ID: 1151694619

View in Genome Browser
Species Human (GRCh38)
Location 17:75707827-75707849
Sequence AGGGCACTGTGGATGTTTTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151694611_1151694619 1 Left 1151694611 17:75707803-75707825 CCGATGGCGGCCCCTCATTGGCC 0: 1
1: 0
2: 1
3: 13
4: 104
Right 1151694619 17:75707827-75707849 AGGGCACTGTGGATGTTTTGTGG 0: 1
1: 0
2: 4
3: 29
4: 219
1151694615_1151694619 -10 Left 1151694615 17:75707814-75707836 CCCTCATTGGCCAAGGGCACTGT 0: 1
1: 0
2: 4
3: 9
4: 132
Right 1151694619 17:75707827-75707849 AGGGCACTGTGGATGTTTTGTGG 0: 1
1: 0
2: 4
3: 29
4: 219
1151694608_1151694619 11 Left 1151694608 17:75707793-75707815 CCTGTGACCTCCGATGGCGGCCC 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1151694619 17:75707827-75707849 AGGGCACTGTGGATGTTTTGTGG 0: 1
1: 0
2: 4
3: 29
4: 219
1151694609_1151694619 4 Left 1151694609 17:75707800-75707822 CCTCCGATGGCGGCCCCTCATTG 0: 1
1: 0
2: 0
3: 6
4: 38
Right 1151694619 17:75707827-75707849 AGGGCACTGTGGATGTTTTGTGG 0: 1
1: 0
2: 4
3: 29
4: 219
1151694614_1151694619 -9 Left 1151694614 17:75707813-75707835 CCCCTCATTGGCCAAGGGCACTG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 1151694619 17:75707827-75707849 AGGGCACTGTGGATGTTTTGTGG 0: 1
1: 0
2: 4
3: 29
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151694619 Original CRISPR AGGGCACTGTGGATGTTTTG TGG Exonic
900820351 1:4881845-4881867 AGGGCACTGTCAATCTTTAGCGG - Intergenic
902325188 1:15695502-15695524 GGGGCACTTTGGGTTTTTTGGGG + Intronic
903171091 1:21554199-21554221 AGGGCAGTGTCTATGTTTTAAGG + Intronic
903925749 1:26829311-26829333 AGGGCACTCTGGCTGTTGTGTGG - Intronic
904779767 1:32937005-32937027 AGGTCACTGCGGATGCTTTCAGG + Exonic
904882289 1:33710107-33710129 ACTGCACTGTGGATCCTTTGGGG + Intronic
904892225 1:33788115-33788137 AGGGCCTTCTGGTTGTTTTGAGG - Intronic
905111944 1:35601851-35601873 GGAACAATGTGGATGTTTTGTGG - Exonic
905256150 1:36686769-36686791 AGAGCTCTGTGGATGCTTGGAGG + Intergenic
907371272 1:54005124-54005146 AGAGGCCTGTGGATGGTTTGGGG + Intergenic
908026564 1:59958289-59958311 AGGGCACAGTGGAAGGATTGGGG - Intergenic
909943190 1:81634306-81634328 AGATCACTGTGGATTTTTTGTGG - Intronic
910126842 1:83851855-83851877 AATGCACTATGGATGTTTTCTGG - Intergenic
910526406 1:88183880-88183902 TGGGAACTGTTGATCTTTTGAGG + Intergenic
912583445 1:110739884-110739906 AGGGCAATGTGGAAGTCTTCTGG - Intergenic
915249682 1:154579198-154579220 AGGGCTCTTTGGATGGTTTGGGG + Exonic
917210128 1:172622672-172622694 AGGGAAATGTGTGTGTTTTGAGG - Intergenic
918170140 1:181988638-181988660 AGGGCACAGTGGAAGGTTTGGGG - Intergenic
918850095 1:189677247-189677269 AGGGAAGTGTGGATGATTTTAGG - Intergenic
919758062 1:201078212-201078234 AAGGCACCATGGATGTTTTTTGG + Intronic
