ID: 1151702542

View in Genome Browser
Species Human (GRCh38)
Location 17:75751013-75751035
Sequence GCTCAGCTGGGTCACCGTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151702542_1151702548 -10 Left 1151702542 17:75751013-75751035 CCTCCACGGTGACCCAGCTGAGC 0: 1
1: 0
2: 2
3: 11
4: 175
Right 1151702548 17:75751026-75751048 CCAGCTGAGCTGGGCTGAGCCGG 0: 1
1: 0
2: 27
3: 137
4: 815
1151702542_1151702549 3 Left 1151702542 17:75751013-75751035 CCTCCACGGTGACCCAGCTGAGC 0: 1
1: 0
2: 2
3: 11
4: 175
Right 1151702549 17:75751039-75751061 GCTGAGCCGGCTGAGACCAACGG 0: 1
1: 0
2: 1
3: 12
4: 134
1151702542_1151702552 23 Left 1151702542 17:75751013-75751035 CCTCCACGGTGACCCAGCTGAGC 0: 1
1: 0
2: 2
3: 11
4: 175
Right 1151702552 17:75751059-75751081 CGGTGAGATCACAGCCTACGAGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151702542 Original CRISPR GCTCAGCTGGGTCACCGTGG AGG (reversed) Exonic
900350974 1:2234371-2234393 GGGCAGCAGGGTCACGGTGGGGG + Intronic
900951301 1:5859530-5859552 CCTCAGCTTGGCCACAGTGGAGG + Intergenic
903034359 1:20485003-20485025 CCCCGGCTGGGTCACCCTGGGGG - Intronic
903219949 1:21864044-21864066 GCTCAGCTGGGCCTGGGTGGGGG - Intronic
904353747 1:29925272-29925294 TCTCAGCTGGGACAGCGGGGAGG - Intergenic
904710333 1:32425397-32425419 GCTCAGCTGGGGTCCCTTGGTGG + Intergenic
906699632 1:47848575-47848597 GCTAAGCTGTGTCACTCTGGGGG - Intronic
910376869 1:86582042-86582064 GCTCAGGTGGGTCCCAGTAGTGG + Intergenic
915596636 1:156900067-156900089 GCTCAGCTGGTTCCCTCTGGTGG - Intronic
916745779 1:167683943-167683965 GGCCAGCTGGGCCACCGAGGGGG - Exonic
922956950 1:229611050-229611072 GCTCACCCTGGTCACCCTGGAGG - Intronic
1062882305 10:988568-988590 CCTCAGCTGGGTCCCCGGGGAGG + Intronic
1062936793 10:1396300-1396322 GCTGCGATGGGTCACCGAGGGGG - Intronic
1067158882 10:43806070-43806092 GCACAGGTGGGTCACACTGGAGG - Intergenic
1067945899 10:50687737-50687759 GCTCAGGTGGGACACAGAGGTGG - Intergenic
1070867415 10:79714613-79714635 GCTCAGGTGGGACACAGAGGTGG - Intronic
1070881207 10:79852737-79852759 GCTCAGGTGGGACACAGAGGTGG - Intergenic
1070954367 10:80454577-80454599 GCTCAGCGGGGTCCCGGCGGAGG - Intronic
1071634329 10:87236836-87236858 GCTCAGGTGGGACACAGAGGTGG - Intronic
1071647780 10:87369053-87369075 GCTCAGGTGGGACACAGAGGTGG - Intronic
1073042250 10:100615622-100615644 GCCCCGCTGGGGCACCCTGGGGG + Intergenic
1075087219 10:119421771-119421793 GCTCAGCTGGGAGACCCTGAGGG + Intronic
1076268642 10:129131335-129131357 GCTCAGCATGGTCACCTTGTTGG + Intergenic
1076417303 10:130300932-130300954 GCTCAGCTGGCTCAGCCTGCAGG + Intergenic
1076926121 10:133488780-133488802 GCTCAGCTGGCCAACCCTGGTGG - Intergenic
1078955252 11:16186894-16186916 GATCAGCTGGGTAATCATGGTGG + Exonic
1079395118 11:20055775-20055797 GCTCATCTGGGTGACAGTGGTGG - Exonic
1079513025 11:21233118-21233140 TCTCAGATGGGTTTCCGTGGTGG + Intronic
1082828519 11:57598275-57598297 GGTCAGCAGGGTCAGCCTGGAGG - Exonic
1082861257 11:57858666-57858688 GCTCAGGCGGGGCACGGTGGTGG - Intergenic
1083162743 11:60865215-60865237 GCTCAGCTGGGAAAGCTTGGTGG - Intergenic
1084269442 11:68021228-68021250 GCTCAGCAGGGGGACCCTGGGGG + Intronic
1084512955 11:69617494-69617516 GCTCAGCAGGGTGAGTGTGGGGG + Intergenic
