64080875 ACAGCCACTGATGGCTGCTCAGG - Intronic
1084171067 11:67401375-67401397 CGAGGCGCTGAGGGTAGCTGGGG - Intronic
1084959379 11:72708345-72708367 CGAGCCACTCATGCCAGCTGGGG + Intronic
1085038448 11:73313258-73313280 AGTCCCAGTGAGGGCAGCTCCGG + Intronic
1089110786 11:116054272-116054294 TGAGCCACTCTGGGGAGCTCAGG + Intergenic
1089594350 11:119567775-119567797 TGAGCCACTGATGACAGCTTTGG + Intergenic
1091121814 11:133063843-133063865 TGAGCCACTGAGCCCAGCCCCGG + Intronic
1093189418 12:16057566-16057588 CGAGAAACCGAGGGCAGCGCCGG - Intergenic
1094610971 12:31995392-31995414 TGAGCCACTGTGCCCAGCTCTGG - Intergenic
1096481934 12:51947971-51947993 AGAGCCAATGAGGGCCACTCAGG - Intergenic
1096611488 12:52805027-52805049 AGAGGCACGGAGGGCTGCTCAGG + Intergenic
1096769751 12:53927669-53927691 CCCGCCACTGTGCGCAGCTCGGG - Intergenic
1103883896 12:124186806-124186828 TCAGCCACTGAGGCCAGCTCTGG - Intronic
1104585577 12:130045578-130045600 GGAGCCCCGGAGGGCAGCCCAGG - Intergenic
1104958406 12:132476925-132476947 GGAAGCACTGAGGGCAGCTCAGG - Intergenic
1105260293 13:18774157-18774179 CCAGCCCATGAGGGCAGCTGTGG - Intergenic
1105263496 13:18797041-18797063 CTAGCCAATGAGGGCAGCTGTGG - Intergenic
1106248260 13:27966497-27966519 GGAGCCACAGAGGACACCTCCGG + Intronic
1106417978 13:29561744-29561766 AGAGCCTCAGAGGGCAGTTCTGG - Intronic
1111536384 13:89607353-89607375 TGAGCCACTGAGCCCAGCTGTGG - Intergenic
1111871184 13:93834722-93834744 CAAACAACTGAGGGTAGCTCAGG - Intronic
1111999327 13:95195439-95195461 AGAGCCTCTGAAGGCAGCCCTGG + Intronic
1112344439 13:98577506-98577528 CGAGCCCCTGAGGGCAGGATCGG + Intronic
1113775703 13:112943720-112943742 CGAGCCACCGCAGGCTGCTCGGG - Intronic
1117844454 14:59896327-59896349 AGAGACACTGAGGGCAGTTTAGG + Intergenic
1120809833 14:88792464-88792486 CGAGCCGCAGGTGGCAGCTCGGG + Exonic
1122320569 14:100852854-100852876 TGAGCCAATGAGAGCAGCTCTGG + Intergenic
1202835349 14_GL000009v2_random:74081-74103 CCAGCCCATGAGGGCAGCTGTGG + Intergenic
1126131127 15:45342728-45342750 TGAGCCACTGCGTCCAGCTCCGG - Intergenic
1126179555 15:45771639-45771661 AGAGGCACTGAGGGCAGGTTTGG - Intergenic
1126815307 15:52448120-52448142 CCAGCCCCTGAGAGCAGCTGTGG + Intronic
1127501333 15:59556767-59556789 TGAGTCACTGCGCGCAGCTCTGG - Intergenic
1127698584 15:61475172-61475194 CCAGCCACTCAGGGCCACTCTGG - Intergenic
1128540327 15:68523940-68523962 TGAGCCACTGAGGCCAGCCTTGG - Intergenic
1129765641 15:78164633-78164655 TGAGCCACTGAGCCCAGCTGTGG + Intronic
1131650170 15:94389337-94389359 GGACACACTGAGGGCAGCCCAGG + Intronic
1132292607 15:100713931-100713953 CAAACCACAGTGGGCAGCTCAGG + Intergenic
1132511035 16:341455-341477 CGAGAAATTGAGCGCAGCTCCGG - Intronic
1132820934 16:1870153-1870175 TGAGCCACTGAGCCCAGCCCGGG + Intronic
