ID: 1151694069

View in Genome Browser
Species Human (GRCh38)
Location 17:75705194-75705216
Sequence AGCACCCAGGCGAGCCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 932
Summary {0: 1, 1: 0, 2: 4, 3: 165, 4: 762}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151694069_1151694073 0 Left 1151694069 17:75705194-75705216 CCTCAGTGGCTCGCCTGGGTGCT 0: 1
1: 0
2: 4
3: 165
4: 762
Right 1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1151694069_1151694072 -1 Left 1151694069 17:75705194-75705216 CCTCAGTGGCTCGCCTGGGTGCT 0: 1
1: 0
2: 4
3: 165
4: 762
Right 1151694072 17:75705216-75705238 TACCTATTAGGTCCCACGTTAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1151694069_1151694079 24 Left 1151694069 17:75705194-75705216 CCTCAGTGGCTCGCCTGGGTGCT 0: 1
1: 0
2: 4
3: 165
4: 762
Right 1151694079 17:75705241-75705263 CCTGAGCACCACTTGTTCCCTGG 0: 1
1: 1
2: 0
3: 18
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151694069 Original CRISPR AGCACCCAGGCGAGCCACTG AGG (reversed) Intronic
900113271 1:1018537-1018559 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
900130989 1:1087188-1087210 CGCACCCGGGCCAGCAACTGTGG + Exonic
900344863 1:2205732-2205754 AGTCCCCGGGCGCGCCACTGAGG - Intronic
900525321 1:3125666-3125688 AGCTCCTGGGAGAGCCACTGAGG - Intronic
901601474 1:10426585-10426607 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
901783346 1:11608892-11608914 AGCACCCGGGCCAGCGGCTGTGG + Intergenic
902032131 1:13430691-13430713 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
902870658 1:19312000-19312022 AGCACCGAGGCGACCCGCGGTGG + Exonic
903495025 1:23760134-23760156 AGCACCCTGTCGCCCCACTGAGG - Exonic
905761146 1:40559096-40559118 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
906055987 1:42917215-42917237 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
907102236 1:51847603-51847625 AGCACCCAGGCCAGCAGCTGCGG - Intronic
907889495 1:58623565-58623587 AGCACCCAGGCCAGCGGCTGCGG + Intergenic
908027750 1:59969890-59969912 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
909318545 1:74253567-74253589 AGCACCCGGGCCAGCAGCTGCGG - Intronic
909377072 1:74952273-74952295 AGCACCCAGGCCAGTGGCTGCGG - Intergenic
909782288 1:79561751-79561773 AGCACCCAGGCCAGCAGCTGTGG - Intergenic
910034765 1:82777007-82777029 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
910625571 1:89303045-89303067 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
911259599 1:95669854-95669876 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
911839249 1:102660238-102660260 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
911969628 1:104415480-104415502 AGCATCCAGGTGATCCACAGGGG + Intergenic
912058123 1:105631461-105631483 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
912538755 1:110396559-110396581 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
912824691 1:112894823-112894845 AGCACCCAGGCAAGCAGCTGTGG + Intergenic
914203436 1:145506096-145506118 AGCACCCGGGCCAGCGGCTGAGG - Intergenic
914438442 1:147680992-147681014 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
914482558 1:148079250-148079272 AGCACCCGGGCCAGCGGCTGAGG - Intergenic
915242326 1:154532318-154532340 AGCACCCAGGCCAGCAGCTGCGG - Intronic
915261225 1:154678172-154678194 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
915624819 1:157108002-157108024 AGCTCCCAGGGGAGCCGATGTGG + Intergenic
915666110 1:157446508-157446530 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
915764491 1:158349215-158349237 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
915767160 1:158374380-158374402 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
915931355 1:160062514-160062536 TGCCCCCAGGGGAGCCCCTGTGG - Intronic
916219866 1:162433287-162433309 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
916910112 1:169337303-169337325 AGCACCCGGGCCAGCAGCTGCGG - Intronic
917445407 1:175102526-175102548 AGCACCCGGGCCAGCAGCTGCGG - Intronic
917446362 1:175108683-175108705 AGCACCCGGGCCAGCAGCTGCGG - Intronic
917578546 1:176349496-176349518 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
917932997 1:179837156-179837178 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
918059006 1:181045964-181045986 AGCACCCGGGCCAGCGGCTGCGG + Intronic
918667675 1:187172128-187172150 AGAGCCCAGGAGAGTCACTGAGG - Intergenic
918789971 1:188813215-188813237 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
919091903 1:192987045-192987067 AGCACCCGGGCCAGCGGCTGTGG + Intergenic
919167951 1:193919138-193919160 AGCACCCAGGCCAGTGGCTGCGG - Intergenic
919174473 1:194001976-194001998 AGCACCCAGGCCAGCGGCTGTGG + Intergenic
919419772 1:197355621-197355643 AGCACCCGGGCCAGCAGCTGTGG - Intronic
920604867 1:207371623-207371645 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
920878460 1:209858877-209858899 AGCACCCAGGCCAGGAGCTGCGG - Intergenic
921396384 1:214673372-214673394 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
921903837 1:220475895-220475917 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
922011786 1:221596164-221596186 GGAACCCAGGCGATCCACTTTGG - Intergenic
922417075 1:225431500-225431522 AGTACCCAGGCCAGCAGCTGCGG + Intergenic
922485426 1:225969900-225969922 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
922541912 1:226426518-226426540 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
923386071 1:233466164-233466186 AGCACCCAGGCAAGCAGCTTCGG + Intergenic
924219237 1:241855805-241855827 AGCACCCGGGCCAGCGGCTGCGG - Intronic
924305944 1:242689562-242689584 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
1063318730 10:5032744-5032766 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1063769693 10:9183484-9183506 AGCACCCAGCCCAGCAGCTGCGG + Intergenic
1063848704 10:10161031-10161053 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
1064461017 10:15535070-15535092 AGCACCCGGGCCAGCGGCTGCGG + Intronic
1065441335 10:25756133-25756155 AGCACCCAGGCCAGTGGCTGCGG + Intergenic
1065745829 10:28840921-28840943 AGCACACAGGCGTACGACTGAGG - Intergenic
1065938526 10:30543259-30543281 AACACCCAGGCTGGCCACAGTGG - Intergenic
1066234045 10:33468168-33468190 AGCACCCGGGCCAGCGGCTGTGG + Intergenic
1066544244 10:36482224-36482246 AGCACCAGGGCCAGCCGCTGCGG - Intergenic
1066615061 10:37285392-37285414 AGCACCCAGGCCAGCAGCTGTGG - Intronic
1067363192 10:45600876-45600898 AGCACCCAGGCCAGCGGCTGCGG + Intergenic
1067574714 10:47401962-47401984 ACCACCCAGATGATCCACTGTGG + Intergenic
1068211330 10:53924316-53924338 AGCACCCAGGCCAGCAGCTGCGG + Intronic
1068863171 10:61867779-61867801 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1068978139 10:63033723-63033745 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1069090813 10:64197000-64197022 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1069960211 10:72075037-72075059 AGCCCCCAGGCAAGCCTCTGGGG + Intronic
1069988674 10:72300726-72300748 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1069992973 10:72326088-72326110 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1070783017 10:79148332-79148354 AGAACCCAGGGGAGCCTGTGGGG - Intronic
1070973383 10:80586010-80586032 AGCACCCAGGCCAGCAGCTGCGG + Intronic
1071388005 10:85141534-85141556 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1071611012 10:87031206-87031228 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
1072806051 10:98424644-98424666 AGCAACCAGGCCAGCCCCTCGGG + Intronic
1073532518 10:104245307-104245329 AGCACCCAGGTCAGCAGCTGTGG + Intronic
1073789772 10:106928329-106928351 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1074129170 10:110558022-110558044 AGCACTCTGGGGGGCCACTGTGG - Intergenic
1074817285 10:117151960-117151982 AGAACCCAAGGGTGCCACTGAGG - Intergenic
1074884766 10:117685079-117685101 AGCCCCCAGGCCAGACACGGGGG + Intergenic
1075093886 10:119458661-119458683 AGAGCCCAGGTGAGCCCCTGAGG + Intronic
1075255623 10:120923959-120923981 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1075269378 10:121035565-121035587 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1075505006 10:123013730-123013752 AGCACCCAGGCCAGCAGCTGTGG - Intronic
1076445766 10:130512785-130512807 AGGAGCCATGCGAGCCGCTGTGG - Intergenic
1076632250 10:131858149-131858171 AGCACCCAGGGGAGTGACTGTGG + Intergenic
1076773610 10:132680787-132680809 AGCACCCGGGCCAGCAGCTGCGG + Intronic
1076796537 10:132801171-132801193 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1077052390 11:573156-573178 TGCACCCAGGCCAGGCACGGTGG - Intergenic
1077103918 11:833673-833695 AGGACACAGGCGACCCGCTGAGG - Intronic
1077516059 11:3002800-3002822 GGCACCCAGGGGTGCCGCTGAGG - Intronic
1077805765 11:5590013-5590035 AGCACCCGGGCTAGCGGCTGCGG + Intronic
1078301199 11:10133530-10133552 AGCACCCAGGCCAGTGGCTGCGG - Intronic
1078891329 11:15561046-15561068 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1079117225 11:17647530-17647552 GGCACCCAGGAGAGGGACTGAGG + Intergenic
1079731755 11:23942504-23942526 AGCACCCAGGCCAGAGGCTGTGG - Intergenic
1079767776 11:24416226-24416248 AGCACCCGGGCCAGCGGCTGTGG - Intergenic
1079867608 11:25756252-25756274 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
