ID: 1151696688

View in Genome Browser
Species Human (GRCh38)
Location 17:75721559-75721581
Sequence CGCCCGTCCTGGACCTACCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151696688_1151696691 -2 Left 1151696688 17:75721559-75721581 CCGAGGTAGGTCCAGGACGGGCG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1151696691 17:75721580-75721602 CGCACAGCAGCAGCCGAGGCTGG 0: 1
1: 0
2: 2
3: 22
4: 252
1151696688_1151696698 29 Left 1151696688 17:75721559-75721581 CCGAGGTAGGTCCAGGACGGGCG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1151696698 17:75721611-75721633 GGGTGAGTGCCCGCCCCAGCTGG 0: 1
1: 0
2: 0
3: 22
4: 155
1151696688_1151696695 9 Left 1151696688 17:75721559-75721581 CCGAGGTAGGTCCAGGACGGGCG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1151696695 17:75721591-75721613 AGCCGAGGCTGGCCGGGAGAGGG 0: 1
1: 0
2: 1
3: 24
4: 270
1151696688_1151696690 -6 Left 1151696688 17:75721559-75721581 CCGAGGTAGGTCCAGGACGGGCG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1151696690 17:75721576-75721598 CGGGCGCACAGCAGCAGCCGAGG 0: 1
1: 1
2: 0
3: 20
4: 184
1151696688_1151696699 30 Left 1151696688 17:75721559-75721581 CCGAGGTAGGTCCAGGACGGGCG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1151696699 17:75721612-75721634 GGTGAGTGCCCGCCCCAGCTGGG 0: 1
1: 0
2: 4
3: 18
4: 147
1151696688_1151696693 3 Left 1151696688 17:75721559-75721581 CCGAGGTAGGTCCAGGACGGGCG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1151696693 17:75721585-75721607 AGCAGCAGCCGAGGCTGGCCGGG 0: 1
1: 0
2: 3
3: 41
4: 435
1151696688_1151696694 8 Left 1151696688 17:75721559-75721581 CCGAGGTAGGTCCAGGACGGGCG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1151696694 17:75721590-75721612 CAGCCGAGGCTGGCCGGGAGAGG 0: 1
1: 0
2: 3
3: 34
4: 399
1151696688_1151696692 2 Left 1151696688 17:75721559-75721581 CCGAGGTAGGTCCAGGACGGGCG 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1151696692 17:75721584-75721606 CAGCAGCAGCCGAGGCTGGCCGG 0: 1
1: 0
2: 3
3: 66
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151696688 Original CRISPR CGCCCGTCCTGGACCTACCT CGG (reversed) Exonic
900292003 1:1927589-1927611 AGCCCCTCCTGGACCCACCTGGG + Exonic
900549628 1:3247752-3247774 CGCCCGTCCTGGTGCGCCCTGGG + Intronic
906198788 1:43946570-43946592 CGCCTGTCCTCGGCCTACCGCGG - Intergenic
913671924 1:121105072-121105094 CCCCCATCCTGAAGCTACCTAGG + Intergenic
914023699 1:143892517-143892539 CCCCCATCCTGAAGCTACCTAGG + Intergenic
914662175 1:149800464-149800486 CCCCCATCCTGAAGCTACCTAGG + Intronic
917961882 1:180152119-180152141 TGCCCTTCCTGGAACTTCCTGGG - Intergenic
918355530 1:183703992-183704014 CGCCCTTCCTTGACCTACCATGG + Intronic
919098454 1:193064321-193064343 CCCCCATCCTGAAGCTACCTAGG + Intronic
919678680 1:200411603-200411625 CCCCCATCCTGAAGCTACCTAGG - Intergenic
