ID: 1151696609

View in Genome Browser
Species Human (GRCh38)
Location 17:75721293-75721315
Sequence GGAGCCGCAGCCCTTTCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151696602_1151696609 5 Left 1151696602 17:75721265-75721287 CCGATCGGGGCGCTGGGCGGGCG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1151696609 17:75721293-75721315 GGAGCCGCAGCCCTTTCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1151696594_1151696609 17 Left 1151696594 17:75721253-75721275 CCCCGCCGCTAGCCGATCGGGGC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1151696609 17:75721293-75721315 GGAGCCGCAGCCCTTTCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1151696592_1151696609 18 Left 1151696592 17:75721252-75721274 CCCCCGCCGCTAGCCGATCGGGG 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1151696609 17:75721293-75721315 GGAGCCGCAGCCCTTTCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1151696597_1151696609 12 Left 1151696597 17:75721258-75721280 CCGCTAGCCGATCGGGGCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1151696609 17:75721293-75721315 GGAGCCGCAGCCCTTTCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1151696586_1151696609 25 Left 1151696586 17:75721245-75721267 CCCCCGGCCCCCGCCGCTAGCCG 0: 1
1: 0
2: 0
3: 28
4: 281
Right 1151696609 17:75721293-75721315 GGAGCCGCAGCCCTTTCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1151696589_1151696609 22 Left 1151696589 17:75721248-75721270 CCGGCCCCCGCCGCTAGCCGATC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1151696609 17:75721293-75721315 GGAGCCGCAGCCCTTTCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1151696596_1151696609 15 Left 1151696596 17:75721255-75721277 CCGCCGCTAGCCGATCGGGGCGC 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1151696609 17:75721293-75721315 GGAGCCGCAGCCCTTTCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1151696587_1151696609 24 Left 1151696587 17:75721246-75721268 CCCCGGCCCCCGCCGCTAGCCGA 0: 1
1: 0
2: 1
3: 16
4: 176
Right 1151696609 17:75721293-75721315 GGAGCCGCAGCCCTTTCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1151696588_1151696609 23 Left 1151696588 17:75721247-75721269 CCCGGCCCCCGCCGCTAGCCGAT 0: 1
1: 0
2: 1
3: 8
4: 73
Right 1151696609 17:75721293-75721315 GGAGCCGCAGCCCTTTCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1151696585_1151696609 28 Left 1151696585 17:75721242-75721264 CCTCCCCCGGCCCCCGCCGCTAG 0: 1
1: 0
2: 6
3: 66
4: 776
Right 1151696609 17:75721293-75721315 GGAGCCGCAGCCCTTTCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1151696595_1151696609 16 Left 1151696595 17:75721254-75721276 CCCGCCGCTAGCCGATCGGGGCG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1151696609 17:75721293-75721315 GGAGCCGCAGCCCTTTCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151696609 Original CRISPR GGAGCCGCAGCCCTTTCCGG GGG Intergenic