920035859 1:203065020-203065042 AGGGCTCTGTGGATGTCCTGTGG + Intronic
920398168 1:205661220-205661242 TGGGCACTGTGTAAGTTGTGGGG - Intronic
920703014 1:208232025-208232047 TGGGCCCTGTGAATGTTTAGAGG + Intronic
922793507 1:228323992-228324014 AGGGCATGGTGAATGGTTTGTGG + Intronic
923298145 1:232615033-232615055 AGTACACTGTGGATGTTATGAGG + Intergenic
924310959 1:242742706-242742728 AGGTTACTGTGGTTGTTTTGTGG + Intergenic
924640698 1:245830859-245830881 TGGGCACTGTGGAGGTTAGGAGG - Intronic
1063239547 10:4153766-4153788 GGTGGACTGTGGAGGTTTTGAGG - Intergenic
1063598451 10:7458710-7458732 AGGGCACTGTGCAAGGGTTGGGG - Intergenic
1066291207 10:34016021-34016043 AGTGCACTGTGGAGGGTGTGGGG - Intergenic
1067209111 10:44243625-44243647 AGGGCCCTGGGTATGTGTTGAGG - Intergenic
1068568741 10:58605278-58605300 AGGGAACAGAGTATGTTTTGTGG - Intronic
1068959596 10:62853154-62853176 AGGGCACTGTGGTTCCTGTGTGG - Intronic
1068979094 10:63042522-63042544 AGGGCCACGTGTATGTTTTGGGG - Intergenic
1070016206 10:72534551-72534573 AGGGTGCTGTGGGAGTTTTGAGG + Intronic
1072423900 10:95313265-95313287 AGGGTACTGTGGCTGTCTGGTGG + Exonic
1072436586 10:95419629-95419651 AGTGCACTGTTGATGCTCTGGGG - Intronic
1074763260 10:116683163-116683185 AGGGCTCTGTGGGTGTGTCGAGG - Intronic
1076288234 10:129322344-129322366 AGTTCATTGTGCATGTTTTGGGG - Intergenic
1080775641 11:35383831-35383853 AGGGCAGTGCTGATATTTTGAGG + Intronic
1081306971 11:41524489-41524511 AGTGCACTGTGTGTGTTTTGAGG + Intergenic
1082027734 11:47585206-47585228 AGGCCAGTGTGGATCATTTGAGG - Intergenic
1082166057 11:48952534-48952556 AATGCACTGTGTATGGTTTGAGG - Intergenic
1082237143 11:49832479-49832501 AATGCACTGTGTATGGTTTGAGG + Intergenic
1082241554 11:49877278-49877300 AATGCACTGTGTATGGTTTGAGG - Intergenic
1082610525 11:55291401-55291423 AATGCACTGTGTATGGTTTGAGG + Intergenic
1083579826 11:63817939-63817961 CGGGCACTGTGCATGGTGTGTGG + Exonic
1084498910 11:69523110-69523132 AGGGCATTATGGCTGTTGTGAGG + Intergenic
1085251755 11:75148533-75148555 AGGGCTCTGTGAATGTTATGGGG + Intronic
1086697574 11:89863531-89863553 AATGCACTGTGTATGGTTTGAGG - Intergenic
1086708585 11:89980957-89980979 AATGCACTGTGTATGGTTTGAGG + Intergenic
1089744390 11:120606877-120606899 AGGGGAATCTGCATGTTTTGAGG + Intronic
1093227867 12:16507272-16507294 AGGGCAGTGTGTATGTGGTGGGG + Intronic
1095656228 12:44672438-44672460 AGGGCTCTGGGGATGGTTTCGGG - Intronic
1096589990 12:52651761-52651783 AGGCCGCTTTGGAGGTTTTGGGG - Exonic
1096670505 12:53195763-53195785 AGGGCACCTTGCATGTTGTGGGG - Intronic
1100612917 12:96206771-96206793 AGGGCAGCGAGGATGCTTTGGGG + Intronic
1102263162 12:111457802-111457824 CGGGCACTGTGTATGGTATGTGG + Intronic