1084531621 11:69731040-69731062 GCTCAGCAGGATCTCTGTGGTGG - Intergenic
1088565883 11:111172544-111172566 GCTAATCTGGGCCACTGTGGAGG - Intergenic
1089834650 11:121359312-121359334 GCTCAGTTGGGTAACACTGGTGG + Intergenic
1090164355 11:124531713-124531735 GATCTGCTTGGTCACCATGGTGG + Intergenic
1091991214 12:4957474-4957496 GCTCAGCTGGGCCACCTTGCCGG + Intergenic
1092173041 12:6385131-6385153 ACTCACCTGGGTCACAGGGGCGG - Exonic
1095983199 12:47984241-47984263 GCTCAGCTGGGGTACCGTGGAGG - Intronic
1096259020 12:50079519-50079541 CCTCAGCTGGTTGACCCTGGAGG + Intronic
1096691762 12:53325754-53325776 GCCCAGCGGGGTAACCTTGGGGG + Intergenic
1097179337 12:57162441-57162463 GCGCAGAAGGGTCACAGTGGGGG - Exonic
1101833847 12:108281204-108281226 GCACTGCTGGGTCACCTTTGTGG - Intergenic
1104944657 12:132410219-132410241 GCTCAGCTGCGTGCACGTGGCGG + Intergenic
1106184418 13:27396539-27396561 GTTCAGCAACGTCACCGTGGTGG - Intergenic
1108275888 13:48809283-48809305 TCTTAGCTGGTTCACCTTGGAGG + Intergenic
1108775595 13:53761571-53761593 GCTCTGCTGGAGCACCGTGCTGG - Intergenic
1109598333 13:64587839-64587861 GCACAGCTGGCTGAGCGTGGTGG - Intergenic
1110638069 13:77789460-77789482 GATCAGCTGAGTCACCTTGTTGG - Intergenic
1111322830 13:86651929-86651951 ACTCAGCTGTGTTACAGTGGGGG + Intergenic
1113790100 13:113023757-113023779 GCTCAGCTGTGTCCTCATGGGGG + Intronic
1119386125 14:74258992-74259014 GCTTAGCTGGGACAGGGTGGAGG + Intronic
1121552321 14:94812083-94812105 GTTGTGCTGGGTCACCTTGGGGG + Intergenic
1121561687 14:94880868-94880890 GCTCACCTTGGTCAGCCTGGGGG - Intergenic
1122922083 14:104884416-104884438 GGTCAGCTGGGGGTCCGTGGGGG - Exonic
1123130435 14:105981389-105981411 GCTCAGCTGGGTCTGGGTGCTGG + Intergenic
1123410017 15:20050410-20050432 GCTCAGCTGGGTCTGGGTGCTGG - Intergenic
1123519349 15:21057117-21057139 GCTCAGCTGGGTCTGGGTGCTGG - Intergenic
1123580672 15:21712610-21712632 GCTCAGCTGGGTCTGGGTGCTGG + Intergenic
1123617321 15:22155233-22155255 GCTCAGCTGGGTCTGGGTGCTGG + Intergenic
1128148031 15:65343679-65343701 GCTCCGGTGGGTCTGCGTGGAGG - Intronic
1128248801 15:66150952-66150974 GCTCAGCAGGGTGATCCTGGTGG - Intronic
1129385307 15:75192996-75193018 ACTGAGCCGGGTCACCTTGGAGG + Intergenic
1131013424 15:89038325-89038347 GCTCTGCAGGGTGACAGTGGCGG + Intergenic
1202989542 15_KI270727v1_random:446855-446877 GCTCAGCTGGGTCTGGGTGCTGG + Intergenic
1132656665 16:1044384-1044406 GCTCAGCGGGGTCTCCCGGGCGG + Intergenic
1132804144 16:1767984-1768006 GCTCTGCAGGGCCACCTTGGAGG + Intronic
1135044093 16:19140475-19140497 GCTCTGCTGGGTGACTTTGGGGG - Intronic
1135196810 16:20401736-20401758 GCCCAGCTCAGCCACCGTGGAGG + Intronic
1137583741 16:49651398-49651420 GCTCAGCTGGGGCTTCTTGGAGG + Intronic
1137928719 16:52566162-52566184 GCTCAGCTGGGACACTGGGATGG - Intergenic
1138421914 16:56904530-56904552 GCTCAGCAGGGGCACCACGGAGG + Intronic
1140674820 16:77317529-77317551 GACCAGCTGGGCCAACGTGGCGG - Intronic
1141688890 16:85585543-85585565 GCCCAGCTGGGTCTCCATGTGGG + Intergenic
1142602532 17:1061230-1061252 GCACAGCTGGGGCAACGGGGAGG + Intronic
1142717283 17:1754213-1754235 GCTCAGCGAGGTCGGCGTGGAGG + Exonic
1143658933 17:8312986-8313008 GCTCAGATGGGTGCCTGTGGGGG + Exonic