910569541 1:88684430-88684452 GGAGGCGCAGCCCCTGCTGGAGG - Exonic
912209413 1:107542399-107542421 GGAGTTGCAGCCATTTCTGGGGG - Intergenic
915244162 1:154544422-154544444 GGAGCAGCAGCCCTACCTGGAGG + Exonic
916226973 1:162498030-162498052 GGAGCCGCCGCGTTTTCTGGAGG + Exonic
917925598 1:179786865-179786887 GGAGCCGAGGCCCTTTCCCGAGG + Intronic
921100211 1:211922364-211922386 TGAGCAGCAGCCCTTACCTGAGG + Intergenic
1067685608 10:48464731-48464753 GGAGCTGCCTCCCTTTCCTGGGG + Intronic
1069533931 10:69239392-69239414 GCAGCCACAGCCCTCTCCGGAGG + Intronic
1072744121 10:97928116-97928138 GGAGCCACAGCCCTTACGAGGGG + Intronic
1072927064 10:99625134-99625156 GAAGCCGCAGACCTTTGCAGTGG + Intergenic
1076186785 10:128456613-128456635 GGAGACGAAGCCCTTTCAGGAGG + Intergenic
1076541505 10:131218072-131218094 GGAGCCACAGCCAGTCCCGGTGG + Intronic
1084612155 11:70210084-70210106 GGGGCCTCAGCCCTTTCCACTGG + Intergenic
1087037823 11:93772500-93772522 AGAGCGGCAGCCCTTTGGGGAGG - Intronic
1089253105 11:117179178-117179200 GCAGCCGCAACCCGTCCCGGAGG + Exonic
1091567923 12:1661940-1661962 GGAGGCGGAGCCATTTCCCGAGG - Intergenic
1092135355 12:6143203-6143225 GAAGCTGCAGACCTTTGCGGTGG - Intergenic
1096580102 12:52579621-52579643 GCAGACGCAGCCCTTTCCCAGGG + Intergenic
1097573487 12:61360405-61360427 GAAGCCGCAGACCTTTGCAGTGG - Intergenic
1101870713 12:108563046-108563068 GAAGCCGGAGCCCGCTCCGGGGG - Intronic
1104906293 12:132215206-132215228 GGAGCCCCAGCTCTTTCTCGTGG + Intronic
1113743098 13:112724658-112724680 GAAGCTGCAGCCCTGTCCTGGGG + Intronic
1115398665 14:32935315-32935337 GGATCCTCATCCCTTTCCAGTGG + Intronic
1120727003 14:87955183-87955205 GGAGCCGATGCCCTTTTCTGAGG + Intronic
1122261958 14:100528811-100528833 GGAGCCGCACTTCTTTCTGGAGG - Intronic
1122486616 14:102086640-102086662 GGAGCCGCAGCCCGCGCGGGAGG - Intronic
1124116475 15:26847879-26847901 GGTGACACAGCCCTTTCTGGTGG + Intronic
1125920852 15:43524813-43524835 GGAGCAGAAGCCCTTCCCGGAGG + Exonic
1127270537 15:57397335-57397357 GGACCCGCAGGCCTTTGTGGAGG + Intronic
1128532279 15:68462666-68462688 GGAGAGGCAGCCCTTGCCTGTGG - Intergenic
1129235540 15:74221786-74221808 AGAGCAGCAGCCCTTCCCAGAGG + Intergenic
1132524164 16:406114-406136 GGACCCGCAGGCCTGTGCGGTGG + Intronic
1132700487 16:1220150-1220172 GGAGACGCAGCGCTGTCCGAAGG - Exonic
1138439265 16:57024498-57024520 GCAGCCCCAGCCCTTTCCCTGGG + Intronic
1139650570 16:68360114-68360136 AGAGCCGCAGCCCCACCCGGGGG + Exonic
1141299152 16:82796821-82796843 GGAGCAGCAGCTCTTTACGTAGG + Intronic
1142344519 16:89545486-89545508 GGAGCAGAAGCCCTTCCCGCTGG + Intronic
1142364069 16:89640491-89640513 GGAGCAGCAGCCCCTGCAGGCGG + Intergenic
1146284621 17:31566008-31566030 GGAGTCACAGCCTTTTCCGGGGG + Intergenic
1147652294 17:42069496-42069518 GGAGAAGCAGCCTTTTCTGGAGG - Intergenic
1151476978 17:74349679-74349701 GGAAACGGAGCCCATTCCGGGGG - Intronic
1151696609 17:75721293-75721315 GGAGCCGCAGCCCTTTCCGGGGG + Intergenic