1102520421 12:113474679-113474701 AGGGCACTTTGCATATTTTGTGG - Intergenic
1103813554 12:123634938-123634960 AGATCACTGTGGCTGTTGTGTGG + Intronic
1104143838 12:126013241-126013263 AGGACACTGTGAATTTTTTTAGG + Intergenic
1106850745 13:33787958-33787980 AGGGCACAAGGGATCTTTTGGGG + Intergenic
1109220717 13:59638457-59638479 AGGGAAATGTGGATGATCTGGGG + Intergenic
1109942264 13:69385394-69385416 AGGCCACTGTAGTTGTTTGGTGG - Intergenic
1110757624 13:79194481-79194503 ATAGCACTGCGGATGTTCTGTGG - Intergenic
1112294071 13:98171108-98171130 AGGGGACTGTGGAGGTTTCCTGG + Intronic
1114330043 14:21627534-21627556 AGAGGCCTGTGCATGTTTTGTGG + Intergenic
1116450532 14:45059865-45059887 ATGTCAATGTGGCTGTTTTGTGG - Intronic
1119303432 14:73588995-73589017 AGGGAACTATGCAAGTTTTGGGG - Intergenic
1120786488 14:88542347-88542369 AGGGAACTGATGGTGTTTTGGGG - Intronic
1121324100 14:93009847-93009869 ATGGCACTGTGGGTGGTGTGAGG - Intronic
1121410461 14:93745415-93745437 AGGGCAGAGAGGATGTTTTCAGG - Intronic
1124423569 15:29542671-29542693 AGAGCTCTGTGCATGTTTGGTGG - Intronic
1128249078 15:66152251-66152273 AGGGCACTAGGGATGCATTGAGG - Intronic
1130978137 15:88792859-88792881 TGGGCACAGTGGGGGTTTTGTGG - Intergenic
1131558540 15:93419826-93419848 AGGCTACTGTGCTTGTTTTGGGG + Intergenic
1131717945 15:95133775-95133797 CGGGCACGGTGGATCATTTGAGG + Intergenic
1134838207 16:17379561-17379583 AGGCCACTGGGCATGTTGTGGGG + Intronic
1135385467 16:22035581-22035603 AGGTTTCTGTGGAGGTTTTGAGG + Intronic
1135853853 16:25988383-25988405 GTGGGACTGTGGATGTTTTTTGG + Intronic
1136085674 16:27883194-27883216 TGGGCACTGTGCTTGTTTGGGGG - Intronic
1137622333 16:49884086-49884108 AGGTCCCTCTGGCTGTTTTGTGG - Intergenic
1137955537 16:52825285-52825307 AGATCACTCTGGATGTTTTGTGG - Intergenic
1140805399 16:78527902-78527924 TGGGCACTGCTGATATTTTGTGG - Intronic
1146470715 17:33122130-33122152 AGCAGACTGTGGATGGTTTGTGG - Intronic
1146485963 17:33242813-33242835 AGGGCACTTTGCTTATTTTGTGG + Intronic
1147816718 17:43215887-43215909 AGGCCACTGTGGAGGAGTTGAGG - Exonic
1150129905 17:62663448-62663470 AGGGCACGGTGCTTCTTTTGGGG - Intronic
1150131207 17:62670243-62670265 TGGGAAATGTGGATGCTTTGGGG - Intronic
1150342414 17:64379147-64379169 TGAGCATTGTGGCTGTTTTGAGG - Intronic
1151694619 17:75707827-75707849 AGGGCACTGTGGATGTTTTGTGG + Exonic
1155158156 18:23175194-23175216 AGAGCAGTGTAGCTGTTTTGAGG - Intronic
1157277535 18:46322404-46322426 AAGGCACTGTGCCTGATTTGAGG + Intergenic
1158203233 18:54962749-54962771 AGGGCACTCTGGGTGGTTTGGGG - Intergenic
1158705008 18:59784431-59784453 AGGGGAAAGTGGATGGTTTGAGG + Intergenic
1159475558 18:68916537-68916559 AGGGAAATGTGGATGTTTTGTGG + Intronic
1160388088 18:78509849-78509871 GAGGCACTTTGGATGATTTGAGG - Intergenic
