ID: 1151696814

View in Genome Browser
Species Human (GRCh38)
Location 17:75722068-75722090
Sequence CGCCATCCCGGCTCCAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151696808_1151696814 -6 Left 1151696808 17:75722051-75722073 CCACCCTGAGAGGCAGACGCCAT 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1151696814 17:75722068-75722090 CGCCATCCCGGCTCCAGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1151696806_1151696814 8 Left 1151696806 17:75722037-75722059 CCTACTTTTAAAAGCCACCCTGA 0: 1
1: 0
2: 2
3: 14
4: 195
Right 1151696814 17:75722068-75722090 CGCCATCCCGGCTCCAGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1151696810_1151696814 -10 Left 1151696810 17:75722055-75722077 CCTGAGAGGCAGACGCCATCCCG 0: 1
1: 0
2: 1
3: 8
4: 102
Right 1151696814 17:75722068-75722090 CGCCATCCCGGCTCCAGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1151696809_1151696814 -9 Left 1151696809 17:75722054-75722076 CCCTGAGAGGCAGACGCCATCCC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1151696814 17:75722068-75722090 CGCCATCCCGGCTCCAGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151696814 Original CRISPR CGCCATCCCGGCTCCAGGCA GGG Intronic
900160994 1:1223752-1223774 TGCCCTCCAGGCACCAGGCAAGG + Intronic
900202798 1:1418929-1418951 GGCCATCCCTGGTCCAGCCAAGG + Exonic
900490454 1:2946291-2946313 CTCCAGCCTGGCTCCAGGCTGGG + Intergenic
900977593 1:6026933-6026955 CGCCATCCATGTTCAAGGCAGGG - Intronic
901081735 1:6587582-6587604 GGCCATTCCGGCTCGAGGCCCGG - Exonic
901674758 1:10876643-10876665 GGTTATCCAGGCTCCAGGCAGGG + Intergenic
902984724 1:20148577-20148599 CCCCAGCCCAGCCCCAGGCATGG + Exonic
905447850 1:38038907-38038929 GGCCAGCCCAGCTCCAGGGAAGG + Intergenic
905959885 1:42035275-42035297 CGGCATCCCGGCTCTGGGCCGGG - Intronic
909539132 1:76771309-76771331 CACCTTCCTGGCTCCAGGAAAGG - Intergenic
910163324 1:84297810-84297832 CGCGATCTCGGCTCAATGCAGGG - Intergenic
913039932 1:115012325-115012347 AGCCATTCCAGCTCCAGCCATGG + Intergenic
914088613 1:144476036-144476058 CGCCATCTCGGCTCACTGCAAGG + Intergenic
914592111 1:149114965-149114987 CGCCATCTCGGCTCACTGCAAGG + Intergenic
914723942 1:150311548-150311570 CGCCATCTCGGCTCACTGCAAGG - Intergenic
919705274 1:200669817-200669839 CCCCTTCCAGGCTCCAGGCCAGG + Exonic
920034823 1:203059107-203059129 CCCCACCCCTGATCCAGGCAAGG + Intronic
922182398 1:223245718-223245740 CGCCATCATCTCTCCAGGCATGG - Intronic
1063452638 10:6161303-6161325 CCCTATCACTGCTCCAGGCAGGG - Intronic
1067030733 10:42877658-42877680 CACCATCCAGCCCCCAGGCATGG - Intergenic
1067106025 10:43366987-43367009 CGCCATCCAGCCACCAGGCTGGG + Intergenic