1080223517 11:29934297-29934319 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1080689456 11:34544377-34544399 GGGACCCAGGTCAGCCACTGTGG + Intergenic
1081046409 11:38278825-38278847 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1081047695 11:38296493-38296515 AGCAACCAGGCCAGCAGCTGCGG - Intergenic
1081374709 11:42344559-42344581 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1081428387 11:42950020-42950042 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1082698760 11:56402145-56402167 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
1082912327 11:58390797-58390819 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
1082955261 11:58863751-58863773 AGGACCCAGGCAAGCCTTTGTGG - Intronic
1083672053 11:64305345-64305367 CGCAGCCCGCCGAGCCACTGCGG - Intergenic
1084062766 11:66686862-66686884 AGTAACCAGGCCAGCCACTTGGG - Intronic
1084107410 11:66988929-66988951 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1084210462 11:67619171-67619193 AGCACCCGGGCCAGCGGCTGTGG + Intergenic
1084406080 11:68974475-68974497 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
1085179886 11:74524754-74524776 AACACCCAAGTGAGCCCCTGGGG - Intronic
1085245598 11:75098341-75098363 AGCACCCGGGCCAGCGGCTGTGG + Intergenic
1085349553 11:75789825-75789847 AGCACCCAGCCCAGACACTGTGG - Intronic
1085414083 11:76308746-76308768 AGCACCCAGGCCAGTCTCCGGGG + Intergenic
1085863130 11:80257697-80257719 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1085886963 11:80532970-80532992 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
1085941131 11:81207751-81207773 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
1085982804 11:81744752-81744774 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
1086001089 11:81986901-81986923 AGCACCCAGGCCAGCAGCTGTGG - Intergenic
1086087564 11:82970807-82970829 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1086305888 11:85481804-85481826 AGCCCCCAGGCCAGCCACTGTGG + Intronic
1087070811 11:94078578-94078600 AAGACCCAGGAGAGCCAATGGGG + Intronic
1087407317 11:97745844-97745866 AGCACCCAGGCCAGCATCTGCGG - Intergenic
1088570878 11:111222113-111222135 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1089246198 11:117122079-117122101 AGCACCAAGGGAAGCCAGTGAGG + Intergenic
1089466405 11:118689200-118689222 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1089666863 11:120026033-120026055 AGCTCCCAGGCCAGCAGCTGCGG + Intergenic
1089735395 11:120547183-120547205 GGCTCCCAGGAGAGGCACTGTGG - Intronic
1089979897 11:122763592-122763614 ACCACCAAGGCCAGCCAATGGGG - Intronic
1091233452 11:134003088-134003110 AGCACCCGGGCCAGTCGCTGCGG - Intergenic
1092135201 12:6142331-6142353 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
1092220287 12:6708417-6708439 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1092336679 12:7639974-7639996 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1092572421 12:9739802-9739824 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1093443776 12:19230583-19230605 AGCACCCAGGCCAGCAGCTGTGG - Intronic
1093480166 12:19596097-19596119 AGCACCTGGGCCAGCCACGGTGG - Intronic
1093652551 12:21661664-21661686 AGCACCCGGGCCAGCGGCTGCGG + Intronic
1093653941 12:21674278-21674300 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1093715521 12:22377041-22377063 AGCACCCTGGCCAGCAGCTGCGG + Intronic
1093921665 12:24866211-24866233 AGCACCCAGGCCAGCAGCTGCGG + Intronic
1093970214 12:25369501-25369523 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1094148775 12:27258614-27258636 AGCAACCAGGCCAGGCACGGGGG - Intronic
1094327560 12:29256777-29256799 AGCACCCAGGCCAGCTGCCGAGG + Intronic
1094718196 12:33034157-33034179 AGCACCCAGGCCAGCGGCTGTGG - Intergenic
1095478832 12:42612871-42612893 ATGAGCCAGGCGAGGCACTGTGG + Intergenic
1095587409 12:43864028-43864050 AGCACCCGGGCCAGCAGCTGTGG + Intronic
1096201161 12:49684290-49684312 AGCACTCAGGAGGGCCTCTGAGG - Intronic
1096234694 12:49918143-49918165 TGCATCCATGTGAGCCACTGTGG - Intergenic
1096787255 12:54024287-54024309 AGCACCCAGGCCAGGCGCTGAGG + Intronic
1096801754 12:54115089-54115111 TGCACCCAGGTGAGCCAGTCAGG + Intergenic
1097490944 12:60269880-60269902 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1097863842 12:64543267-64543289 AGCACCCGGGCTAGCAGCTGCGG + Intergenic
1098168218 12:67719458-67719480 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1098759242 12:74403081-74403103 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1098866991 12:75774382-75774404 AGCAGCCAGGGGACCCACTCTGG - Intergenic
1099190958 12:79561674-79561696 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
1099191385 12:79565086-79565108 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1099204354 12:79711069-79711091 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
1099228161 12:79993450-79993472 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1099413712 12:82361643-82361665 AGCACCCAGGACAGCAGCTGCGG - Intronic
1099478669 12:83140254-83140276 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1099716230 12:86296628-86296650 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1099790712 12:87330350-87330372 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1101008990 12:100430436-100430458 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1101984354 12:109433910-109433932 AGTTCCCAGGGCAGCCACTGGGG - Intronic
1102303401 12:111787464-111787486 AGAACCAAGGCCAGCCACTCAGG - Intronic
1103439232 12:120950567-120950589 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1103668546 12:122592159-122592181 AGCACCCGGGCCAGCGGCTGCGG + Intronic
1103754753 12:123195763-123195785 AGCAAACAGGCCAGGCACTGTGG + Intronic
1103760880 12:123249545-123249567 AGCACCCCGGCCAGCAGCTGTGG - Intronic
1104344491 12:127983516-127983538 AGCACCGAGGCCAGCAGCTGCGG + Intergenic
1104373874 12:128247377-128247399 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1104614516 12:130256880-130256902 AGCACCCGGGCCAGCGGCTGTGG - Intergenic
1104965499 12:132507170-132507192 AGAACCCTGGGAAGCCACTGGGG - Intronic
1105342899 13:19544606-19544628 AGCAGCCAGGCCAGGCACGGTGG + Intergenic
1105351812 13:19622719-19622741 AGAACCCAGGCGGGGCACGGTGG + Intergenic
1105425646 13:20292551-20292573 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1105593880 13:21818078-21818100 AACACCCAGGCCAGCAGCTGCGG + Intergenic
1105701542 13:22938863-22938885 AGCACCCAGACCAGCAGCTGAGG - Intergenic
1105722173 13:23127706-23127728 AGCACCCAGGCCAGCGGCTGTGG + Intergenic
1105883480 13:24623491-24623513 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
1106144375 13:27038668-27038690 AGCACCCAGGCCGGGCACGGTGG + Intergenic
1106221329 13:27748540-27748562 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
1106251760 13:27987267-27987289 AGCATCCAGGACAGCCCCTGAGG + Intronic
1108362305 13:49678535-49678557 AGCACCCGGGCCAGCAGCTGTGG - Intronic
1108413094 13:50169867-50169889 AGCAGCAAGGCCAGCCACTCTGG - Intronic
1108486597 13:50933132-50933154 ACCACATAGGTGAGCCACTGAGG - Intronic
1108858960 13:54829726-54829748 AGCACCCGGGCCAGCGGCTGTGG - Intergenic
1108991144 13:56659339-56659361 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1109124925 13:58505646-58505668 AGCACCCAGGCCAGCACCTGTGG - Intergenic
1109201867 13:59440044-59440066 AGCACCCTGGCCAGCAGCTGTGG + Intergenic
1109364635 13:61339299-61339321 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1109446613 13:62448125-62448147 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1109506151 13:63305869-63305891 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1109638092 13:65149799-65149821 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
1109829959 13:67773162-67773184 AGCACCCCGGCCAGCAGCTGCGG - Intergenic
1109854299 13:68107943-68107965 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
1110440191 13:75518687-75518709 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1110497853 13:76190234-76190256 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
1110874369 13:80490788-80490810 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
1110940296 13:81340997-81341019 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
1111006644 13:82258094-82258116 AGCACCTAGGCCAGCAGCTGCGG + Intergenic
1111441905 13:88291954-88291976 AGCAACCAGGCCAGCTGCTGCGG + Intergenic
1111602721 13:90494914-90494936 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1111748324 13:92296800-92296822 AGCACCCAGGCCAGTGGCTGCGG + Intronic
1112538267 13:100282562-100282584 AGCACCCGGGCCAGCGGCTGTGG + Intronic
1113812561 13:113151427-113151449 AGAACCCAGGTGAGACCCTGAGG + Intergenic
1114131204 14:19795059-19795081 AGTACCTAGGCCAGGCACTGTGG - Intronic
1114593533 14:23891891-23891913 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1116152126 14:41154466-41154488 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1116251035 14:42482617-42482639 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1116325802 14:43533164-43533186 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1116712203 14:48383088-48383110 AGCACACAGGTGAGCGAGTGCGG + Intergenic