1132905301 16:2279358-2279380 CCAGGCTCTGAGAGCAGCTCTGG - Intronic
1136074617 16:27808368-27808390 TGAGCCACTGTGCTCAGCTCTGG + Intronic
1137332648 16:47514416-47514438 CGAGCCACTGATGGAAGCCCTGG + Intronic
1138631200 16:58295467-58295489 CCAGCCACTGTGAGCAGCTTTGG + Intronic
1139500114 16:67356206-67356228 TGAGCCACTGAGGGTGGCTGTGG - Intronic
1139517062 16:67458384-67458406 CCAGCCTCTGAGGGCAGCCAAGG + Intronic
1139518237 16:67464524-67464546 CCAGCCCCTGAGGGCCACTCAGG + Intronic
1139590223 16:67929137-67929159 CTACCCACTGAAGGCAGCTGTGG - Exonic
1139901749 16:70333592-70333614 CCAGCCACTGATGCCAGCCCTGG + Exonic
1139906839 16:70371996-70372018 CCAGCCACTGATGCCAGCCCTGG + Exonic
1140043496 16:71424884-71424906 AGAGCAGCTGAGGGCAGCTTGGG + Intergenic
1140406861 16:74717033-74717055 CAAGGCACTGAGGGCAACTGAGG + Intronic
1141442834 16:84040571-84040593 CAAGCCACAGAGGGCAGGTGGGG - Intronic
1142292095 16:89197885-89197907 CCAGCCACAGAGTGCAGCACAGG - Intronic
1142864503 17:2782423-2782445 CAAGCCACTGAGGGCGGGTCAGG - Intronic
1142897457 17:2991151-2991173 AGTCCCACTGAGGGCAGCTATGG + Intronic
1142969660 17:3602836-3602858 TGAGCCACTGAGGCCGGCTGGGG - Intergenic
1144699275 17:17326293-17326315 CCAGCCAGTGAGGCCTGCTCCGG + Intronic
1144847194 17:18225987-18226009 CGAGTCTCTGCGGGCCGCTCTGG + Intronic
1146337745 17:31989890-31989912 CGAGCCACTGTGCCCAGCCCAGG + Intronic
1150808415 17:68337180-68337202 GGAAACACTGAGGGCAGCCCTGG + Intronic
1151694065 17:75705184-75705206 CGAGCCACTGAGGGCAGCTCTGG - Intronic
1151697300 17:75724162-75724184 TAAGCCACTGCGGGCAGCTGTGG + Intronic
1151721835 17:75861301-75861323 CGTGCCTCTGAAGGGAGCTCAGG + Intergenic
1153561567 18:6376453-6376475 TGAGCCACTGTGCGCAGCTGGGG - Intronic
1153586750 18:6629099-6629121 TGAGCCACTGAGCCCAGCTGGGG + Intergenic
1153951276 18:10059810-10059832 CGAGCCCCTGTGGGCAGGGCCGG + Intergenic
1154425726 18:14270638-14270660 CCAGCCCATGAGGGCAGCTGTGG + Intergenic
1154427537 18:14283693-14283715 CTAGCCAATGAGGGCAGCTGTGG + Intergenic
1154428949 18:14293718-14293740 CGAGCCCCTGAGGGCAGCCGTGG + Intergenic
1154430265 18:14303233-14303255 CTAGCCAATGAGGGCAGCTGTGG + Intergenic
1154431224 18:14310060-14310082 CAAGCCCCTGAGGGCAGCCTTGG + Intergenic
1154433415 18:14325879-14325901 CCAGCCCATGAGGGCAGCTGTGG + Intergenic
1154433900 18:14329366-14329388 CGAGCCCCTGAGGGCAGCCGTGG + Intergenic
1156475198 18:37401627-37401649 TGAGCCACAGAGCCCAGCTCAGG + Intronic
1157818258 18:50746788-50746810 TGAGCCACCGCGGCCAGCTCAGG + Intergenic
1158799730 18:60892225-60892247 GGAGCCACTGAGGGAAGTCCAGG + Intergenic
1159892269 18:73964102-73964124 CCAGCCAGTGAAGGCAGCTGTGG - Intergenic
1160804923 19:988428-988450 CAAACCACAGAGGGCAGCTCTGG - Intronic