1069549523 10:69353194-69353216 CCCCATGCCGCCTCCAGGGAGGG + Intronic
1069551393 10:69366911-69366933 TGCCATCCCTGTGCCAGGCATGG + Intronic
1070144527 10:73764136-73764158 TACCATCCCCTCTCCAGGCATGG - Intronic
1070951708 10:80436530-80436552 GGGCATCCTGGCTCCAGGTAAGG - Exonic
1072003600 10:91220938-91220960 GGCCCTCCCGGCTCCAGGCTGGG - Intronic
1074435045 10:113426777-113426799 AGCCATCCAGGCAGCAGGCAGGG + Intergenic
1074937144 10:118192632-118192654 GGCCCTCCAGGCTCCAGGGAAGG - Intergenic
1076245533 10:128944858-128944880 CCCCATCTGGGCTCCAGACATGG + Intergenic
1077180981 11:1216026-1216048 CGTCATCCCAGGGCCAGGCACGG - Intergenic
1078722848 11:13899821-13899843 CTCCATTCCAGCTCCAGGAAGGG + Intergenic
1084556721 11:69880095-69880117 GGCCATCCCTGCCCCTGGCAAGG - Intergenic
1085298290 11:75443276-75443298 CGCCGTCCAGGCTGCAGGGAGGG + Exonic
1089845050 11:121452049-121452071 CCCCATCCCCGCGCCAGGGAGGG + Intergenic
1092053370 12:5489309-5489331 AGCCGTCCTGGCTCCAGGCTTGG + Intronic
1094475153 12:30835073-30835095 CACCTTCCTGGCTCCAGCCAGGG + Intergenic
1096503450 12:52079391-52079413 CCCCATCCCAGCTGCAGGCTGGG - Intergenic
1096872516 12:54602360-54602382 CACCATCACAGCTCCAGGGAGGG - Intergenic
1097195449 12:57240285-57240307 CGGCGTCCCGGCTCCTGGCCGGG + Intronic
1098771616 12:74559833-74559855 AGCCATTCCAGCTCCAGCCATGG - Intergenic
1099229325 12:80003823-80003845 AGCCATGCCAGCTCCAGCCATGG - Intergenic
1101828204 12:108237122-108237144 TCCCATCTTGGCTCCAGGCATGG - Intronic
1102489185 12:113278699-113278721 CAGCATCCTGGCTCCAGGCAGGG + Intronic
1103907485 12:124335063-124335085 CCCCATCCCCTCTCCAGGCCTGG + Intronic
1105291225 13:19055005-19055027 CACCTTCCCAGCCCCAGGCATGG - Intergenic
1107662917 13:42658137-42658159 CGCCTCCACGGCCCCAGGCAGGG - Intergenic
1108770948 13:53699941-53699963 AGCCATCCCAGCTCCAGCCATGG + Intergenic
1109003358 13:56835565-56835587 TGCCATTCCAGCTCCAGCCATGG - Intergenic
1109297545 13:60552867-60552889 AGCCACCCCAGCTCCAGCCATGG - Intronic
1112459281 13:99589100-99589122 CACCATGACGGATCCAGGCATGG - Intergenic
1114210493 14:20609866-20609888 CGCCAGCCCCGTGCCAGGCAAGG - Intronic
1115122261 14:29951603-29951625 CGCCATCTCGGCTCACTGCAAGG + Intronic
1115919865 14:38360507-38360529 CACCATCCAGCCTCCAGGGAGGG - Intergenic
1115970989 14:38944666-38944688 CTCCATTCCAGCTCCAGGGATGG + Intergenic
1116928705 14:50668398-50668420 CCCCACCGCGGCTCCAGGCGCGG + Intergenic
1118149574 14:63175199-63175221 CTCCATCCCCTCTCCAGCCATGG + Intergenic
1118963882 14:70561683-70561705 AGCCATTCCAGCTCCAGCCATGG + Intergenic
1122293490 14:100692334-100692356 CCCCAGCCCGGCGCCGGGCAGGG - Intergenic