919873460 1:201842503-201842525 CCCCCATCCTGAAGCTACCTAGG + Intronic
923329500 1:232909542-232909564 CACCCATCCTGAAGCTACCTAGG - Intergenic
924297746 1:242605272-242605294 CTCCCAGCCTGGAGCTACCTAGG + Intergenic
1064901677 10:20302080-20302102 CCCCCATCCTGAAGCTACCTAGG + Intergenic
1066962187 10:42233955-42233977 ACCCCGCCCTGGCCCTACCTTGG - Intergenic
1068150139 10:53121239-53121261 CTCCCATCCTGAAGCTACCTAGG + Intergenic
1075689896 10:124387689-124387711 GCCCAGTCCTGGACTTACCTTGG - Intergenic
1076631456 10:131854640-131854662 GGCCCCTCCAGGAACTACCTGGG + Intergenic
1077868040 11:6239392-6239414 TGCCTGTCCTGGACCCATCTGGG + Exonic
1084666062 11:70577012-70577034 CGCCCGTCCTGCACCTGCCACGG + Intronic
1086728777 11:90222751-90222773 TGCCCCTCCTGGGCCTCCCTTGG - Intronic
1089369062 11:117941317-117941339 AGCCCTGCCTGGACCCACCTGGG + Intergenic
1089532802 11:119142478-119142500 CGCCCATCCTGAAGCTACCTAGG - Intergenic
1090364189 11:126192544-126192566 AGCCCGTCCTGGCCCTGCCGGGG - Intergenic
1093708127 12:22297862-22297884 CCCCCATCCTGAATCTACCTAGG - Intronic
1094451271 12:30585326-30585348 CCCCCATCCTGAAACTACCTAGG - Intergenic
1106207785 13:27615592-27615614 GGCCCATCCTGAAGCTACCTAGG + Intronic
1106838173 13:33658751-33658773 CTCCCATCCTGAAACTACCTGGG - Intergenic
1112372178 13:98803566-98803588 TGCTGGTCCTGGACCAACCTTGG + Intronic
1114236936 14:20832206-20832228 CGCCCTTCCTTGACATACCATGG + Intergenic
1115851414 14:37592775-37592797 CGGCCGTCCGGGACCTAACCCGG + Intronic
1120041540 14:79758676-79758698 AACACGTCCTGGACCTAACTGGG - Intronic
1121458688 14:94056296-94056318 CCCCCATCCTGAAACTACCTGGG - Intronic
1122889008 14:104724140-104724162 CGCCCGCCCTGGCCCTCCCCCGG + Intergenic
1122956032 14:105071757-105071779 CCCCCATCCTGGAGCTACCCAGG + Intergenic
1123442853 15:20303471-20303493 TGCCTGTCCTGGCCCTGCCTTGG + Intergenic
1126545126 15:49865038-49865060 CCCCCATCCTGAAGCTACCTAGG - Intronic
1137565018 16:49527384-49527406 CGCACGTCCTCCACCTCCCTTGG + Intronic
1141735344 16:85848434-85848456 CTCCCGCCCTGGACCTTGCTGGG - Intergenic
1143497617 17:7321466-7321488 CGTCCGTCCTTGTCCTACCTCGG - Intronic
1145760119 17:27420916-27420938 CCCAGGTCCTGGACCTTCCTGGG + Intergenic
1150637297 17:66922657-66922679 CCCCCATCCTGAAGCTACCTAGG + Intergenic
1151696688 17:75721559-75721581 CGCCCGTCCTGGACCTACCTCGG - Exonic
1151828871 17:76538207-76538229 CGGCCGCCGTGGACCTAGCTGGG + Intronic
1153181647 18:2441850-2441872 CTCCCCTCCTGAAGCTACCTAGG + Intergenic
1155129096 18:22912204-22912226 CCCCCATCCTGAAGCTACCTAGG + Intronic
1156409273 18:36812272-36812294 CCCCCATCCTGCAGCTACCTTGG - Intronic
1157920384 18:51707939-51707961 CGCCCTTCCTTGACATACCATGG - Intergenic
1160615576 18:80124730-80124752 CCCCCATCCTGAAGCTACCTAGG + Intronic
1160814537 19:1028994-1029016 CCCCTGACCTGGACCTGCCTGGG - Intronic