1160880744 19:1318887-1318909 AGGGCCACTGTGGGCGGCTCAGG + Intergenic
1164416134 19:28047906-28047928 GGAGCCACTGAGGATAGCTGTGG + Intergenic
1165859737 19:38901774-38901796 TGAGCCACTGTGTGCAGCTGTGG + Intronic
1166231116 19:41426385-41426407 GCAGCCACTGTGGGAAGCTCCGG + Exonic
1166718211 19:44982611-44982633 AGAGCCCCAGAGGGCAGCGCTGG - Intronic
1168601529 19:57722618-57722640 TGAGCCACTGCGCCCAGCTCAGG - Intronic
1202637275 1_KI270706v1_random:53268-53290 CCAGCCCATGAGGGCAGCTGTGG - Intergenic
925072697 2:983611-983633 GGAGCCACTGAGTGCAGAACAGG - Intronic
925276570 2:2653269-2653291 CAAGACACTGAAGGCAGCTTTGG + Intergenic
926048511 2:9727887-9727909 TGAGCCACTGCGTCCAGCTCAGG + Intergenic
926220917 2:10934935-10934957 TGAGCCCCTGAGGGCAGGGCTGG + Intergenic
926802032 2:16666881-16666903 AGAGCCTCTGTGGGCAGTTCAGG - Intergenic
927201045 2:20578256-20578278 CCCGCCTCTGAGGGCAGCCCTGG - Intronic
927504925 2:23606711-23606733 GGGGCATCTGAGGGCAGCTCAGG + Intronic
929017731 2:37515592-37515614 TGAGCCACTGTGCCCAGCTCTGG + Intergenic
929115406 2:38439907-38439929 ATAGCCTCTGAGGACAGCTCTGG - Intergenic
929407995 2:41665326-41665348 CGGGACAGTGAGGGCAGCTGAGG + Intergenic
931282316 2:60804901-60804923 CAAGCCACTGATGGCAGCAGTGG - Intergenic
932188182 2:69716438-69716460 CGAGGAACTGCGAGCAGCTCAGG + Intronic
932447173 2:71788042-71788064 CAAGACACTGAGAGCATCTCAGG + Intergenic
932688811 2:73895116-73895138 TGAGTCTGTGAGGGCAGCTCCGG + Intronic
933161986 2:79035681-79035703 AGAGCCACTGAGCCCAGCCCTGG - Intergenic
934491764 2:94766004-94766026 CCAGCCCATGAGGGCAGCTGTGG - Intergenic
936561262 2:113541694-113541716 GGAGAAACTGAGGGCAGCTCGGG + Intergenic
938090982 2:128434622-128434644 CGAGCAACAGAAGGCAGCCCAGG - Intergenic
941178903 2:162235033-162235055 CGAGAAACTGAGGGCAGCCTCGG - Intronic
941431821 2:165422753-165422775 CCAGCCAATGAGAGCAGCTGTGG - Intergenic
944912184 2:204321851-204321873 CCAGGCACTAAGGGCATCTCTGG + Intergenic
945988347 2:216372172-216372194 CGAGCCAGTGGGGGCAGCGGCGG - Intergenic
946189002 2:217997375-217997397 CCAGCCACTAAAGGCAGTTCAGG - Intronic
946357536 2:219197712-219197734 TGAGCCACTGTGCCCAGCTCAGG - Intronic
947437041 2:230081770-230081792 TGAGCCACTGTGCCCAGCTCAGG + Intergenic
947885820 2:233570137-233570159 TGAGCCACTGCGCACAGCTCAGG + Intergenic
947927772 2:233936665-233936687 TGAGGCACTGAGGCCAACTCAGG + Intronic
948383512 2:237567469-237567491 GCAGCCACTCAGGGCAGCTTGGG - Intergenic
948768151 2:240233805-240233827 CGAGGCACTGTGGGCAGGGCCGG - Intergenic
948918243 2:241049127-241049149 CCAGCCACTGTGAGTAGCTCGGG + Exonic
949069480 2:242015605-242015627 TGAGCAACTCAGGGCAGCCCAGG + Intergenic
1171113683 20:22506018-22506040 CCAGCTAGTGAGGACAGCTCAGG + Intergenic