1152008735 17:77697791-77697813 GGAGCCGCTCCCCTTTCTGCGGG - Intergenic
1152629497 17:81403937-81403959 GGAGCCGCCGCGCTTTCTGTAGG + Intronic
1160543463 18:79638088-79638110 GGAGCAGGAGTCCTTCCCGGAGG - Intergenic
1160876733 19:1300008-1300030 GGGGCCGCAGCCGGGTCCGGAGG - Exonic
1161771707 19:6234299-6234321 GGAGGGGGAGCCCTGTCCGGAGG + Intronic
1162744855 19:12792494-12792516 GGAACCGCAGACCGTGCCGGAGG + Exonic
1163726955 19:18928385-18928407 GGGGCAGCAGCCCTTCCCGGGGG + Exonic
1165956398 19:39504335-39504357 GGAGCCACAGCCCTCTCCCTGGG + Intronic
1166220890 19:41363792-41363814 GGAGCCATAGCCCCTTCGGGCGG - Intronic
1166352687 19:42207509-42207531 GCAGCCTCAGCCCTTTGCAGGGG + Intronic
1166688525 19:44809731-44809753 GGTGCTCCAGCCCTTTCCTGAGG - Intronic
925333771 2:3078120-3078142 GGAGAACCAGACCTTTCCGGGGG + Intergenic
925886289 2:8395953-8395975 GGAGCTGCAGACCCTTCAGGTGG - Intergenic
927214203 2:20657617-20657639 GAGGCCGCAGCCCTTTGCAGGGG + Intergenic
929979959 2:46669064-46669086 GGAGCAGCAGCCATTTTCTGGGG - Intergenic
930158748 2:48131495-48131517 GCAGCCCCAGTCCTTTCCTGAGG - Intergenic
934479402 2:94621776-94621798 GAAGCTGCAGACCTTCCCGGTGG + Intergenic
936713773 2:115161974-115161996 GGAGCCGCAGCCCACCCCGGGGG + Exonic
938934861 2:136118613-136118635 GCAGACGCAGCCCATTCAGGAGG + Intergenic
948025041 2:234770117-234770139 GGACCCGCACCCCTTTGCAGGGG + Intergenic
948328997 2:237150460-237150482 GGACTCACAGCCCTTTCCTGAGG - Intergenic
948550048 2:238765225-238765247 GGTCCTGCAGCCCTCTCCGGTGG + Intergenic
1170843539 20:19943307-19943329 GGAGACGCTGCCATTTCGGGAGG - Intronic
1172104908 20:32511043-32511065 GGAGCCGCAGCCCTGGCCCCTGG - Intronic
1174053927 20:47785486-47785508 GGAGCAGCAGCGCTCGCCGGGGG - Intronic
1175253278 20:57622591-57622613 TCAGCCGGAGCCCCTTCCGGAGG - Intergenic
1175598372 20:60253510-60253532 GGAGCCCCAGCACTGGCCGGGGG + Intergenic
1175963799 20:62650033-62650055 GAAGCTGCTGCCTTTTCCGGGGG + Intronic
1175963808 20:62650078-62650100 GAAGCCGCTGCCTTTTCCAGGGG + Intronic
1176145422 20:63563295-63563317 GGAGCTGCAGCGCTGGCCGGAGG - Exonic
1178552768 21:33555182-33555204 GGAGCCGCACCCCTAGCCGTCGG + Exonic
1178921984 21:36744791-36744813 GGAGCAGCAGCGCTTGCAGGGGG - Exonic
1179707513 21:43190813-43190835 TGAGCCCCAGCCCTTGCCTGTGG + Intergenic
1179876633 21:44272190-44272212 GGGGCCGCAGCCCTGCCTGGTGG - Intergenic
1180177573 21:46098029-46098051 GGGGCCGCAGCGCTTCCTGGCGG + Intergenic
1181747513 22:24966161-24966183 GGAGCCTCAGCCCTGACCTGGGG - Intronic
1183642583 22:39101440-39101462 GAAGCCGCAGCCCCTTCTGCTGG - Exonic
1183649191 22:39144619-39144641 GGAGATTCAGCCTTTTCCGGGGG - Intronic
1184022850 22:41832829-41832851 GGAGCCGCTGCCTTCTCCGTTGG - Intergenic
1185027543 22:48424406-48424428 GGAGCTGCTGCCCATGCCGGGGG + Intergenic
1185389246 22:50549858-50549880 GGAGCTGCAGCCCTTCCCCTTGG + Exonic