1160814631 19:1029313-1029335 CCCCTGACCTGGACCTGCCTGGG - Intronic
1160814702 19:1029552-1029574 CCCCTGACCTGGACCTGCCTGGG - Intronic
1162366469 19:10252473-10252495 CGCCCCTCCTGGAGCCACCCCGG - Intronic
1164208301 19:23075585-23075607 CGCCCTGTCTGGACCTCCCTGGG + Intronic
1164451767 19:28372223-28372245 CACCCATCCTGAAGCTACCTAGG - Intergenic
1165509220 19:36256598-36256620 CGCTCTTCCTGGACCGACCACGG - Intergenic
1165509734 19:36259013-36259035 CGCTCTTCCTGGACCGACCACGG - Intergenic
1165918052 19:39273200-39273222 CACCTGTCCTGGAGCTACTTTGG - Intergenic
1166438038 19:42786182-42786204 CTCCCCTCCTGGGCCTACCCAGG + Intronic
1166456996 19:42949976-42949998 CTCCCTTCCTGGGCCTACCCAGG + Intronic
1166466940 19:43040845-43040867 CTCCCTTCCTGGGCCTACCCAGG + Intronic
1166486745 19:43220460-43220482 CTCCCTTCCTGGGCCTACCCAGG + Intronic
1166493856 19:43283907-43283929 CTCCCTTCCTGGGCCTACCCAGG + Intergenic
934238632 2:90250583-90250605 CGCCGGCCCTGGCCCTGCCTTGG + Intergenic
937433344 2:121859668-121859690 CTCCCATCCTGAAGCTACCTAGG - Intergenic
946174078 2:217912106-217912128 GGCCCCTCCTGGCCCCACCTTGG - Intronic
1168938205 20:1686212-1686234 GCCCAGTCCTTGACCTACCTTGG + Intergenic
1172702830 20:36863390-36863412 CGCCCGGCCTCGACGTCCCTGGG + Exonic
1175384788 20:58587245-58587267 ACCCCATCCTGGACCTCCCTGGG + Intergenic
1175545475 20:59775254-59775276 CGGCCGCCCTGGACCTTCCTGGG - Intronic
1176147672 20:63572683-63572705 CGCCCGGCCTGCCCCTCCCTGGG + Intronic
1176866492 21:14057417-14057439 TGCCTGTCCTGGCCCTGCCTTGG - Intergenic
1181093630 22:20491423-20491445 CCCCCATCCTGAAGCTACCTAGG + Intronic
1183112348 22:35659669-35659691 TGCCTGTCCTGGACAGACCTCGG + Exonic
1183348082 22:37318925-37318947 CGCCCGGCCTGGAACCACCACGG - Intergenic
1183966845 22:41447251-41447273 CGTCCGCCCTGCACCTGCCTCGG + Intergenic
1184295002 22:43517532-43517554 CGCCCTTCGCGGACCTGCCTGGG + Intergenic
951892003 3:27576125-27576147 CCCCCATCCTGCAACTACCTAGG + Intergenic
953364879 3:42335827-42335849 CCCCCATCCTGAAGCTACCTAGG - Intergenic
954066492 3:48110874-48110896 CCCCCATCCTGAAGCTACCTAGG - Intergenic
960601476 3:119463285-119463307 CGGCTGTCCTGGACCTGCCTCGG - Intronic
960994741 3:123333423-123333445 GGCCCGGCCTGGAGCTCCCTGGG + Intronic
964765064 3:160171630-160171652 TGCCCCTCCTGCCCCTACCTTGG + Intergenic
965143034 3:164863865-164863887 CCCCCATCCTGAAGCTACCTGGG - Intergenic
968480881 4:832594-832616 TGCCCTTCCTGGCCCCACCTGGG - Intergenic
969128422 4:4971968-4971990 CCCCCATCCTGAAGCTACCTAGG + Intergenic
978522389 4:109629981-109630003 CTCCCGTCCTGAAGCTACCTAGG + Intronic
981187966 4:141827565-141827587 CTCCCATCCTGCAGCTACCTAGG - Intergenic
983408216 4:167359947-167359969 CGCCTCTGCTGGACCTACCTGGG - Intergenic
986825183 5:11512655-11512677 CACAGGTGCTGGACCTACCTAGG - Intronic
