ID: 1151694073

View in Genome Browser
Species Human (GRCh38)
Location 17:75705217-75705239
Sequence ACCTATTAGGTCCCACGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151694064_1151694073 13 Left 1151694064 17:75705181-75705203 CCTCCAGAGCTGCCCTCAGTGGC 0: 1
1: 0
2: 4
3: 64
4: 393
Right 1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1151694068_1151694073 1 Left 1151694068 17:75705193-75705215 CCCTCAGTGGCTCGCCTGGGTGC 0: 1
1: 0
2: 1
3: 23
4: 148
Right 1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1151694069_1151694073 0 Left 1151694069 17:75705194-75705216 CCTCAGTGGCTCGCCTGGGTGCT 0: 1
1: 0
2: 4
3: 165
4: 762
Right 1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1151694065_1151694073 10 Left 1151694065 17:75705184-75705206 CCAGAGCTGCCCTCAGTGGCTCG 0: 1
1: 0
2: 1
3: 24
4: 253
Right 1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG 0: 1
1: 0
2: 0
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151694073 Original CRISPR ACCTATTAGGTCCCACGTTA GGG Intronic
904356798 1:29945482-29945504 ACCTATTACGTGCCAGGTTCTGG - Intergenic
904820395 1:33239281-33239303 CCCTATTAGGGCCCACGTTTGGG - Intergenic
1066508880 10:36073371-36073393 ATCTATTAGGAGCCACGTTCTGG - Intergenic
1074733539 10:116403090-116403112 ACCTATTAGGTTATAAGTTAAGG - Intergenic
1089090635 11:115871871-115871893 ACCTCTCAGGTCCCACCTTCTGG - Intergenic
1099413635 12:82361352-82361374 ACCTAGTGGATCCCACGTTGGGG + Intronic
1101853816 12:108425661-108425683 ACACATTAGGTCCCACCTTGAGG + Intergenic
1114517695 14:23310500-23310522 GCCAATTTGGTCCCACGTTCTGG - Exonic
1127309093 15:57736269-57736291 ACTTATTAGGACCTACATTAAGG + Intronic
1147345782 17:39793657-39793679 GACCATTAGGTCCCAAGTTAGGG + Intronic
1149553306 17:57555707-57555729 ACCTATTATGTCCCAGGTACTGG - Intronic
1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG + Intronic
1157911181 18:51618675-51618697 ACCATTTAGCTCCCACTTTAAGG + Intergenic
1160198348 18:76776072-76776094 ACCGATGTGGTCCCACGTTGTGG - Intergenic
1166605881 19:44142099-44142121 ACCTGTTAGGTCCCCCGGTGGGG + Intronic
1167150933 19:47709220-47709242 GCCTATTAGTTCCCACGCTGGGG - Intergenic
930538712 2:52677845-52677867 ACTTATTAGGACTCACTTTAGGG + Intergenic
940137466 2:150455005-150455027 ACCTATTAGGTTCCAGGTACTGG + Intergenic
1169223744 20:3842875-3842897 CCCTATTACGTCCCACATCATGG + Intergenic
967511651 3:190320351-190320373 GCATTTTAGGTACCACGTTAAGG - Intronic
974874401 4:67685627-67685649 TCCCATTAGGTCCTACGTAACGG - Intronic
992214391 5:74511076-74511098 TCCTATTAGGTGCCAATTTAGGG + Intergenic
992493864 5:77272239-77272261 ATCTATTAGTTCACAGGTTATGG + Intronic
995609281 5:113891724-113891746 ACCTAGGAAGTCCCATGTTAGGG - Intergenic
1004277131 6:14247082-14247104 ACCTGTTAGGGCACACGTGATGG + Intergenic
1005264979 6:24102169-24102191 ACCCTTCAGCTCCCACGTTAAGG - Intergenic
1013264103 6:108477716-108477738 CCCTAGTAGGTCCAATGTTATGG - Intronic
1013674295 6:112440317-112440339 AGCTATTAGGGTCCACTTTATGG + Intergenic
1025575204 7:62629837-62629859 ACATATTTGGTGCCACGTTGAGG - Intergenic
1029573855 7:101390125-101390147 ACCTTTTAGGTCTCATGTTAAGG + Intronic
1034076700 7:148238651-148238673 AACTACAAGGTCCAACGTTAAGG + Intronic
1039582740 8:38680335-38680357 GACTCTTAGGTCCCACTTTAAGG + Intergenic
1042826766 8:72987351-72987373 AACTATTTGGTCACAAGTTAAGG + Intergenic
1057430732 9:94991257-94991279 ACCTATTTGGTACCACATAATGG - Intronic
1199094763 X:143726171-143726193 ACCTAGTGGATCCCACGCTAGGG + Intergenic