1162005029 19:7772571-7772593 AGGCGAATGTGAATGTTTTGGGG + Intergenic
1163647791 19:18499877-18499899 AGGTCACTGAGCATGTTCTGTGG - Intronic
1165201511 19:34148737-34148759 ATGGAACTCTGGAGGTTTTGGGG - Intergenic
1166674413 19:44731070-44731092 AGGGCACAGTGGACCTTTTCCGG + Intergenic
1166916028 19:46196612-46196634 AGGGCAATGTGGTTGTTTCCTGG - Intergenic
1166925010 19:46261177-46261199 AGGGCAATGTGGTTGTTTCCTGG + Intergenic
1168034380 19:53707420-53707442 CTGGCACTGTGGATTTTTTGTGG - Intergenic
1168374101 19:55861022-55861044 TTGGCACTGGTGATGTTTTGGGG + Intronic
1168709627 19:58491524-58491546 AGGGCACTGGGCATGGTGTGGGG + Intronic
925887048 2:8402069-8402091 ATTGCATTGTGGATGTTTTGTGG - Intergenic
925932928 2:8724553-8724575 AAGGCACTGTGTAGGATTTGTGG + Intergenic
928499563 2:31876027-31876049 AGGTCACTGTGGTAGTTGTGTGG - Intronic
929999132 2:46849243-46849265 ATGGGACTGTGGATGGATTGAGG - Intronic
930341727 2:50124596-50124618 AGGGCACAATGGAAGTTTTGGGG - Intronic
930883390 2:56297266-56297288 AGAGGACTGTGGATGAGTTGGGG + Intronic
931172529 2:59818921-59818943 AGGGCTCTGTTGATGTGGTGAGG - Intergenic
931810308 2:65848463-65848485 AGGTCACTCTGGTTGTTGTGTGG + Intergenic
932035671 2:68244391-68244413 AGGGAACTGGGGTGGTTTTGAGG - Intronic
933050870 2:77600389-77600411 AAGGCATTATGGATGTGTTGGGG + Intergenic
933665005 2:84957778-84957800 AGGGCTCTCTGGATGCTTAGAGG - Intergenic
935396372 2:102613732-102613754 AGGGAAGTGTGGATGATTTTAGG - Intergenic
939202397 2:139054263-139054285 TAGGCACTGTGGTGGTTTTGAGG + Intergenic
941003194 2:160222134-160222156 AGGGCACTGTGAGTGTCATGAGG - Intronic
944047550 2:195430186-195430208 AGGGCTCTGTGTATGTTATAAGG + Intergenic
944260684 2:197673009-197673031 AGGGCACTGTGGATTTTCAGAGG + Intronic
944686588 2:202123044-202123066 AGTGCAGTGTGGCTGTTTTCTGG + Intronic
948184588 2:236010725-236010747 AGGGCTCTGTGTGTGTTTTCCGG + Intronic
949043846 2:241861320-241861342 TGGGGACTGTGTATGTTTTGGGG - Intergenic
1168786547 20:544457-544479 AGTGCTTTGTGGCTGTTTTGGGG - Intergenic
1168973338 20:1945949-1945971 AGGGCACTGTGGAGTTGATGGGG - Intergenic
1169326724 20:4682657-4682679 AGTCCACTCTGGTTGTTTTGTGG - Intergenic
1170242720 20:14186933-14186955 AGGGCACTGGGGACTATTTGAGG + Intronic
1170609427 20:17900223-17900245 AGGGGACTGTCCTTGTTTTGGGG - Intergenic
1171005539 20:21461962-21461984 ATGCCACTGAGGATGTGTTGGGG + Intergenic
1171442658 20:25177832-25177854 AGGGGACTGTGGCTGTGTAGGGG + Intergenic
1174283459 20:49455750-49455772 TGTGCACTGTGGATGTTTAGCGG + Intronic
1174736352 20:52969390-52969412 AGGGCAGGGTGGATGGTTTTGGG + Intergenic
1175353540 20:58344076-58344098 AGAGCACTGTGTATAATTTGGGG + Intronic
1175947908 20:62567238-62567260 AGGACACTGTGGCTGTTTCCTGG + Intronic