992668871 5:79038728-79038750 CCCCCATCCTGAAGCTACCTAGG - Intronic
997709381 5:135990899-135990921 CGCCCCTCATGGCCCTTCCTTGG - Intergenic
1002562013 5:180088863-180088885 GCCCCATCCTGGAGCTACCTGGG + Intergenic
1004730109 6:18349490-18349512 CCCCCATCCTGAAGCTACCTAGG + Intergenic
1007391348 6:41551294-41551316 CGCCCGGGCTGGACATGCCTGGG + Intronic
1007406518 6:41638821-41638843 CGCCACTCCCGGTCCTACCTGGG - Exonic
1015275237 6:131377326-131377348 CGCCTGGCCTGGACCTCCCTGGG + Intergenic
1018781055 6:167066010-167066032 CCCCCATCCTGAAGCTACCTAGG - Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1020021806 7:4873745-4873767 CGCCTGTCCTGCGCCTCCCTGGG - Intronic
1020862811 7:13516045-13516067 CCCCCATCCTGAAACTACCTAGG + Intergenic
1024601811 7:50988718-50988740 CGCCCATCCTGAAGCTACCTAGG - Intergenic
1028720421 7:94024244-94024266 CTCCCTTCCTGCCCCTACCTGGG + Intergenic
1030301493 7:107978972-107978994 GGTCCCTCCTGGACCCACCTTGG + Intronic
1033147511 7:138883953-138883975 CCCCCATCCTGCAGCTACCTTGG - Intronic
1036704930 8:11039774-11039796 TGCACGTCCCGGCCCTACCTGGG + Intronic
1037425069 8:18746498-18746520 CACCCCCCCTGGACCTCCCTTGG - Intronic
1037442197 8:18927731-18927753 GCCCCGTCCTGAAGCTACCTAGG + Intronic
1037459888 8:19098241-19098263 CTCCAGTCCTAGAACTACCTAGG + Intergenic
1039236754 8:35510255-35510277 CCCCCACCCTGGAGCTACCTAGG + Intronic
1040304574 8:46205374-46205396 AGCCCGTCCGGGACAGACCTGGG - Intergenic
1040329557 8:46378910-46378932 CGCCCGACCGGGACAAACCTGGG - Intergenic
1040333565 8:46404678-46404700 AGCCCATCCGGGACATACCTGGG - Intergenic
1044098761 8:88102670-88102692 CCCCCATCCTGAAACTACCTAGG + Intronic
1046655595 8:116890874-116890896 CCCCCATCCTGAAACTACCTAGG - Intergenic
1048490266 8:134885541-134885563 TGCCCGTCCTGCTCCTACCTGGG - Intergenic
1049167754 8:141137265-141137287 CCACCGTGCTCGACCTACCTTGG + Intronic
1056578847 9:87876014-87876036 CTCCCGTCCAGGTCCTGCCTGGG - Intergenic
1056969049 9:91187443-91187465 CTCCCTTCCTGCACCTTCCTAGG - Intergenic
1056984183 9:91346166-91346188 CGCCTGTCCTGGAGCTATCTAGG - Intronic
1057358355 9:94350740-94350762 CCCCCATCCTGAAGCTACCTAGG - Intergenic
1057649394 9:96906870-96906892 CCCCCATCCTGAAGCTACCTAGG + Intronic
1058833160 9:108837441-108837463 CCCCCATCCTGAAGCTACCTAGG - Intergenic
1062000531 9:134213682-134213704 GGCCCCTCCTGGACCTCCCCTGG - Intergenic
1189400524 X:40663933-40663955 CCCCCTTCCTGAAGCTACCTAGG - Intronic
1190638798 X:52463257-52463279 CTCCCATCCTAGAGCTACCTAGG - Intergenic
1190653341 X:52589560-52589582 CCCCCATCCTAGAGCTACCTAGG - Intergenic
1192945842 X:75964966-75964988 CGCCCTTCCTTGACATACCATGG + Intergenic
1193753954 X:85383216-85383238 CTCCCCTCCTGAAGCTACCTAGG + Intergenic
1195087194 X:101423691-101423713 CCCCCGTCCTAAATCTACCTAGG - Intronic
1200047157 X:153409150-153409172 TGCCCGTCCTGGGCCAGCCTAGG + Intergenic