953699360 3:45184019-45184041 GGGGCAGAAGCCCTGTCCGGGGG + Intergenic
953913740 3:46905439-46905461 GGAGACACAGCCCTGTCCTGGGG - Intergenic
964743674 3:159991711-159991733 AGAGCTGTAGCCCTTTCTGGAGG + Intronic
966190849 3:177270983-177271005 GAAGCTGCAGACCTTTACGGTGG + Intergenic
968697698 4:2041049-2041071 GGAGCCGCACCCCTACCTGGAGG - Intronic
968966661 4:3772349-3772371 GGAGGAGCAGCCCTGTGCGGAGG + Intergenic
987914102 5:24189354-24189376 AGAGCTGCATCCCTTTCTGGAGG + Intergenic
997257171 5:132437949-132437971 GGGGACTCAGCCCTTTCAGGAGG + Intronic
997377164 5:133405511-133405533 GGAGCGGCAGCCCTCGCCTGGGG + Intronic
1002536523 5:179879056-179879078 GGAGCCACAGCTCTCCCCGGAGG + Exonic
1007105539 6:39280853-39280875 GGAGACGCAGCCCTCTCCTCAGG - Intergenic
1007105561 6:39280931-39280953 GGAGACGCAGCCCTCTCCTCAGG - Intergenic
1007105583 6:39281009-39281031 GGAGACGCAGCCCTCTCCTCAGG - Intergenic
1007105593 6:39281048-39281070 GGAGACGCAGCCCTCTCCTCAGG - Intergenic
1007327263 6:41072369-41072391 GGATCCGGAGCCCTTCCCCGCGG - Exonic
1007707182 6:43798134-43798156 GGAGACGCAGCCCTGTCCTCAGG + Intergenic
1011303355 6:85899711-85899733 GGAGCAGCTGCTCTTTCTGGAGG - Intergenic
1017810779 6:157981967-157981989 GCAGCCGCAGCCCTTTGCTCAGG - Exonic
1018719740 6:166563464-166563486 GGAGCCGCAGCCCCTGGGGGTGG - Intronic
1019191097 6:170251448-170251470 TGAGCTGTAGCCCTTTCCAGGGG + Intergenic
1025255313 7:57380893-57380915 GGTGTCCCAGCCCTTCCCGGGGG - Intergenic
1027138236 7:75639294-75639316 GGAGCCGCAGCGCGCGCCGGGGG + Intronic
1030113974 7:106049453-106049475 GGGGCGGCCGCCCTTTCTGGGGG - Intergenic
1035744146 8:1949786-1949808 GGAGCCACAGCCTTTCTCGGTGG + Intronic
1039493505 8:37964995-37965017 GACACCGCAGCGCTTTCCGGTGG + Intronic
1042347874 8:67746396-67746418 GGAGGCCCAGCCCTTTCTAGGGG - Intergenic
1043874016 8:85464382-85464404 GGAGGCGCAGCCCTGGCCGCGGG + Intronic
1049721169 8:144116170-144116192 GGAGCCGCAGCCTTTCCCCCTGG + Exonic
1049845467 8:144798846-144798868 GGCGCAGCGGCCGTTTCCGGGGG + Intergenic
1053678426 9:40461804-40461826 GAAGCTGCAGACCTTCCCGGTGG - Intergenic
1054285298 9:63163143-63163165 GAAGCTGCAGACCTTCCCGGTGG + Intergenic
1054291504 9:63297341-63297363 GAAGCTGCAGACCTTCCCGGTGG - Intergenic
1054389521 9:64601880-64601902 GAAGCTGCAGACCTTCCCGGTGG - Intergenic
1054506193 9:65914491-65914513 GAAGCTGCAGACCTTCCCGGTGG + Intergenic
1056332269 9:85530828-85530850 AGCGCTGCACCCCTTTCCGGGGG + Intergenic
1061264524 9:129497424-129497446 GCAGCCGCAGCCCTGTTCTGGGG + Intergenic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062311191 9:135938321-135938343 GGACCGGAAGCCCTCTCCGGAGG - Exonic
1196871244 X:120115604-120115626 GCAGCCGCAGCCCCCGCCGGAGG - Exonic
1202004889 Y:20258159-20258181 GAAGCTGCAGACCTTTACGGTGG + Intergenic
1203336853 Y_KI270740v1_random:12023-12045 GAAGCTGCAGACCTTTACGGAGG + Intergenic
1203337156 Y_KI270740v1_random:16038-16060 GAAGCTGCAGGCCTTTACGGTGG + Intergenic