1117183652 14:53217737-53217759 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1117297567 14:54393575-54393597 AGCACCCAGGCCAGCGGCTGCGG + Intergenic
1118558917 14:67056941-67056963 AGCCCCCAGGCCAGCAGCTGCGG - Intronic
1119781191 14:77277818-77277840 AGCACCAAGGCCAGGGACTGGGG + Intronic
1119870704 14:78014207-78014229 AGCACCCAGGCCAGTGGCTGCGG - Intergenic
1120209870 14:81623993-81624015 AGCATCCAGGCCAGCAGCTGCGG - Intergenic
1120330982 14:83092519-83092541 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1120439113 14:84513135-84513157 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
1120704771 14:87734978-87735000 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
1120822232 14:88922576-88922598 GGCACCCAGGTGATCCACTTGGG - Intergenic
1120844164 14:89111782-89111804 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1121145372 14:91578091-91578113 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1121350664 14:93170343-93170365 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
1122329205 14:100901677-100901699 AGGACACAGGCCAGCCTCTGTGG + Intergenic
1122837644 14:104437881-104437903 ACCACCCAGGCCAGCCCCGGGGG + Intergenic
1122894824 14:104751724-104751746 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1123051881 14:105547961-105547983 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1123435068 15:20248441-20248463 AGCACCCAGGCCTCCCACTGTGG - Intergenic
1123574266 15:21650658-21650680 AGTACCTAGGCCAGGCACTGTGG - Intergenic
1123610881 15:22093245-22093267 AGTACCTAGGCCAGGCACTGTGG - Intergenic
1123799139 15:23803048-23803070 AGCACCCAGGCCAGCGACTGTGG + Intergenic
1124114858 15:26831405-26831427 AGCACCCAGGCCAGCCGCTGCGG - Intronic
1124818471 15:33019704-33019726 AGCACTCAGGCAAGCAGCTGCGG - Intronic
1125112216 15:36047089-36047111 AGCACCCGGGCCAGCCGCTGCGG + Intergenic
1125480292 15:40074999-40075021 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
1125515257 15:40315547-40315569 GGCACCCAGGTGATCCACTGGGG - Intergenic
1125609699 15:40961752-40961774 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1125885543 15:43226776-43226798 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1126088991 15:45034969-45034991 AGCACCCGGGCCAGCGGCTGCGG + Intronic
1126128077 15:45314227-45314249 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1126205040 15:46035808-46035830 AGAACCCAGGCAATCCACTTGGG - Intergenic
1126831251 15:52608176-52608198 AGCACCCAGGCCAGGCACAATGG - Intronic
1127916445 15:63459220-63459242 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
1127984775 15:64061018-64061040 AACACCCGGGCCAGCCGCTGCGG + Intronic
1128813308 15:70587400-70587422 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1129280397 15:74480571-74480593 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1129678177 15:77643536-77643558 AGGAGCCAGGAGAGCCCCTGCGG - Intronic
1130964939 15:88690134-88690156 AGCACCCAGGAGGGGCCCTGAGG - Intergenic
1131507785 15:93031962-93031984 AGCACCCAGGCCAGTGGCTGCGG + Intergenic
1132339380 15:101068487-101068509 AGCCCACAGGCTGGCCACTGGGG + Intronic
1202983130 15_KI270727v1_random:385001-385023 AGTACCTAGGCCAGGCACTGTGG - Intergenic
1132511017 16:341398-341420 AGCACCCGGGCCAGCGGCTGCGG + Intronic
1132668718 16:1094112-1094134 AGCACCCAGGCCAGGGGCTGGGG + Intronic
1132836823 16:1958425-1958447 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1135280850 16:21152732-21152754 AGCACCCCGGCCAGCGGCTGCGG + Intronic
1135470206 16:22723168-22723190 AGCACTCAGGCCAGCAGCTGTGG - Intergenic
1135557981 16:23453081-23453103 AGCACCGAGGCTAGCCTCCGAGG + Exonic
1135674963 16:24407364-24407386 AGAACCCAGGCCAGGCACAGTGG - Intergenic
1136199670 16:28679483-28679505 AGTACCCAGGCCAGCAGCTGCGG - Intergenic
1136609884 16:31359822-31359844 AGCACCCAGGTGTGCCTTTGGGG + Exonic
1136849535 16:33602508-33602530 AGCACCCAGGCCTCCCCCTGTGG + Intergenic
1137432152 16:48427147-48427169 AGCACCCAGCCAGGCCTCTGAGG - Intronic
1137628930 16:49928415-49928437 AGGCCCCAAGCGAGGCACTGTGG - Intergenic
1138168835 16:54829951-54829973 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
1138688776 16:58748989-58749011 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1138693603 16:58790995-58791017 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
1139125539 16:64072554-64072576 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1139147732 16:64344029-64344051 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1139650172 16:68358261-68358283 TGCCCCCAGGCGTGCCCCTGAGG + Exonic
1139958864 16:70706268-70706290 AGCATCCAGCCCAGCCTCTGAGG - Intronic
1140661609 16:77194872-77194894 AGCATCCAGGCGGGCCACGTAGG - Exonic
1141465748 16:84204841-84204863 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1142355469 16:89599581-89599603 AGCTCCCTGGCGCCCCACTGTGG - Intergenic
1203111244 16_KI270728v1_random:1451161-1451183 AGCACCCAGGCCTCCCCCTGTGG + Intergenic
1143095277 17:4475517-4475539 ATCACCCAGGCCAGACGCTGGGG - Intronic
1143375239 17:6463360-6463382 AGCACACAGCCCAGCCACAGGGG + Intronic
1143708654 17:8718302-8718324 AGCACCCGGGCAAGCAGCTGCGG - Intergenic
1144723207 17:17486488-17486510 AGCACCCGGGCCAGCAGCTGCGG + Intronic
1144804672 17:17956716-17956738 AGCATCCAGGCCAGCAGCTGCGG - Intronic
1146740469 17:35279140-35279162 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1147373623 17:40011069-40011091 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1148448657 17:47758223-47758245 AGCACCCAGGAGAGACTCTGTGG - Intergenic
1148819688 17:50353438-50353460 ACCTCCCTGGCCAGCCACTGAGG - Intronic
1149099263 17:52884201-52884223 AGCACCCAGGCCAGCGGCTGCGG - Intronic
1150778280 17:68099417-68099439 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1150786752 17:68169583-68169605 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1151438513 17:74113557-74113579 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1151694069 17:75705194-75705216 AGCACCCAGGCGAGCCACTGAGG - Intronic
1151782678 17:76257873-76257895 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1151983173 17:77526277-77526299 AGCACCCGGGCCAGCAGCTGGGG - Intergenic
1152179884 17:78812815-78812837 AGCACCAAGACCAGCCACTTTGG + Intronic
1152619053 17:81352273-81352295 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1154057243 18:11023872-11023894 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1154255314 18:12777080-12777102 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1154485054 18:14866562-14866584 CGCAACCAGGCGAGCCATGGTGG - Intergenic
1155003314 18:21706652-21706674 AGCACCCAGACCAGCAGCTGTGG + Intronic
1155295034 18:24376805-24376827 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1155852280 18:30788579-30788601 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
1156034697 18:32753428-32753450 AGGACCCATGTGAGCCACAGGGG - Intronic
1156038669 18:32794709-32794731 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1156243044 18:35271872-35271894 AGCACCCGGGCCAGCAGCTGCGG - Intronic
1156657824 18:39309228-39309250 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1156943167 18:42795367-42795389 AGCACCCGGGCCAGCGGCTGTGG + Intronic
1157131328 18:45009989-45010011 ACCTCCCAGGCGAGGAACTGTGG - Intronic
1158392009 18:57051665-57051687 GGCAGCAGGGCGAGCCACTGTGG + Intergenic
1158392017 18:57051727-57051749 AGAAGCCAGGCGAGCCATTGTGG + Intergenic
1159230799 18:65605389-65605411 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1159260484 18:66006180-66006202 AACACCCAGGCCAGCAGCTGTGG - Intergenic
1159656208 18:71031932-71031954 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
1160009147 18:75090311-75090333 AGCCCCCACGCCAGCCTCTGAGG - Intergenic
1160176622 18:76600355-76600377 AGCACCCGGGCCAGTCGCTGCGG - Intergenic
1162091092 19:8280583-8280605 AGCACCCGGGCCAGCAGCTGTGG - Intronic
1162093326 19:8295421-8295443 AGCACCCGGGCCAGCAGCTGTGG - Intronic
1162230144 19:9259648-9259670 AGCACCCGGGCCAGCGGCTGTGG + Intergenic
1162351659 19:10154083-10154105 AGCACCCAAGCATGCCTCTGTGG + Intronic
1162522745 19:11191573-11191595 ATGACCCAGGCCAGCCAATGAGG + Intronic
1162660224 19:12163111-12163133 AGACTCCAGGCGAGCCACTCTGG - Exonic
1162993490 19:14318872-14318894 AACTCCCAGGGGAGCCTCTGGGG - Intergenic
1164270587 19:23668752-23668774 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1165031217 19:32999362-32999384 AGCACCCAGGCCTCCCACTGTGG - Intronic
1167485675 19:49761674-49761696 ACCACCCAGGCCAGGCACGGGGG + Intronic
925098977 2:1229824-1229846 AGCACCCGGGCCAGCGGCTGCGG - Intronic
925384396 2:3452105-3452127 AGCCCTCAGGTGAGACACTGCGG - Intronic
925537811 2:4935539-4935561 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
926071895 2:9902371-9902393 AGCACCCAGCAGAGCTCCTGGGG - Intronic
926097490 2:10091552-10091574 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
927150047 2:20190297-20190319 AGCACCCAGGCGTGTCAGGGAGG + Intergenic
927509872 2:23637726-23637748 AGAACCCAGGAGAGCCACTCTGG + Intronic
928493080 2:31803838-31803860 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