1173485301 20:43436698-43436720 TGAGCCACTGAGCCCAGCCCTGG - Intergenic
1175067945 20:56306001-56306023 CTATGCACTGAGGGCAGCACAGG + Intergenic
1175784977 20:61706652-61706674 GGTGCCACTGTGTGCAGCTCGGG - Intronic
1176843133 21:13856357-13856379 CGAGCCCATGAGGCCAGCTGTGG - Intergenic
1176843628 21:13859871-13859893 CCAGCCCATGAGGGCAGCTGTGG - Intergenic
1176846300 21:13879191-13879213 CCAGCCCATGAGGGCAGCTGTGG - Intergenic
1176849037 21:13898733-13898755 CCAGCCCATGAGGGCAGCTGTGG - Intergenic
1176870283 21:14078468-14078490 GGAGACACGGAGGGCAACTCAGG + Intergenic
1180126186 21:45791897-45791919 CCAGCTCCTGAGTGCAGCTCAGG - Intronic
1180937697 22:19636996-19637018 GGACCCACAGAGGGCTGCTCGGG - Intergenic
1182132838 22:27870680-27870702 GGAGGCACTGAGGGTAGCACTGG - Intronic
1182431072 22:30299207-30299229 CATTCCACTGAGGGCTGCTCAGG + Intronic
1182476605 22:30579960-30579982 CGAGTCACAGAGGGCAACTCAGG + Intronic
1183479761 22:38057125-38057147 CGGGCCCCTGAGTGCAGCTGAGG + Intronic
1184662099 22:45970200-45970222 GGAGCTACTGAGGGCAAGTCAGG + Intronic
1185376253 22:50483795-50483817 AGAGCCAGGGAGGGCAGCCCAGG + Exonic
949841109 3:8321006-8321028 TGAGTTACTGAGGGCAGATCAGG - Intergenic
949947617 3:9202808-9202830 TCAGCCACTGTGGGCAGCTGGGG - Intronic
951024342 3:17814081-17814103 TGAGCCACTGTGCCCAGCTCAGG - Intronic
951902505 3:27670716-27670738 TGACTCACTGAAGGCAGCTCAGG + Intergenic
953369431 3:42374922-42374944 CCAGCCACTCAGGGGAGCTGAGG - Intergenic
953627328 3:44581346-44581368 CGGGGCGCTGAGGGCAGCTGTGG - Intronic
956797980 3:72733135-72733157 CCAGCCTGGGAGGGCAGCTCAGG - Intergenic
961059375 3:123815506-123815528 CCTGCCAGTGGGGGCAGCTCTGG + Intronic
961595040 3:128009292-128009314 TGAGCCACTGAGGGCAATGCTGG + Intergenic
965488307 3:169306396-169306418 TGAGCCACTGAGCCCAGCTGTGG - Intronic
967150932 3:186649752-186649774 TGAGCCACTGCGCCCAGCTCAGG + Intronic
968286620 3:197512860-197512882 CTAGCCACTGACAGCAGCCCTGG + Intronic
969503556 4:7569932-7569954 AGAGACACTCAGGGCTGCTCTGG + Intronic
972479271 4:39482599-39482621 CGAGCCACTGCGCCCAGCTGGGG + Intergenic
973367089 4:49216564-49216586 CCAGCCCATGAGGGCAGCTGTGG - Intergenic
973393527 4:49575797-49575819 CCAGCCCATGAGGGCAGCTGTGG + Intergenic
973758842 4:54099653-54099675 CCAGTCCCTGAGCGCAGCTCTGG - Intronic
976301722 4:83521829-83521851 TGAGCCACTGTGCCCAGCTCTGG + Intronic
984837967 4:184040026-184040048 GAAGCCAATGAGGGCAGCCCAGG + Intergenic
985126361 4:186698688-186698710 GGAGCCAGTGAGGGAAGCACGGG + Intronic
1202764594 4_GL000008v2_random:139125-139147 CCAGCCCATGAGGGCAGCTGTGG - Intergenic
986370631 5:7077193-7077215 GGAGCCACTGAGGACAGAGCCGG - Intergenic
988155039 5:27439618-27439640 CGAGAAACTGAGGGCAGCGCCGG + Intergenic
991868609 5:71088236-71088258 TGAGCCACTGTGCCCAGCTCTGG + Intergenic