1123042341 14:105495553-105495575 CGCCAGCCCGGCTTCAGCCAGGG - Intronic
1125230765 15:37452761-37452783 AGCCATGCCAGCTCCAGCCATGG + Intergenic
1127359299 15:58230818-58230840 CTCCAGCCCAGCCCCAGGCAGGG + Intronic
1128582265 15:68818509-68818531 CCCCACCCCGCCTCCAGGCAGGG + Intronic
1132519004 16:378886-378908 CTCCATCCCCGCACCAGGCGTGG - Intronic
1132724626 16:1333486-1333508 CTCCGGCCCGGCTCAAGGCACGG + Intergenic
1132843956 16:1991485-1991507 CGCCGTTCCGGCTCCAGCCTGGG + Intronic
1132987895 16:2777427-2777449 CGCCATCCCGACGGCGGGCATGG + Intergenic
1134059062 16:11188144-11188166 AGCCATCTCGGCTCCAGGCGAGG - Intergenic
1136479734 16:30534039-30534061 CTGCATCCCGGAGCCAGGCAGGG + Intronic
1138345386 16:56317145-56317167 AGACATCCTGGGTCCAGGCAGGG + Intronic
1138417678 16:56880446-56880468 CCCCTTCCCACCTCCAGGCAGGG + Intronic
1139503966 16:67389903-67389925 CCCCAACCCAGCCCCAGGCATGG - Exonic
1142588230 17:987684-987706 GGCCATCCTGGCTGCAGCCATGG - Intergenic
1142593295 17:1017172-1017194 CACCAGCCCGGCTGGAGGCAGGG + Intronic
1142769165 17:2084288-2084310 GGGCATCCAGGCTTCAGGCAGGG - Intronic
1143836951 17:9700327-9700349 CCCCAGCACGGCTGCAGGCAGGG + Intronic
1143888981 17:10087904-10087926 CCCCATCCTCGCTCCAGCCAGGG + Intronic
1149041671 17:52197115-52197137 ACCAATCCTGGCTCCAGGCAGGG + Intergenic
1150283994 17:63945319-63945341 CTCCATCCAGGTTCCCGGCAGGG + Intronic
1151611939 17:75182334-75182356 CGCCGCCGCGGCCCCAGGCAGGG + Intergenic
1151696814 17:75722068-75722090 CGCCATCCCGGCTCCAGGCAGGG + Intronic
1152160361 17:78664835-78664857 CGACAGCCCTGCTCCAGCCATGG - Intergenic
1152332332 17:79680426-79680448 CCCCATCCAGGCCCAAGGCAGGG + Intergenic
1152407931 17:80108081-80108103 TGCCAGCCCACCTCCAGGCAGGG - Intergenic
1152581261 17:81166413-81166435 TGCCATCCCCGCTCCGTGCACGG - Intergenic
1152834580 17:82520540-82520562 CGCAGCCCCGGCTCCAGGAAGGG - Intronic
1155540640 18:26864663-26864685 TGCCATCCCGGCTACAGCCCTGG - Intronic
1161139015 19:2637092-2637114 CCCCCTGCCGGCTCCAGGCCCGG + Intronic
1161388225 19:4008012-4008034 CGCTCCCCCGGCTTCAGGCAGGG + Intronic
1161562080 19:4979003-4979025 AGCCATCCGGCCTCCAGGCTTGG - Intronic
1161768094 19:6217696-6217718 CACCAGCCTGGCTCCAGGCACGG + Intronic
1162099127 19:8329106-8329128 CGCCATCTCGGCTCACTGCAAGG - Intronic
1165958321 19:39515589-39515611 CCCCAGCCCAGCTCCTGGCAGGG + Exonic
1166764263 19:45243551-45243573 AGCCATGGGGGCTCCAGGCAAGG - Intronic
1167100090 19:47399307-47399329 CCCCTTCCCAGCACCAGGCAGGG + Intergenic
1167289168 19:48615085-48615107 CGCCATCCCAGCACCAGGGAGGG + Intergenic
1167304329 19:48698295-48698317 CTCCTTCCAGGCTCCAGTCAAGG + Intronic