928599196 2:32886793-32886815 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
928723122 2:34142761-34142783 AGCACGCAGGCCAGCAGCTGTGG - Intergenic
928753193 2:34494428-34494450 AGCACCCAGGCCAGTGGCTGCGG + Intergenic
928844770 2:35657606-35657628 GGCTCCCAGGCAATCCACTGGGG + Intergenic
928880573 2:36092376-36092398 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
928936896 2:36688396-36688418 AGCACCCGGGCTAGCGGCTGTGG + Intergenic
929148474 2:38727317-38727339 AGCACTCAAGTGAGACACTGAGG - Intronic
929233709 2:39585490-39585512 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
930038011 2:47099867-47099889 AGCACCCAGGCCAGCAGCTGCGG + Intronic
931329826 2:61269198-61269220 ATCACCCAGGCTAGCGACAGTGG + Intronic
932423437 2:71614423-71614445 AGAACCCTGGAGAGCCACAGAGG - Intronic
933049912 2:77590608-77590630 AGCACCCAGCCCAGCAGCTGCGG + Intronic
933487259 2:82938671-82938693 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
933531633 2:83518306-83518328 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
934898491 2:98139138-98139160 AGCACCCAGGCCAGCAGCTGCGG + Intronic
935790299 2:106584524-106584546 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
935878365 2:107536316-107536338 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
936250812 2:110866948-110866970 TGCACCCTGGCCAGCCTCTGGGG - Intronic
936346886 2:111681985-111682007 AGCACCCAGGCCAGCGGCAGCGG + Intergenic
936370572 2:111898877-111898899 AGCAGCCAGGCGCGCCCCTGTGG - Intronic
936581524 2:113704630-113704652 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
937310734 2:120901520-120901542 AGCCCCCAGCCAGGCCACTGGGG + Intronic
937596847 2:123683908-123683930 AGCACCCAGGCCAGTGGCTGCGG + Intergenic
937608204 2:123826970-123826992 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
937924325 2:127156157-127156179 TACACCCAGGAGAGACACTGGGG + Intergenic
937975831 2:127581675-127581697 AGCCCCCAGGAGACCCACTGAGG + Intronic
938126083 2:128672350-128672372 AGCACCCTGGCCAGCAGCTGTGG - Intergenic
938662001 2:133496793-133496815 ACCACCTATGAGAGCCACTGAGG + Intronic
939053215 2:137331833-137331855 AGCACCCGGGCCAGCGGCTGCGG - Intronic
939229757 2:139410475-139410497 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
939275208 2:139990925-139990947 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
939281750 2:140073924-140073946 AGCACCCAGGCCAGCGGCTGCGG + Intergenic
939745419 2:145960794-145960816 AGCACCCAGGCCAGCAGCTGTGG - Intergenic
939869051 2:147507043-147507065 AGTACCCAGGCCAGCAGCTGTGG + Intergenic
939972544 2:148678626-148678648 AGCACCCGGGCCAGCGGCTGCGG - Intronic
940666708 2:156618283-156618305 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
940858072 2:158745297-158745319 AGGACAGAGGCCAGCCACTGGGG - Intergenic
941178887 2:162234976-162234998 AGCACCCAGGCCAGCAGCTGCGG + Intronic
941240083 2:163026410-163026432 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
941712124 2:168725123-168725145 AGCACCCGGGCCAGCGGCTGCGG - Intronic
941928075 2:170915607-170915629 AGCACCCAGGCCAGCAGCTGTGG - Intergenic
942170259 2:173282814-173282836 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
942317604 2:174709802-174709824 AGCACCTGGGCCAGCCCCTGCGG - Intergenic
942867288 2:180691522-180691544 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
942868329 2:180703508-180703530 AGCAACCCGGCCAGGCACTGTGG - Intergenic
943365281 2:186962388-186962410 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
943680344 2:190761180-190761202 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
943954914 2:194176448-194176470 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
944228429 2:197370705-197370727 AGCACCCCGGCCAGCGGCTGCGG + Intergenic
944252493 2:197591783-197591805 AGCACCCAGGCCAGCAGCTATGG - Intronic
944728597 2:202497045-202497067 AGCACCCGGGCCAGCGGCTGCGG + Intronic
944729634 2:202503505-202503527 AGCACCCAGGCCAGCAGCTGCGG + Intronic
944857938 2:203785800-203785822 AGCACCCAGGCCAGTGGCTGCGG - Intergenic
945575478 2:211524603-211524625 AGCACCCGGGCCAGCGGCTGCGG - Intronic
945869147 2:215208008-215208030 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
945907896 2:215615111-215615133 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
946017061 2:216612433-216612455 AGAACCTAGGCCAGGCACTGTGG - Intergenic
946982169 2:225229674-225229696 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
947026626 2:225744268-225744290 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
947103793 2:226648142-226648164 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
947411992 2:229850852-229850874 AGCACCCGGGCCAGCGGCTGCGG + Intronic
947613852 2:231541636-231541658 AGGACACAGGAGACCCACTGTGG + Intergenic
948449112 2:238058079-238058101 AGCACCCGGGCCAGCGGCTGCGG - Intronic
948596778 2:239084489-239084511 AGCTCCCAAACAAGCCACTGGGG + Intronic
948844007 2:240674612-240674634 AGCACACAGGGGAGCCGATGGGG - Intergenic
948849804 2:240700023-240700045 AGCACACAGGGGAGCCGATGGGG + Intergenic
948950904 2:241250726-241250748 AGCAACGAGGCGATGCACTGAGG + Intronic
1169553500 20:6725940-6725962 AGCTCCCAGTCAAGCCACTCAGG + Intergenic
1169849190 20:10031816-10031838 AGCACCCGGGCCAGCAGCTGCGG + Intronic
1170246466 20:14226642-14226664 AGCACCCGGGCCAGCGGCTGCGG + Intronic
1170989882 20:21292006-21292028 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1171794948 20:29559377-29559399 TGCACCCAGGTGAGCCAGTCAGG - Intergenic
1171853501 20:30324888-30324910 TGCACCCAGGTGAGCCAGTCAGG + Intergenic
1172259116 20:33546780-33546802 AACACCCAGGCCAGGCACAGTGG - Intronic
1172431860 20:34899028-34899050 AGCACCCGGGCCAGCAGCTGCGG - Intronic
1173601593 20:44299268-44299290 AGCACCCAGGCCAGCGGCTGCGG + Intergenic
1173831506 20:46091985-46092007 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
1174092300 20:48058997-48059019 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
1174354834 20:49990675-49990697 AGCCCCTAGGGCAGCCACTGGGG + Intergenic
1175951879 20:62587949-62587971 AGCACCAAGGAGAGCAGCTGAGG + Intergenic
1176136022 20:63522387-63522409 AGGACCCAGGGCAGCCACTGAGG + Intergenic
1176189378 20:63800680-63800702 AGCACCCGGGCCAGCAGCTGCGG + Intronic
1176671038 21:9735673-9735695 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
1176857083 21:13981701-13981723 AGCAGCGAGGCGAGCCAGCGAGG + Intergenic
1176867519 21:14062526-14062548 AGCAGCGAGGCGAGCCAGCGAGG - Intergenic
1177565829 21:22819065-22819087 AGCACCCTGGCCAGCGGCTGCGG - Intergenic
1177637617 21:23807151-23807173 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1177669655 21:24208895-24208917 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1178585647 21:33868542-33868564 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1179481033 21:41678807-41678829 AGCACACAGGCCAGCCCCTGAGG + Intergenic
1180199828 21:46217665-46217687 AGCACCCTGGCGTGCCCATGCGG + Intronic
1180304952 22:11066631-11066653 TGCAGCCAGGCGAGCCGCGGTGG - Intergenic
1180962023 22:19766463-19766485 AGCACCCGGGCCAGCAGCTGCGG - Exonic
1181800898 22:25347156-25347178 AGCACCCAGGCCAGCACCTGTGG - Intergenic
1181851478 22:25752937-25752959 AGCACCCAGGCCAGCAGCTGCGG + Intronic
1182375408 22:29843622-29843644 ACCACCCAGCCAAGCCACTTTGG - Intergenic
1184658726 22:45955520-45955542 GGCACCCAGGCAAGCAGCTGAGG - Intronic
1185048687 22:48541910-48541932 AGCACCCACACGATCCCCTGGGG - Intronic
949258973 3:2083762-2083784 AGCACCCCGGCCAGCGGCTGCGG + Intergenic
950203596 3:11061508-11061530 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
950207891 3:11094171-11094193 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
950600380 3:14029720-14029742 AGCACCCGGGCCAGCGGCTGTGG - Intronic
951951089 3:28200638-28200660 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
952124637 3:30286245-30286267 AGCAACAAGGCTAGCAACTGGGG - Intergenic
952198693 3:31102673-31102695 ATCAACCAGTCGAGCCCCTGAGG + Intergenic
952393713 3:32902929-32902951 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
952398230 3:32939818-32939840 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
952453693 3:33453584-33453606 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
952593635 3:34988511-34988533 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
952730640 3:36634042-36634064 AGCACCCCGGCCAGCGGCTGCGG + Intergenic
952795246 3:37233138-37233160 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
952815196 3:37441680-37441702 AGCACCCAGATAAGCCACTTCGG - Intergenic
953096271 3:39779880-39779902 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
953124515 3:40078152-40078174 AGCACCCGGGCCAGCGGCTGCGG - Intronic
953714601 3:45306804-45306826 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
953877417 3:46674215-46674237 AGCCCCAAGCCGAGCCAGTGAGG + Intronic
953907320 3:46874856-46874878 GGCAACCTGGCCAGCCACTGGGG - Intronic
953950823 3:47188817-47188839 AGCATACAGGCCAGGCACTGTGG + Intergenic
955186426 3:56719067-56719089 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
955210284 3:56934600-56934622 AGCACCCGGGCCAGCGGCTGCGG + Intronic
956183945 3:66544882-66544904 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