1179159693 21:38884100-38884122 GGGGAAATGTGGATGGTTTGAGG - Intergenic
1180952712 22:19727911-19727933 GGGGCAGTGAGGATGCTTTGGGG + Intergenic
1181621600 22:24095205-24095227 AGGGCACAGTGGGTGGTATGAGG - Intronic
1183001905 22:34867209-34867231 AAGGGACTGTGTAAGTTTTGTGG - Intergenic
1185286110 22:50000565-50000587 AGTGCACTTTGGCTGCTTTGCGG - Exonic
950881035 3:16322800-16322822 AGGGCCCTGGGGATCTCTTGAGG + Intronic
950975512 3:17238690-17238712 AGGGAACTGTGTCTATTTTGGGG - Intronic
951394287 3:22146040-22146062 AGGGCCCTGCGGATGTGTTGTGG - Intronic
951754043 3:26069627-26069649 AGGGCAGTGGGGATAGTTTGTGG - Intergenic
952036211 3:29205023-29205045 AGGACTCTGTGGTTGTTTTTTGG + Intergenic
953087388 3:39683318-39683340 ATGGCAATGTGGAGGTTTTTTGG + Intergenic
953821979 3:46214760-46214782 AGGGCAGTGTGGATGATGTAGGG + Intronic
954882280 3:53844380-53844402 AGGGCACTGAGGCTGGTTGGTGG - Intronic
955089371 3:55734142-55734164 AGGCCACTGTATTTGTTTTGAGG - Intronic
963730761 3:148969256-148969278 AAGGCATTGTGAGTGTTTTGTGG - Intergenic
964301882 3:155296873-155296895 TGGGCTCTGTGTATGTGTTGAGG - Intergenic
965780911 3:172285084-172285106 AGGGAAATGGGCATGTTTTGGGG - Intronic
965921731 3:173925264-173925286 AAGCCACTGAGGATCTTTTGGGG + Intronic
966199731 3:177349341-177349363 AGGGCATTGTGTATGTGTTGAGG - Intergenic
967512140 3:190323984-190324006 AGGTCTCAGTGGATGTTCTGTGG + Intronic
967712796 3:192728168-192728190 AAGCCACTGAGGATATTTTGAGG + Intronic
968413254 4:406980-407002 AGGTCCATGAGGATGTTTTGAGG + Intergenic
968811314 4:2800777-2800799 AGGGCATTGGGGGTGTCTTGGGG + Intronic
969124535 4:4936674-4936696 TGGCCACTGTGGATGTTGTGGGG - Intergenic
969891073 4:10260566-10260588 ATGGCACTGTGCAAGTTTTCAGG - Intergenic
969951719 4:10843729-10843751 AGTGGACTGTGCTTGTTTTGGGG + Intergenic
970213800 4:13737814-13737836 AGGTCATTCTGGCTGTTTTGTGG + Intergenic
970433612 4:16011777-16011799 ATGACACTTTAGATGTTTTGTGG - Intronic
971483763 4:27139074-27139096 AGGGCAGTGGGGATGGTTTTGGG - Intergenic
972017073 4:34261191-34261213 AGGGCACTTTTGATGTAATGTGG + Intergenic
972780346 4:42281781-42281803 AGGGCAGTGAGGATGTTTTGTGG + Intergenic
974844526 4:67335307-67335329 AGGGAAGTGTGGATGATTTTAGG + Intergenic
974850804 4:67403294-67403316 AGGGCATGGTGCATGCTTTGGGG - Intergenic
980766391 4:137311318-137311340 AGGCTACTGTGGAGGTGTTGGGG + Intergenic
980904886 4:138938689-138938711 AGAGAACTGTGGATGTTTTAAGG + Intergenic
981994459 4:150960963-150960985 AGAGCACTGTTACTGTTTTGAGG - Intronic
983950769 4:173638636-173638658 AGGGCACTGTAGTTTTTTTAGGG - Intergenic
983980227 4:173986772-173986794 AGGGCACTTGGAATGTTTTGAGG - Intergenic
986276636 5:6281008-6281030 AGCTCACTGTAGATATTTTGGGG - Intergenic