1168549986 19:57284737-57284759 CTTCATCCTGGCTCCAGGCCTGG + Intronic
925991951 2:9261136-9261158 CCCCAGCCCAGCTACAGGCAAGG - Intronic
927111045 2:19863929-19863951 CGCCACCTGGGCTCCAGGCCAGG + Intergenic
932337447 2:70939088-70939110 CCCCATCCCGGCCTCACGCATGG + Intronic
934113475 2:88764191-88764213 CACCGTCCATGCTCCAGGCAAGG + Intergenic
936519167 2:113201107-113201129 CACCATCCTGGCTCCAGGTTGGG - Intronic
940977912 2:159967051-159967073 CTCTATGCCGGCTCCAGGCAGGG + Intronic
941397944 2:164995011-164995033 GGCCCTGCCGGCCCCAGGCAAGG - Intergenic
945515905 2:210762928-210762950 AGCCATTCCAGCTCCAGCCATGG - Intergenic
946407023 2:219497227-219497249 CGCCAGCCCAGCTCTGGGCACGG + Intronic
948467898 2:238160847-238160869 GGCTATCTGGGCTCCAGGCAAGG - Intronic
1168963345 20:1883589-1883611 CCCCACCCTGGCTCCGGGCAGGG - Intergenic
1173148400 20:40545101-40545123 CCCCATCACAGCTCCAGACATGG + Intergenic
1176146909 20:63569570-63569592 CGCCAGGCCGGCTCTACGCACGG - Exonic
1181109239 22:20591669-20591691 AGCCCTCCCCTCTCCAGGCAGGG - Intergenic
1181576580 22:23798985-23799007 CGCCATCTGGGCTCAATGCAAGG - Intronic
1181653055 22:24271371-24271393 CGCTGTCCCCGCCCCAGGCAAGG - Intronic
1181953280 22:26570334-26570356 CCACACCCCGGCTCCTGGCATGG + Intronic
1182019998 22:27073682-27073704 CCCCAGCCAGCCTCCAGGCAGGG + Intergenic
1183418019 22:37693767-37693789 AGCCTTCCCAGCTCCAGGCTGGG - Intronic
1183492681 22:38124986-38125008 CCTCAGCCCCGCTCCAGGCAGGG + Intronic
1183734496 22:39636338-39636360 CCCCATCCCCGCCCCAGGAAGGG + Intronic
1183865373 22:40700183-40700205 CTTCATCCCAGCTCCAGGGATGG + Intergenic
950003090 3:9672742-9672764 CTCCATCCCGTATCCAGGTAGGG + Exonic
950497577 3:13343228-13343250 CGTCTTCCCGGCCCCAGCCAAGG - Exonic
954856004 3:53643872-53643894 GGCCCTCCCTGCTCCAGGCAGGG - Intronic
955144725 3:56305728-56305750 TGCCATCCCGGCTTCAGGTATGG - Intronic
957555516 3:81761262-81761284 CGCCAACCCCGCCCCAGGCGGGG - Intronic
962394220 3:135000879-135000901 GGCCTTCCTGGCTCCTGGCAGGG - Intronic
968473447 4:792151-792173 AGCCAGCCAGGCTCCACGCAGGG + Intronic
968948670 4:3679033-3679055 TGCCATCCCAGCACCAGGCCAGG - Intergenic
980775450 4:137430873-137430895 CGCCATTCCAGCTCCAGCCATGG + Intergenic
985924192 5:3002999-3003021 CGCCATCTCCTCCCCAGGCATGG - Intergenic
986297060 5:6448656-6448678 CGCCAGCCCGGGACCCGGCAAGG + Exonic
988768393 5:34406704-34406726 AGCCATGCCAGCTCCAGCCATGG + Intergenic
997335350 5:133104851-133104873 CCCCATCCCCACACCAGGCAGGG - Exonic
1001934249 5:175693330-175693352 CGACTTCCTGTCTCCAGGCAGGG - Intergenic
1001940985 5:175739263-175739285 CCCCACCCCAGCTCCAGGCATGG + Intergenic