956441319 3:69283094-69283116 AGCTCCCAGGCCAGGCGCTGTGG + Intronic
956442690 3:69295604-69295626 TGCTCCCAGGCCAGCCACCGTGG - Intronic
956459220 3:69454572-69454594 AGCACCCAGGCCAGCAGCTGCGG + Intronic
957245970 3:77716572-77716594 AACACACAGCAGAGCCACTGTGG - Intergenic
957371482 3:79300354-79300376 AGCACCCAGGCCAGCAGCTGCGG + Intronic
957556299 3:81767612-81767634 AGCACCCTGGCCAGCGGCTGCGG - Intergenic
957636457 3:82791407-82791429 AGCACCCATGCTAGCAGCTGGGG + Intergenic
957830018 3:85504901-85504923 AGCACCCGGGCCAGCGGCTGCGG - Intronic
958419872 3:93917721-93917743 AGCACCCGGGCCAGCAGCTGTGG + Intronic
959150067 3:102597586-102597608 ATCACCCAGGCCAGGCACAGTGG - Intergenic
959422737 3:106148762-106148784 AGCACCCAGGCCAGCGGCTGCGG + Intergenic
960149805 3:114238515-114238537 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
960669200 3:120140384-120140406 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
961688799 3:128653534-128653556 AGCACCCCGGCCAGCGGCTGCGG + Intronic
961700797 3:128743147-128743169 AGCACCCAGGCCAGCAGATGTGG - Intronic
961772466 3:129260120-129260142 AGCACCCAGGGGTTCCAGTGAGG - Intronic
962383767 3:134916585-134916607 AGCACCCGGGCCAGCAGCTGCGG - Intronic
962600504 3:136987813-136987835 AGCACCCGGGCCAGCGGCTGCGG - Intronic
962671699 3:137714748-137714770 AGCACCCGGGCTAGCAGCTGCGG - Intergenic
962797455 3:138861620-138861642 AGCACCCTGGGGAGCCTGTGAGG + Intergenic
963397210 3:144749947-144749969 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
963397878 3:144757017-144757039 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
963440402 3:145333513-145333535 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
963533263 3:146497433-146497455 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
963862169 3:150323103-150323125 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
964014378 3:151928290-151928312 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
964032318 3:152152551-152152573 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
964117974 3:153155952-153155974 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
964129246 3:153268817-153268839 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
964137123 3:153356672-153356694 GGCATCCAGGTGATCCACTGAGG + Intergenic
964393786 3:156224147-156224169 AGCACCCAGGCCAGCAGCTGTGG - Intronic
964452144 3:156822902-156822924 AGCACCCAGGCCAGTGGCTGTGG - Intergenic
964983154 3:162710735-162710757 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
965044136 3:163552547-163552569 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
965077992 3:164003103-164003125 AGCACCCAGGCCAGTGGCTGCGG + Intergenic
965200344 3:165649542-165649564 AGCACCCGGGCCAGCGGCTGTGG - Intergenic
965245241 3:166258693-166258715 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
965288039 3:166842947-166842969 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
965298130 3:166975969-166975991 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
965434738 3:168635868-168635890 GGCAGCCAGGAAAGCCACTGAGG + Intergenic
965586976 3:170327558-170327580 AGAACCCAGGCCAGCAGCTGTGG + Intergenic
965943488 3:174212197-174212219 AGCACCCGGGCCAGCAGCTGCGG - Intronic
966096791 3:176213645-176213667 AGCACCCAGGCCAGTGGCTGCGG - Intergenic
966425477 3:179775740-179775762 TGCACCCAGGCCAGCATCTGTGG - Intronic
966725436 3:183103971-183103993 AGCACCCGGGCCAGCGGCTGCGG - Intronic
967448503 3:189596259-189596281 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
967499156 3:190177274-190177296 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
967594919 3:191317223-191317245 AGCACCCGGGCCAGCAGCTGAGG - Intronic
967718349 3:192789167-192789189 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
968181598 3:196599262-196599284 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
968716160 4:2161404-2161426 AGCACCCAGGCCAGCGGCTGCGG + Intronic
968733700 4:2284372-2284394 AAGCCCCAGGCGAGCCACGGTGG - Intronic
968946778 4:3669066-3669088 TGCACACAGGCCAGCCACTAGGG - Intergenic
969303159 4:6309250-6309272 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
969362355 4:6672859-6672881 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
969440741 4:7215264-7215286 AGCACCCGGGCCAGCGGCTGTGG + Intronic
969595089 4:8144173-8144195 AGCACCCAGCAGAGCCTCAGCGG + Intronic
969898033 4:10323137-10323159 TGCAGCCAGGGGACCCACTGAGG + Intergenic
970400240 4:15710253-15710275 AGCACCAAGGCCAGGTACTGTGG - Intronic
970408650 4:15786960-15786982 AGCACCCAGGCCAGCAGCTGTGG - Intronic
970576872 4:17436791-17436813 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
970649327 4:18159494-18159516 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
970673168 4:18418563-18418585 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
970707974 4:18828595-18828617 GGCACCCAGGTGATCCACTAAGG - Intergenic
970803527 4:20004147-20004169 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
970817892 4:20179258-20179280 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
971564197 4:28117366-28117388 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
971639823 4:29117489-29117511 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
971905196 4:32716450-32716472 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
972022786 4:34335866-34335888 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
972173372 4:36375083-36375105 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
972505785 4:39718727-39718749 AGCACCCAGGCCAGCAGCTGCGG - Intronic
972676058 4:41260455-41260477 ACCACCCACGCCAGCCAGTGGGG - Intronic
973041807 4:45477574-45477596 AGCACCCAGGCCAGCAGTTGTGG - Intergenic
973048572 4:45567188-45567210 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
973135250 4:46698993-46699015 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
973146313 4:46831173-46831195 AGCCCCCAGGCCAGCAGCTGCGG + Intronic
973190314 4:47378277-47378299 AGCACCTAGGCCAGCGGCTGCGG - Intronic
973308079 4:48675476-48675498 AGCACCCGGGCCAGCGGCTGCGG + Intronic
973530248 4:51830624-51830646 TGATCCCAGGCAAGCCACTGGGG + Intergenic
974089889 4:57300394-57300416 CGCACCCAGGCCAGCAGCTGCGG - Intergenic
974128957 4:57729995-57730017 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
974147418 4:57965560-57965582 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
974484789 4:62492121-62492143 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
974781749 4:66561714-66561736 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
974827758 4:67152015-67152037 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
974992874 4:69115469-69115491 AGCACCCGGGCCAGCGGCTGCGG - Intronic
975160701 4:71121063-71121085 AGCACCCAGGCTAGCAGCTGCGG + Intergenic
975439955 4:74399289-74399311 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
975595188 4:76043511-76043533 AGCACCCAGGCCAGCAGCTGCGG - Intronic
975596366 4:76050882-76050904 AGCACCCGGGCTAGCAGCTGCGG - Intronic
976102490 4:81580586-81580608 AGCACCCATGCCAGCAGCTGCGG + Intronic
976406377 4:84664826-84664848 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
976646870 4:87396171-87396193 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
977206520 4:94169980-94170002 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
977416661 4:96742654-96742676 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
977470704 4:97438310-97438332 AGCACCCAGGCCAGCAGCTGCGG - Intronic
977883594 4:102234474-102234496 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
977906480 4:102483262-102483284 AGCACCCGGGCCAGCGCCTGCGG + Intergenic
978030590 4:103936913-103936935 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
978207198 4:106092626-106092648 AGCACTCAGGCCAGCAGCTGCGG - Intronic
978254887 4:106681679-106681701 AGCACCCAGGCCAGCAGCTGTGG - Intergenic
978285526 4:107073230-107073252 AGCACCCGGGCCAGCAGCTGCGG + Intronic
978458072 4:108917476-108917498 AGAAACCAGGAAAGCCACTGTGG - Intronic
978784970 4:112599432-112599454 AGTACATAGGCCAGCCACTGTGG + Intronic
978809085 4:112830942-112830964 AGCACCCGGGCCAGCAGCTGCGG + Intronic
978929802 4:114296377-114296399 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
978998047 4:115179643-115179665 AACACCCAGGCCAGCGGCTGCGG - Intergenic
979609013 4:122670351-122670373 AGCACCCAGGCCAGCGGCTGCGG + Intergenic
979688588 4:123538052-123538074 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
979865214 4:125745127-125745149 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
979899712 4:126201516-126201538 ACCACCCAGGCCAGCAGCTGCGG - Intergenic
979991464 4:127380070-127380092 AGCACCCAGGCCAGTGGCTGCGG + Intergenic
980043380 4:127964462-127964484 AGCACCCGGGCCAGCGGCTGCGG - Intronic
980227979 4:130012916-130012938 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
980562929 4:134501790-134501812 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
980595438 4:134948376-134948398 AGCACCCAGGCCAGCAGCTGTGG - Intergenic
980774492 4:137421156-137421178 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