992223478 5:74595935-74595957 TGAGCCACTGAGCCCAGCCCAGG - Intergenic
993564927 5:89461972-89461994 AGAGCCACTAAGGCCAGCACAGG + Intergenic
995501649 5:112813632-112813654 CGAGCCAATGAGCCCAGCTATGG - Intronic
996517902 5:124394016-124394038 CGAGTAACTGAGGGCAGTCCAGG - Intergenic
997512089 5:134460874-134460896 GGAGCCACTTAGGGCTGCCCAGG + Intergenic
998424025 5:142012239-142012261 GGCGCCACTGGGGGCAGATCTGG + Exonic
1000001158 5:157140553-157140575 TGAGGTACTGAGGGCAGCTGTGG + Intronic
1002163991 5:177333290-177333312 CTAGGCACAGAGGGCAGCTTTGG + Intronic
1002444735 5:179282945-179282967 TGAGCCACTGTGAGCAACTCTGG + Intronic
1002570132 5:180135508-180135530 GGCGCCACTGTGGGCAGCACTGG - Intronic
1004134342 6:12952009-12952031 CGAGCCAGTGAGCACAGCCCTGG + Intronic
1006334559 6:33413760-33413782 GGAACCACTGCAGGCAGCTCCGG - Exonic
1006349916 6:33513407-33513429 GCAGCCCCAGAGGGCAGCTCAGG + Intergenic
1006795593 6:36730546-36730568 CTCGCCACTGAGGTCAGCTTAGG + Intronic
1007654698 6:43445145-43445167 GGAGCCATTGGGGGCAGCTTTGG - Exonic
1011186893 6:84687537-84687559 CGAGCCTCACAGGGCGGCTCTGG - Intronic
1015390391 6:132675145-132675167 CGAGCAGCTGATGGGAGCTCAGG - Intergenic
1017918467 6:158851782-158851804 TGAGCCACTGAGCCCAGCTTGGG - Intergenic
1018731964 6:166658163-166658185 TGAGCCACTGTGGCCAGCCCAGG + Intronic
1018905515 6:168073342-168073364 TGAGCCCCTGAGGGCAGGTGTGG - Intronic
1018997655 6:168722569-168722591 CCAGCCATGGAGGTCAGCTCTGG - Intergenic
1019734725 7:2645051-2645073 AGTGCCAATGAGGGCAGCGCAGG + Intronic
1019742201 7:2680521-2680543 CCAGCCACAGAGGGGATCTCAGG - Intronic
1019887279 7:3916206-3916228 AGATCCACTGAGGGCTGGTCAGG - Intronic
1022116024 7:27261335-27261357 CAAGCCACCGAGGGAAGTTCTGG + Intergenic
1022207678 7:28180008-28180030 CGAGGCGCTGAGGGCAGCGGGGG - Intronic
1026524387 7:71141611-71141633 CGAGACACTTAGAGCAGCCCTGG + Intronic
1029143416 7:98428503-98428525 TGAGCCACTGGGCTCAGCTCAGG + Intergenic
1029574706 7:101395819-101395841 CGACCCGCTGAGGGCAGCTCAGG + Intronic
1030213281 7:107017735-107017757 GGAGCCCCTCAGGCCAGCTCAGG + Intergenic
1031645295 7:124218802-124218824 CCATCCACTTAGGGAAGCTCTGG - Intergenic
1033553694 7:142470133-142470155 CGGGCCACTTAGGGCCACTCGGG - Intergenic
1034447242 7:151119952-151119974 AGGGCTGCTGAGGGCAGCTCCGG - Intronic
1035535243 8:386126-386148 CCTGCCCCTGGGGGCAGCTCAGG - Intergenic
1038428212 8:27479121-27479143 GGTGCCACTGAGGACAGCCCAGG + Exonic
1038739700 8:30206511-30206533 GGAGACTCTGGGGGCAGCTCTGG - Intergenic
1038794761 8:30700049-30700071 TGAGTCACTGAGGTCAGGTCAGG + Intronic
1039004284 8:33016597-33016619 CGAGCTTCTCTGGGCAGCTCAGG - Intergenic
1042020862 8:64370482-64370504 CGGCGAACTGAGGGCAGCTCAGG + Intergenic