986402026 5:7392124-7392146 AGAGCCCTGTGGATGTTGAGAGG + Intergenic
988337518 5:29925756-29925778 AGAGTACTGTGGATTTTTTGAGG + Intergenic
988851550 5:35185967-35185989 AAGGCTCAGTGGGTGTTTTGAGG - Intronic
989292376 5:39784531-39784553 ATGGGTATGTGGATGTTTTGGGG + Intergenic
990879431 5:60522831-60522853 AGGGAACTGTGGCTGACTTGGGG - Intergenic
991171620 5:63633169-63633191 ATGCCACTGTGATTGTTTTGGGG - Intergenic
994997704 5:107085597-107085619 AGGCCATTGTGGATATTTTGAGG + Intergenic
996824649 5:127668206-127668228 ATGGCACTCTGCATGTTTTAAGG + Intergenic
998622637 5:143811879-143811901 AGGTCACTGTGGATTCTGTGTGG + Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001465733 5:171964235-171964257 AGGGCCTGGTGGAAGTTTTGTGG - Intronic
1001856070 5:175012024-175012046 AGGGCACTGTGGCCCTTATGTGG + Intergenic
1002083364 5:176750861-176750883 AGTGCAATGAGGATGTTTTTTGG + Intergenic
1002341691 5:178520477-178520499 AGGGCTCTGTCGATGTGTTTGGG + Intronic
1003720867 6:8700797-8700819 AGGTCACTCTGGATGTTTTGGGG - Intergenic
1004588124 6:17022453-17022475 AGAGCACAGAGGATGTTTTGAGG - Intergenic
1009815853 6:68733673-68733695 AGGGCAGTGAGGATGGTTAGTGG + Intronic
1012221365 6:96653004-96653026 AGGGCACTTAGGATGGATTGGGG - Intergenic
1013026684 6:106281312-106281334 AGGGCACAGAGGAACTTTTGTGG - Intronic
1014326561 6:120003484-120003506 AGGGCAGTGTGCTTGTGTTGGGG + Intergenic
1016072095 6:139751206-139751228 AGGGCACAGGAGAGGTTTTGTGG - Intergenic
1016461155 6:144281445-144281467 AGGCCACTTTGGATGATTGGAGG - Intergenic
1016828172 6:148407166-148407188 AGAGCTCTGTGGATGGTTGGTGG - Intronic
1018410756 6:163544804-163544826 AGGGAAATGTGGGTATTTTGAGG + Intronic
1020753903 7:12176696-12176718 AGTACACTGTGGATGCCTTGCGG - Intergenic
1021647727 7:22802620-22802642 AAGACACTGTGGATGTGTGGTGG - Intergenic
1022900801 7:34809042-34809064 GGGGCTCTGTGGCTGTCTTGAGG - Intronic
1024395628 7:48863169-48863191 AGGTCACTGTGCATTTGTTGTGG + Intergenic
1024399605 7:48909111-48909133 AGGTCACTGTGCATTTGTTGTGG - Intergenic
1028501520 7:91524131-91524153 GGGAGACTGTGCATGTTTTGGGG - Intergenic
1028748571 7:94355855-94355877 AGGGCACTTAGGATGTGTTTTGG - Intergenic
1028971797 7:96867561-96867583 ATGGCAGTTTGGATGGTTTGAGG - Intergenic
1029304968 7:99612380-99612402 AGGGAGCTGTGGATGTCTTTTGG + Intergenic
1029639903 7:101814392-101814414 AGGGCACTGTGGATCTCGGGTGG - Intergenic
1032082385 7:128866163-128866185 AGGGCCCTGCGGGAGTTTTGGGG + Intronic
1032452236 7:132042950-132042972 TGGGCACTGTGGATTTTATTTGG + Intergenic
1033255495 7:139797798-139797820 AGGGCAGTGTGGCTTTTTTGAGG - Intronic
1033264974 7:139877110-139877132 AGGGCACTGTGGCCACTTTGAGG + Intronic
1034900667 7:154906244-154906266 AGGGCTCAGCAGATGTTTTGAGG + Intergenic