981086617 4:140690007-140690029 AGCACACAGGCCAGGCACTGTGG - Intronic
981136199 4:141213689-141213711 AGCACCCTGGCCAGCAGCTGCGG + Intergenic
981146724 4:141333243-141333265 AGCACCCGGGCCAGCGGCTGTGG - Intergenic
982028592 4:151276966-151276988 AGGACCCAGGGGAGGAACTGGGG - Intronic
982679097 4:158408201-158408223 AGCACCCGGGCCAGCGGCTGCGG + Intronic
982768933 4:159378233-159378255 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
982770144 4:159390095-159390117 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
982868806 4:160550333-160550355 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
983026098 4:162739676-162739698 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
983060337 4:163152981-163153003 AGCACCCGGGCCAGCAGCTGAGG + Intronic
983064088 4:163189940-163189962 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
983290672 4:165799623-165799645 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
983369773 4:166843050-166843072 AGCACCCAGGCCAGCAGCTGCGG - Intronic
983553056 4:169036060-169036082 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
983634345 4:169882431-169882453 TGCACCCAGCAAAGCCACTGGGG + Intergenic
983656737 4:170091364-170091386 AGCACCCGGGCCAGCAGCTGCGG + Intronic
983843183 4:172482097-172482119 AGCACCCGGGCCAGCAGCTGTGG - Intronic
984192838 4:176625390-176625412 AGCACCCGGGCCAGCGGCTGTGG - Intergenic
984238820 4:177193421-177193443 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
984265656 4:177495727-177495749 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
984538837 4:181011773-181011795 AGAACCCAGTCTGGCCACTGTGG + Intergenic
984776112 4:183482917-183482939 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
984811319 4:183798157-183798179 GGCACCCAGGGGAGCCTCGGCGG - Intergenic
984862478 4:184253073-184253095 AGCACCTAGGCCAGCAGCTGCGG + Intergenic
984918100 4:184741342-184741364 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
985203250 4:187505766-187505788 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
985269299 4:188179097-188179119 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
985403873 4:189616871-189616893 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
985590886 5:764497-764519 AGCACCTAGGCCAGCAGCTGTGG + Intronic
985672873 5:1215094-1215116 AGCACCCAGGGGAGCTCCTGAGG - Intronic
985772045 5:1817831-1817853 AGGAGCCAGGCCAGCCCCTGGGG + Intergenic
985874207 5:2583161-2583183 AGCAGCCATGGGAGCCCCTGAGG - Intergenic
986121131 5:4837673-4837695 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
986410532 5:7474903-7474925 AGCCCCCAGGCCAGCCACAATGG + Intronic
986447769 5:7837812-7837834 AGGCCCCTGGCCAGCCACTGCGG + Intronic
986661745 5:10065625-10065647 AGCACCCTGGCCAGCAGCTGTGG + Intergenic
986963589 5:13244324-13244346 AGCACCCAGACCAGCAGCTGCGG + Intergenic
987146249 5:14994030-14994052 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
987358222 5:17083586-17083608 AGCACCCGGGCCAGCGGCTGTGG + Intronic
987476696 5:18399897-18399919 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
987543830 5:19287880-19287902 AGCACCCAGGCCAGCGGCTGCGG + Intergenic
988020523 5:25614780-25614802 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
988073502 5:26324596-26324618 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
988177265 5:27743597-27743619 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
988279555 5:29127847-29127869 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
988684735 5:33515611-33515633 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
988755606 5:34245038-34245060 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
989777378 5:45225747-45225769 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
989950573 5:50292986-50293008 AGCACCCAGGCCAGCAAGTGCGG + Intergenic
989957926 5:50376967-50376989 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
990490067 5:56295460-56295482 AGCACCCGGGCCAGCTGCTGCGG + Intergenic
990510849 5:56487910-56487932 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
991214944 5:64150215-64150237 AGCACCCAGGCCAGTAGCTGCGG + Intergenic
991567565 5:68020627-68020649 AGCACCCGGGCCAGCGGCTGAGG - Intergenic
991657794 5:68921003-68921025 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
991743850 5:69710780-69710802 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
991753863 5:69844462-69844484 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
991795422 5:70290512-70290534 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
991803488 5:70401217-70401239 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
991823217 5:70586048-70586070 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
991833175 5:70719575-70719597 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
991887789 5:71290031-71290053 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
991981515 5:72236386-72236408 AGCAACCAGGGGAGCCTGTGGGG + Intronic
992050361 5:72935374-72935396 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
992296739 5:75333821-75333843 AGCACCCAGGCCAGTGGCTGCGG + Intergenic
992947446 5:81823858-81823880 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
993031870 5:82714825-82714847 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
993202218 5:84830538-84830560 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
993320935 5:86466906-86466928 AGCACCCAGGCCAGTGGCTGCGG - Intergenic
993328579 5:86569748-86569770 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
993529191 5:89003844-89003866 AGCACCCAGACCAGCGGCTGCGG - Intergenic
993556066 5:89339995-89340017 AGGAACCAGGCAAGGCACTGGGG - Intergenic
993770287 5:91917412-91917434 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
994096341 5:95851303-95851325 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
994229967 5:97301284-97301306 AGCACCCAGGGCAGCGGCTGCGG + Intergenic
994251520 5:97542105-97542127 AGCACCCAGGCCAGCAGCTGTGG - Intergenic
994507109 5:100656898-100656920 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
994570297 5:101506163-101506185 AGCAGCCAGGCCAGCAGCTGCGG + Intergenic
994620341 5:102155074-102155096 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
994669752 5:102752201-102752223 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
994768641 5:103954039-103954061 AGCACCCAGGCCAGCAGCTGTGG - Intergenic
994769789 5:103966551-103966573 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
994882892 5:105520340-105520362 AGCATGCAGGCCAGCCCCTGTGG + Intergenic
995032321 5:107494379-107494401 AGCACCCAGGCCAGCGGCTGCGG + Intronic
995206660 5:109488069-109488091 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
995529132 5:113075171-113075193 AGCACCCGGGCCAGCAGCTGTGG + Intronic
995568676 5:113457280-113457302 AGCACCCGGGCCAGCGGCTGCGG + Intronic
995582631 5:113617450-113617472 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
995678906 5:114695595-114695617 AGCACCCAAGCCAGCAGCTGCGG + Intergenic
995975805 5:118033912-118033934 AGCACCCAGGCCAGCAGCTACGG + Intergenic
995988440 5:118208186-118208208 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
996107046 5:119517240-119517262 AGCACCCAGGCCAGCGGCTGCGG + Intronic
996234222 5:121107313-121107335 AGCACCCAGGCCAGCGGCTGCGG + Intergenic
996298558 5:121954164-121954186 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
996435692 5:123430683-123430705 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
996567200 5:124892552-124892574 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
996575897 5:124976339-124976361 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
997375501 5:133394489-133394511 AGCACCCGGGCCAGCAGCTGCGG + Intronic
997981912 5:138472948-138472970 AGGACCTAGGAGAGCCTCTGTGG + Intergenic
998117536 5:139549479-139549501 AGCACCCTGGCCAGCCGCTGTGG + Intronic
998318282 5:141203918-141203940 CCCACCCAGCCAAGCCACTGAGG - Intergenic
999309897 5:150545226-150545248 AGCACAAGGGCGAGGCACTGGGG - Intronic
999406182 5:151309328-151309350 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
999855283 5:155586976-155586998 AGCACCCAGGCCAGCGGCTGTGG - Intergenic
1000066033 5:157693974-157693996 AGCACCCAGGCCAGCGTCTGCGG + Intergenic
1000084739 5:157879417-157879439 AGCACCCGGGCCAGCAGCTGAGG + Intergenic
1000085862 5:157886983-157887005 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
1000902487 5:166927172-166927194 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
1001384073 5:171324024-171324046 CGCATCCAGGCAAGCAACTGGGG + Intergenic
1001389208 5:171365312-171365334 AGCAACCAGGAGAGTCATTGAGG - Intergenic
1001843560 5:174901654-174901676 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1002221743 5:177688371-177688393 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1002296648 5:178235059-178235081 AGGTCCCAGCCGAGACACTGGGG - Intergenic
1002317633 5:178354055-178354077 GGCACCCAGGCAAGGCAGTGTGG + Intronic
1002616448 5:180459305-180459327 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1002681635 5:180969695-180969717 AGGACCCAGGCCAGCAGCTGTGG - Intergenic