1042370792 8:67988515-67988537 TGAGCCCCTGATGGAAGCTCAGG + Intronic
1043472618 8:80578104-80578126 CGGGGGACTGAGGGCTGCTCTGG + Intergenic
1047304424 8:123641492-123641514 GCAGACACTGAGGGCAGCCCTGG + Intergenic
1048968112 8:139628567-139628589 CAGGGCTCTGAGGGCAGCTCAGG - Intronic
1049260588 8:141636936-141636958 AGGGCCACAGAGGGCAGCACCGG - Intergenic
1049473647 8:142787171-142787193 CGAGGCAGGGAGGGCAGCTGGGG + Intergenic
1049616686 8:143578585-143578607 CGAGCGACTGGGGGCACCTCTGG - Exonic
1049891430 9:73645-73667 GGAGAAACTGAGGGCAGCTCGGG - Intergenic
1052341153 9:27365661-27365683 AGAGCCACTGGTGGTAGCTCAGG - Intronic
1052878700 9:33586766-33586788 CCAGCCATTGAGGGCAGCTTTGG + Intergenic
1052879131 9:33589853-33589875 CCAGCCCATGAGGGCAGCTTTGG + Intergenic
1052879566 9:33592966-33592988 CCAGCCCATGAGGGCAGCTGTGG + Intergenic
1053496415 9:38551267-38551289 CCAGCCCATGAGGGCAGCTGTGG - Intronic
1053496845 9:38554366-38554388 CCAGCCCATGAGGGCAGCTTTGG - Intronic
1053497276 9:38557443-38557465 CCAGCCATTGAGGGCAGCTTTGG - Intronic
1053663958 9:40304534-40304556 CCAGCCCATGAGGGCAGCTGCGG + Intronic
1053665366 9:40313843-40313865 CCAGCCCATGAGGGCAGCTGTGG + Intronic
1053732853 9:41074719-41074741 GGAGAAACTGAGGGCACCTCGGG - Intergenic
1053914500 9:42935790-42935812 CCAGCCCATGAGGGCAGCTGCGG + Intergenic
1053914954 9:42938890-42938912 CCAGCCCATGAGGGCAGCTGTGG + Intergenic
1053915823 9:42944896-42944918 CCAGCCCATGAGGGCAGCTGTGG + Intergenic
1054376084 9:64450768-64450790 CCAGCCCATGAGGGCAGCTGCGG + Intergenic
1054376517 9:64453873-64453895 CCAGCCCATGAGGGCAGCTGTGG + Intergenic
1054519249 9:66062441-66062463 CCAGCCCATGAGGGCAGCTGTGG - Intergenic
1054520656 9:66071751-66071773 CCAGCCCATGAGGGCAGCTGCGG - Intergenic
1054695577 9:68356835-68356857 GGAGAAACTGAGGGCAGCTCGGG + Intronic
1056501475 9:87213982-87214004 CCAGCCACTGAGAGCAAGTCAGG + Intergenic
1057273372 9:93663360-93663382 CGGGCCACTGCGGGGTGCTCAGG - Intronic
1057676330 9:97138806-97138828 CCAGCCCATGAGGGCAGCTGTGG - Intergenic
1057676755 9:97141924-97141946 CCAGCCCATGAGGGCAGCTTTGG - Intergenic
1061944585 9:133901633-133901655 GGAGCCCCTCAGGGCAGCTCCGG - Intronic
1062322932 9:135999141-135999163 CCCTCCACTGTGGGCAGCTCTGG + Intergenic
1062367663 9:136218915-136218937 CCAGCCAGTGAGGGCCGCTCAGG - Intronic
1203545343 Un_KI270743v1:124012-124034 CCAGCCCATGAGGGCAGCTGTGG - Intergenic
1187442973 X:19336531-19336553 TGTGCCACTGTGTGCAGCTCGGG + Intergenic
1190325339 X:49203894-49203916 GAAGCCACTGAGGCCAGATCAGG - Intergenic
1198258241 X:134944013-134944035 CCAGGCAGTGAGGCCAGCTCAGG + Intergenic
1200211044 X:154346696-154346718 CGGGCCCCTGAGGACAGCCCTGG - Intergenic
1200219808 X:154385396-154385418 CGGGCCCCTGAGGACAGCCCTGG + Intergenic