1002044704 5:176535457-176535479 CGCCACCCCTGTTCCTGGCAGGG - Intronic
1007380932 6:41489688-41489710 CCCCAGCCCAGCCCCAGGCAGGG + Intergenic
1009792360 6:68419948-68419970 AGCCATGCCAGCTCCAGTCATGG + Intergenic
1011734152 6:90296004-90296026 TGCGATCCCAGCTCCAGGCCGGG - Intronic
1018088928 6:160329132-160329154 CGCCATCCCAGCTCCAGCATTGG - Intergenic
1018824782 6:167400896-167400918 CCACATCCCGGCCCCAGGCATGG - Intergenic
1019366400 7:635575-635597 AGCCTTCCGGGCTCCAGGCCTGG - Intronic
1019515968 7:1440337-1440359 CTCCACCCCAGCTGCAGGCATGG + Intronic
1023391377 7:39714704-39714726 GGCCATTCCAGCTCCAGCCAGGG + Intergenic
1024920320 7:54546856-54546878 AGCCTTCGCGGCTCCGGGCAGGG - Intronic
1028438334 7:90830369-90830391 GGCCATTCCAGCTCCAGCCATGG - Intronic
1031012569 7:116539067-116539089 CACCAGCCCTGCACCAGGCACGG + Intronic
1033390622 7:140924521-140924543 CGCCCTCCCGACTCCGGGCTCGG - Intronic
1034278426 7:149834798-149834820 CGTCATCCCACCTCCAGGCCAGG + Intergenic
1034941988 7:155236661-155236683 TGCCATCCCTGCTCCAGCCCAGG + Intergenic
1035450742 7:158975605-158975627 CGCCTTCCCGGCTAAAGTCAGGG + Intergenic
1035641773 8:1189642-1189664 ATCCATCCCGTTTCCAGGCATGG - Intergenic
1038191517 8:25325404-25325426 CTCCATCTTGGTTCCAGGCAGGG - Exonic
1044821280 8:96157699-96157721 CGCATCCCCGGCTCCTGGCAAGG - Intronic
1044994078 8:97822156-97822178 TACCATCCAGGCTGCAGGCAGGG + Intronic
1045258037 8:100546352-100546374 AGCCACTCCGGCTCCAGCCATGG + Intronic
1049612991 8:143564253-143564275 CGCCATCTCGGCTCACTGCAGGG + Intergenic
1049803514 8:144528838-144528860 CCCCATCCCCGCTGCAGGCCCGG + Exonic
1049818429 8:144619323-144619345 CCCCATCCCCGCTCCAGGGCCGG + Intergenic
1049861227 8:144900981-144901003 GGCCATCCTGGCCCTAGGCACGG + Intronic
1056514864 9:87340507-87340529 CTTCATCCCGGCCTCAGGCATGG + Intergenic
1057290501 9:93803086-93803108 GGCCCTCCCAGCCCCAGGCATGG - Intergenic
1057832695 9:98419143-98419165 AGCCGTCCAGGCGCCAGGCAAGG + Intronic
1060770249 9:126327049-126327071 CGCCCTCCCGGCTGCAGGGCCGG - Intronic
1061871242 9:133521916-133521938 AGCCATTCCTGCTCCTGGCAGGG - Intronic
1062382161 9:136291706-136291728 CTCCATCCGGGCTGGAGGCAAGG + Intronic
1062570021 9:137180687-137180709 CTCCAACCAGGCCCCAGGCACGG + Intronic
1062678444 9:137762513-137762535 GGCCATCCCCGCCCCACGCAGGG + Intronic
1185445525 X:255992-256014 CAGCATCCCGGCTCCATCCAGGG + Intergenic
1188586046 X:31776863-31776885 GGCCATCCCTGCGCCAGTCATGG + Intronic
1192196673 X:69033411-69033433 CATCATCCTGCCTCCAGGCAAGG + Intergenic
1195917728 X:109952325-109952347 CACCAGCCCTGCTCCAGGCCTGG - Intergenic
1199329572 X:146543094-146543116 GACCATCCCAGCTCCAGCCATGG - Intergenic