1002758020 6:179729-179751 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
1002789376 6:426425-426447 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1003060724 6:2860276-2860298 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1003069670 6:2935944-2935966 AGCACCCAGGCCAACAGCTGCGG + Intergenic
1003081913 6:3027837-3027859 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1003224466 6:4191515-4191537 AGCACCCAGGCCAGCAGCTGTGG - Intergenic
1003532858 6:6952473-6952495 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1003748008 6:9024402-9024424 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1003749579 6:9040895-9040917 AGCACCCAAGCCAGCAGCTGCGG + Intergenic
1003845728 6:10171860-10171882 AGCACCCGGGCCAGCGGCTGTGG + Intronic
1003862791 6:10337547-10337569 AGCACCCGGGCCAGCGGCTGTGG + Intergenic
1003947280 6:11087353-11087375 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1003956678 6:11171201-11171223 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1003982466 6:11402806-11402828 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
1004501893 6:16216956-16216978 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1004511644 6:16288390-16288412 AGCACCCGGGCCAGCAGCTGCGG + Intronic
1004607372 6:17206662-17206684 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1004689092 6:17976412-17976434 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1004866053 6:19854651-19854673 AGCACCCGGGCCAGCGGCTGAGG - Intergenic
1004883697 6:20032463-20032485 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1004912632 6:20301388-20301410 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1005059285 6:21761294-21761316 AGCACCCGGGCCAGCGGCTGTGG + Intergenic
1005117732 6:22356631-22356653 AGCACCCAGGCCAGCAGTTGCGG - Intergenic
1005554244 6:26956811-26956833 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1005596211 6:27381292-27381314 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1005707444 6:28469577-28469599 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1005978238 6:30816522-30816544 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1006005771 6:31000601-31000623 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1006007824 6:31016937-31016959 AGCACCCGGGCCAGCAGCTGCGG + Intronic
1006033636 6:31195597-31195619 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1006351104 6:33521732-33521754 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
1006434131 6:34017406-34017428 AGCACCCAGGCCAGCAGCTTCGG - Intergenic
1006497895 6:34437219-34437241 AGCATCCAGGCCAGCAGCTGCGG - Intergenic
1006518184 6:34556081-34556103 AGCACTCAGGTTGGCCACTGGGG + Exonic
1006696011 6:35931406-35931428 AGCACCCAGGCCAGCGGCTTCGG + Intergenic
1006748900 6:36364456-36364478 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1008038784 6:46774735-46774757 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1008270191 6:49482048-49482070 AGCACCCAAGCCAGCGGCTGCGG - Intronic
1008270494 6:49483641-49483663 AGCACCCAAGCCAGCGGCTGTGG - Intronic
1008308359 6:49933814-49933836 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
1008631134 6:53363680-53363702 AGCACCCTGGCCAGCAGCTGCGG - Intergenic
1009615494 6:65999590-65999612 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1010199312 6:73269098-73269120 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1010269342 6:73903295-73903317 AGCATCCAGGCCAGCAGCTGGGG + Intergenic
1010270370 6:73910124-73910146 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
1011246522 6:85326105-85326127 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1011410329 6:87059981-87060003 AGCACCCAGACCAGCAGCTGTGG - Intergenic
1011879935 6:92011969-92011991 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
1011931804 6:92723637-92723659 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
1012016585 6:93860185-93860207 TGCAACCAGGAGAGCCACAGTGG + Intergenic
1012131289 6:95497079-95497101 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1012145018 6:95670177-95670199 AGCACCCAGACCAGCAGCTGTGG + Intergenic
1012148640 6:95718218-95718240 AGCACCCTGCAGAGCCACAGGGG - Intergenic
1012760500 6:103294628-103294650 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
1013025719 6:106269630-106269652 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1013410780 6:109881367-109881389 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
1013853333 6:114541899-114541921 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1014055887 6:117014891-117014913 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1014088380 6:117373510-117373532 AGCATCCAGGCCAGCAGCTGTGG - Intronic
1014240743 6:119015460-119015482 AGCACCCGGGCCAGCGGCTGCGG + Intronic
1014718562 6:124892109-124892131 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1014739000 6:125125993-125126015 AGCACCCGGGCCAGCGGCTGCGG + Intronic
1014788470 6:125644588-125644610 AGCACCCGGGCCAGCGGCTGTGG + Intergenic
1015600345 6:134904867-134904889 AGCACCCAGGCCAGCGGCTGCGG + Intergenic
1016067370 6:139698139-139698161 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
1017298984 6:152834480-152834502 AGCACCCGGGCCAGCGGCTGTGG + Intergenic
1017325088 6:153133758-153133780 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1017537371 6:155363205-155363227 AGCACCCGGGCCAGCGGCTGTGG + Intergenic
1017839508 6:158210012-158210034 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1018064239 6:160114726-160114748 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1018545672 6:164933434-164933456 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1018624646 6:165765510-165765532 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1018696197 6:166393576-166393598 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1019065834 6:169296811-169296833 CGCCCCCCGGCCAGCCACTGTGG - Intergenic
1019323637 7:426662-426684 TGCACCCAGGGGAGTCTCTGAGG - Intergenic
1019456803 7:1132403-1132425 AAAACCCAGGCTAGGCACTGTGG + Intronic
1020430720 7:8113866-8113888 AGCCCCCAGGGGAGCTGCTGGGG + Exonic
1020784438 7:12556383-12556405 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1021133871 7:16943125-16943147 AGCACCCAGGCTAGCAGCTGTGG + Intergenic
1021686767 7:23193957-23193979 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1022248507 7:28584215-28584237 ATCTCCCAGGCGAGGCCCTGTGG + Intronic
1022750434 7:33219110-33219132 AGCACCCAGGCCAGCAGCTGCGG + Intronic
1023396205 7:39754164-39754186 AGCAGCCAGGCCAGCAGCTGTGG - Intergenic
1023895515 7:44429724-44429746 CTCACACAGGCGGGCCACTGTGG + Intronic
1024269078 7:47628613-47628635 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1024335637 7:48203137-48203159 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1024700637 7:51901119-51901141 AGCACCCAAGCCAGCGGCTGCGG - Intergenic
1024834046 7:53495157-53495179 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1026335896 7:69393963-69393985 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1026512341 7:71037730-71037752 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1026596558 7:71738303-71738325 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1027564039 7:79768188-79768210 AGCACCCGGGCCAGCGGCTGAGG - Intergenic
1027579712 7:79977827-79977849 AGCACCCGGGCCAGCGGCTGGGG - Intergenic
1027674470 7:81141874-81141896 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1027868098 7:83673454-83673476 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1028058740 7:86282384-86282406 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
1028511221 7:91627617-91627639 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1028852518 7:95552687-95552709 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
1028989500 7:97034475-97034497 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
1029065347 7:97843090-97843112 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1029255832 7:99268866-99268888 AGCACCTAACTGAGCCACTGTGG - Intergenic
1029567508 7:101348711-101348733 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1029852333 7:103476037-103476059 AGCACCCAGGCCAGGCACAGTGG - Intronic
1030599982 7:111582167-111582189 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1030780414 7:113593455-113593477 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1031378798 7:121060105-121060127 AGCACCCGGGCCAGCGGCTGCGG + Intronic
1031409205 7:121421865-121421887 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
1032339646 7:131058899-131058921 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
1032393208 7:131570115-131570137 ATTACCCGGGTGAGCCACTGTGG + Intergenic
1032437117 7:131909463-131909485 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
1033394092 7:140957179-140957201 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
1033445386 7:141417149-141417171 ATCATCCAGGAGAGACACTGTGG + Intronic
1033779320 7:144650556-144650578 AGCAACCAGGCCAGCAGCTGCGG + Intronic
1033839926 7:145360861-145360883 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