1035742591 8:1939439-1939461 AGGGTGCTGTGGGAGTTTTGGGG + Intronic
1037244573 8:16818201-16818223 CTGGCAGTGTGGATATTTTGGGG - Intergenic
1039730389 8:40269518-40269540 TGTGCACAGTGGAAGTTTTGGGG - Intergenic
1039762098 8:40588872-40588894 TGGGCATTGGGGTTGTTTTGAGG - Intronic
1039919402 8:41882711-41882733 AGAGCACTGGCGATGTTCTGTGG - Intronic
1040755902 8:50773459-50773481 GGGGCTCTGTGTGTGTTTTGTGG - Intronic
1041029435 8:53721314-53721336 AGGGCACTGTGGTTTTTATATGG - Intronic
1041795718 8:61745646-61745668 AGGGCCATGTGTATGTTTTGGGG + Intergenic
1041874081 8:62667674-62667696 AGATCACTGTGGATGTGGTGAGG - Intronic
1042458376 8:69032208-69032230 AGAGCAAGGTGGATTTTTTGAGG + Intergenic
1042678172 8:71346721-71346743 TGTTGACTGTGGATGTTTTGTGG + Intronic
1043154063 8:76755919-76755941 AGGGCTGTGAGGATATTTTGAGG - Intronic
1043811925 8:84752288-84752310 AGGTCACTGTGAATGCTTTGTGG - Intronic
1046667560 8:117021425-117021447 AGGACACTGTGGCTGGTTGGAGG - Intronic
1047905887 8:129472960-129472982 AGGTCAATGGGGATGTTTTTGGG - Intergenic
1048019165 8:130522361-130522383 TGGGCACAGTGGAGCTTTTGTGG - Intergenic
1048332113 8:133477931-133477953 AGGGCACTGTGGATTTAATATGG - Intronic
1051692043 9:19725191-19725213 TGAGCACTGTGGATCTTTAGCGG - Intronic
1052955424 9:34250079-34250101 AGGACACGGGGCATGTTTTGGGG + Intronic
1053286244 9:36851210-36851232 AGGGGACTGGGGATGTTGGGTGG + Intronic
1054809389 9:69422692-69422714 AGGGCCCTGTGGATGCCTTAGGG - Intergenic
1057904903 9:98975792-98975814 TTGGCTCTGTGGATGTTTAGAGG + Intronic
1058753964 9:108066863-108066885 AGGGCAGTGTGGAGGCCTTGAGG + Intergenic
1059164884 9:112068178-112068200 AGAGCACTGTGGATGTGAGGAGG + Intronic
1060236623 9:121868203-121868225 AGGGCACCGTGGAAGTATTTGGG - Intronic
1060745776 9:126129936-126129958 GGGGCTCTGGGGATGTTCTGTGG - Intergenic
1186666301 X:11720720-11720742 AAGGCACTGTGGATGGGGTGTGG + Intergenic
1186845839 X:13530146-13530168 TGGGTACTGTGGATCTTTTTGGG - Intergenic
1188152408 X:26694584-26694606 AGAGCAGTGAGGATCTTTTGTGG + Intergenic
1189701942 X:43720983-43721005 AGGGAAGGGTGTATGTTTTGGGG + Intronic
1191880577 X:65840743-65840765 AGGACACTGTGGAGGTTGGGTGG - Intergenic
1194011413 X:88566924-88566946 TGGGCTATGTGCATGTTTTGGGG - Intergenic
1194699550 X:97096802-97096824 AGTGCACTGTAGTTGTTTTTTGG - Intronic
1196002516 X:110801958-110801980 AGGGAACTGTGGATGCTTTGAGG - Intergenic
1197154633 X:123257085-123257107 AGGGTTCTGTGGGTGTTTAGAGG - Intronic
1197821751 X:130548187-130548209 AAGCCACTCTCGATGTTTTGGGG - Intergenic
1199391037 X:147279217-147279239 ATGGCACTGTGGGTGCATTGAGG - Intergenic
1199391255 X:147281908-147281930 ATGGCACTGTGGGTGCATTGAGG - Intergenic
1199391473 X:147284606-147284628 ATGGCACTGTGGGTGCATTGAGG - Intergenic