1034097911 7:148426544-148426566 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1034107255 7:148501019-148501041 TGCCTCCAGGCGAGCCACTGGGG + Intergenic
1034155016 7:148949217-148949239 AGCACCCGGGCCAGTGACTGCGG + Intergenic
1034167759 7:149038922-149038944 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1034400564 7:150858933-150858955 AGCCCCCAGGAGAACCCCTGGGG + Exonic
1035151186 7:156874228-156874250 AGCACCCAGGCCAGTGGCTGCGG - Intronic
1035325413 7:158062707-158062729 AGCACCCAGGCCAGCAGCTGCGG + Intronic
1035463902 7:159063364-159063386 AGCACCCGGGCCAGCAGCTGTGG - Intronic
1036928652 8:12931529-12931551 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1036952519 8:13154422-13154444 AGCACGCAGGCCAGCAGCTGCGG - Intronic
1037065019 8:14566975-14566997 AGCACCCGGGCCAGCAGCTGCGG + Intronic
1037425610 8:18751267-18751289 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1037612402 8:20487294-20487316 AGCACTCAGTTGACCCACTGAGG - Intergenic
1037810973 8:22086690-22086712 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1037957554 8:23071010-23071032 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1038638277 8:29304389-29304411 AGCACCCAGGCCAGCGGCTGCGG + Intergenic
1038639401 8:29311601-29311623 AGCACCCAGGCCAGCGGCTGCGG + Intergenic
1038813658 8:30878672-30878694 AGCACGCAGGCCAGGCACAGTGG - Intronic
1039068730 8:33631813-33631835 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
1039069114 8:33634057-33634079 AGCACCCGGGCCAGCGGCTGTGG - Intergenic
1039284862 8:36028962-36028984 AGCACCCAGGCCAGTGGCTGCGG + Intergenic
1040806837 8:51405031-51405053 AGCACCCGGGCCAGCAGCTGCGG - Intronic
1040879878 8:52192996-52193018 AGCACCCAAGTGATCCACTGGGG + Intronic
1040954924 8:52970072-52970094 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
1041031869 8:53745105-53745127 AGGACCCAGGCCAGGCACAGTGG + Intronic
1041034661 8:53776123-53776145 AGCACCCGGGCCAGCTGCTGCGG - Intronic
1042512566 8:69626696-69626718 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1043073350 8:75665689-75665711 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
1043129938 8:76447838-76447860 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1043346461 8:79303630-79303652 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1043352491 8:79377429-79377451 AGCACCCAGGCCAGTGGCTGCGG - Intergenic
1043435323 8:80231944-80231966 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1043621033 8:82192475-82192497 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1044075819 8:87820970-87820992 AGCACCCGGGCCAGCGGCTGTGG + Intergenic
1044441644 8:92230911-92230933 AGCACCCGGGCCAGCATCTGCGG + Intergenic
1044788682 8:95823774-95823796 AGCACCCAGGCCAGCGGCTGCGG + Intergenic
1044880667 8:96719311-96719333 AGCACCCAGGCCAGTGGCTGCGG - Intronic
1045096213 8:98800723-98800745 AGCACCCGGGCCAGCAGCTGCGG + Intronic
1045232328 8:100316999-100317021 AGCACCCGGGCCAGCGGCTGCGG - Intronic
1045678413 8:104633109-104633131 AGCACCCGGGCCAGCAGCTGTGG - Intronic
1046208892 8:111041062-111041084 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
1046251878 8:111642962-111642984 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
1046288903 8:112132827-112132849 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1046661201 8:116949970-116949992 AGCACCCGGGCTAGCAGCTGCGG - Intergenic
1046958035 8:120081783-120081805 AGCATTCAGGCCAGGCACTGTGG - Intronic
1047124734 8:121948173-121948195 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1047631706 8:126714861-126714883 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1048112851 8:131487166-131487188 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
1048676966 8:136794025-136794047 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1048757501 8:137755345-137755367 AGCACCCGGGCCAGCGGCTGTGG - Intergenic
1049087640 8:140490739-140490761 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1049162036 8:141103803-141103825 AGGCCCCAGGTGAGGCACTGAGG - Intergenic
1049304101 8:141890082-141890104 AGCCCCCAGGTGAACCAATGTGG + Intergenic
1049746035 8:144263707-144263729 GGCCCCCAGGAGAGACACTGAGG + Exonic
1049789846 8:144467524-144467546 CAGTCCCAGGCGAGCCACTGGGG + Exonic
1050091021 9:2016520-2016542 GGGACCCAGGAGAGCCACGGCGG + Intronic
1050173938 9:2850815-2850837 AGAACCTAGGCGATCCACTTAGG - Intergenic
1051314194 9:15810628-15810650 AGCACCCAGGCCAGCAGCTGCGG - Intronic
1051383301 9:16480643-16480665 AGCACCCGGGCCAGCGGCTGCGG + Intronic
1051439855 9:17072740-17072762 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1051459434 9:17295058-17295080 AGCACCCAGGCCAGCAGCCGCGG - Intronic
1051929061 9:22363697-22363719 AGCACCCTGGCCAGCAGCTGCGG - Intergenic
1052014845 9:23452169-23452191 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
1052122790 9:24738672-24738694 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1053027288 9:34740461-34740483 AGCACCCAGGCCAGCGGCTGTGG - Intergenic
1053393406 9:37752013-37752035 AGCACCCAGGCCAGCAGCTGCGG + Intronic
1053791308 9:41688186-41688208 TGCACCCAGGTGAGCCAGTCAGG + Intergenic
1054153847 9:61626586-61626608 TGCACCCAGGTGAGCCAGTCAGG - Intergenic
1054179656 9:61899880-61899902 TGCACCCAGGTGAGCCAGTCAGG + Intergenic
1054473633 9:65557706-65557728 TGCACCCAGGTGAGCCAGTCAGG - Intergenic
1054657882 9:67680941-67680963 TGCACCCAGGTGAGCCAGTCAGG - Intergenic
1055557581 9:77490608-77490630 AGCACCCAGGCCAGTGGCTGCGG - Intronic
1056305761 9:85289181-85289203 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1056743746 9:89282561-89282583 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1056799434 9:89681226-89681248 AGCACCCTGGCCAGCAGCTGTGG + Intergenic
1057118159 9:92545384-92545406 AGCACCCCGGCCAGCAGCTGCGG + Intronic
1058286560 9:103187038-103187060 AGCACCCCGGCCAGCGGCTGTGG + Intergenic
1058727523 9:107817929-107817951 AGCACCCAGGCCAGCAGCTGCGG + Intergenic
1058786493 9:108393649-108393671 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
1058799362 9:108530280-108530302 AGCACCCAGGCCAGCAGCTGTGG + Intergenic
1060018119 9:120104773-120104795 AGCAACCAGGAGAGCCTCTGTGG - Intergenic
1060352930 9:122875305-122875327 AGTGCCCAAGCTAGCCACTGAGG + Intronic
1061254441 9:129446029-129446051 AGGACACAGGCGAGCCAGGGAGG - Intergenic
1061429786 9:130523788-130523810 TGCACCCTGGTGAGCCCCTGAGG + Intergenic
1062132641 9:134908138-134908160 AGCACCCAAAGGAGTCACTGCGG - Intronic
1062662181 9:137643169-137643191 AGCACCAAGGCCAGGCACGGTGG - Intronic
1185813430 X:3131580-3131602 AGCACCAAGGTGCTCCACTGTGG - Intergenic
1185839901 X:3379302-3379324 AGCACCCAATCAAGCCAGTGAGG + Intergenic
1186785626 X:12954087-12954109 AGGACCCAGGCCGACCACTGAGG + Intergenic
1187139045 X:16575588-16575610 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1187904010 X:24049827-24049849 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1189187888 X:39070032-39070054 AGCACCCAGCCCAGGCACTCTGG + Intergenic
1189467121 X:41285934-41285956 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
1190114066 X:47614236-47614258 GGCACCCAGGGGATCCACTTGGG + Intronic
1190413970 X:50163556-50163578 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1192022459 X:67408796-67408818 AGCACCCAGCCCAGCAGCTGTGG + Intergenic
1192448823 X:71230153-71230175 AGCACACAGGCCAGGCACAGTGG + Intergenic
1193538163 X:82738429-82738451 AGCACCCGGGCCAGCAGCTGCGG - Intergenic
1194121209 X:89965872-89965894 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1194204460 X:90995541-90995563 AGCACCCGGGCCAGCAGCTGTGG + Intergenic
1194340459 X:92699706-92699728 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
1195369971 X:104163953-104163975 AGGTCCCAGGCGAGGCACGGTGG - Intergenic
1195896374 X:109749546-109749568 AGCACCCGGGCCAGCATCTGCGG - Intergenic
1196319536 X:114270786-114270808 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1196582689 X:117394816-117394838 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1196705917 X:118717162-118717184 AGCACCCAGGCCAGCGGCTGCGG - Intergenic
1196845057 X:119890726-119890748 AGCACCCGGGCCAGCGGCTGCGG + Intergenic
1196860868 X:120026011-120026033 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
1197340047 X:125255782-125255804 AGCACTCAGGCCAGCGGCTGCGG + Intergenic
1197376806 X:125690806-125690828 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1198256129 X:134925779-134925801 AGCACCCCGGCCAGCAGCTGCGG + Intergenic
1198299981 X:135325589-135325611 AGCACCCGGGCCAGCGGCTGTGG + Intronic
1200470911 Y:3584323-3584345 AGCACCCAGGCCAGCAGCTGCGG - Intergenic
1200474066 Y:3623323-3623345 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1200550300 Y:4570982-4571004 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1200648818 Y:5816442-5816464 AGCACCCGGGCCAGCAGCTGTGG - Intergenic
1201285486 Y:12375235-12375257 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1201423047 Y:13820431-13820453 AGCACCCGGGCCAGCGGCTGCGG - Intergenic
1201715797 Y:17043241-17043263 AGCACCCGGGCCAGCAGCTGCGG + Intergenic
1201901114 Y:19046792-19046814 AGCACCCAGGCCAGCAACTGCGG - Intergenic
1202589453 Y:26467077-26467099 AGCAGCCAGGCCAGGCACAGTGG - Intergenic