1144788962 17:17847068-17847090 GCTCTGCTGGGTCTCCATGGTGG - Exonic
1144947693 17:18978195-18978217 TCTCAGCTGGGACACCGTCCTGG + Exonic
1146794259 17:35770085-35770107 GCTCAGCTGGGACGACGTGCTGG - Exonic
1147332060 17:39705168-39705190 GCTCAGCTCAGTTACTGTGGCGG + Intronic
1148197186 17:45722406-45722428 GCCCAGCTGGGCCAGCCTGGTGG - Intergenic
1148786879 17:50149878-50149900 GCTGAGCTGGCTGACCGTGGGGG + Exonic
1151026527 17:70683926-70683948 GCTGAGCTGGATCACCAGGGAGG + Intergenic
1151473351 17:74331385-74331407 GCTGGGCTGGGCCACCGTGAGGG + Intronic
1151702542 17:75751013-75751035 GCTCAGCTGGGTCACCGTGGAGG - Exonic
1152388803 17:79991169-79991191 GCCCAGCTGGGTCTCCAGGGTGG - Intronic
1152855330 17:82662432-82662454 CCTCAGCTGGGACAACGTGCCGG + Intronic
1156904424 18:42336779-42336801 CCTCAGCAGGGTCTCCGTGTGGG + Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161036944 19:2090219-2090241 GCTGAGCTGGGACACCTGGGTGG - Intronic
1161586333 19:5107783-5107805 GCTCAGCAGGGCCACAGTGTGGG - Intronic
1163218466 19:15897597-15897619 GCTCAGCTGGGACATCCTGCAGG + Exonic
1165313446 19:35041551-35041573 GCACACCTGGGTCCCCCTGGAGG + Intronic
1166931300 19:46303315-46303337 GCTTTGCTGTGTCACCCTGGCGG + Intronic
1167114971 19:47483843-47483865 TCTGAGCCGGGTCACCGTGCTGG - Intronic
1168099037 19:54131238-54131260 GCTCTGATGGGTCACAGTTGGGG + Intronic
1168110518 19:54189321-54189343 GCTCAGGTGGGCCAGGGTGGCGG - Exonic
1168267599 19:55231021-55231043 ACGCAGCTGGCTCAGCGTGGAGG + Intronic
925170223 2:1745488-1745510 TCTCAGCTGTGTCCCCGTGCTGG + Intergenic
926329107 2:11810313-11810335 ACTCAGCTGAGTCTCCATGGAGG + Intronic
927138235 2:20112874-20112896 CTTCAGCTGGGCCTCCGTGGTGG - Intergenic
929583890 2:43101533-43101555 GCGGAGCTGGGTTACTGTGGAGG - Intergenic
929874572 2:45786040-45786062 GCCCTGCTGGGTCATCGTGGGGG + Intronic
930718667 2:54617778-54617800 GCTTAACTGTCTCACCGTGGTGG + Intronic
932301415 2:70669900-70669922 GCTCAGCTGGGACACTGAGATGG - Intronic
932769557 2:74492916-74492938 TCTCAGCAGGGTCAGCGAGGAGG + Exonic
937011947 2:118571019-118571041 GCCAAGCTGGGTCACCTGGGGGG - Intergenic
938077463 2:128347271-128347293 GCCCAGCTGAGGCACCGTGGTGG - Intergenic
938216177 2:129518372-129518394 GCTCAGCTTGGTCGCTGTTGGGG + Intergenic
945943738 2:215974438-215974460 GCTCAGGTGGGGCATCGAGGAGG - Intronic
946607513 2:221421728-221421750 GCTAAACATGGTCACCGTGGTGG - Intronic
947228251 2:227860382-227860404 GCTCAGCCCGGTCATCATGGGGG - Intergenic
1170254088 20:14320035-14320057 TCTAAACTGGGTCACTGTGGAGG + Intronic
1171293178 20:23994198-23994220 GATCAGCTGGGTCACCCTGGTGG + Intergenic
1172126530 20:32627935-32627957 GCACACCTGCGTCACAGTGGGGG - Intergenic
1175833676 20:61980389-61980411 GCTCGGCTGGGGCTCCGTGGCGG - Intronic
1179595221 21:42438658-42438680 TTTCAGCTGGGTCAGCGAGGAGG + Intronic
1179784240 21:43720454-43720476 GCTCAGCTTGGTCCTCCTGGGGG - Intronic
1180392625 22:12298443-12298465 GCTCAGCTGGGGGATGGTGGGGG - Intergenic
1180407123 22:12566325-12566347 GCTCAGCTGGGGGATGGTGGGGG + Intergenic
1180824235 22:18851912-18851934 GACCAGCCGGGTCACCCTGGTGG + Intronic
1181124663 22:20695066-20695088 GACCAGCCGGGTCACCCTGGTGG + Intergenic
1181188501 22:21122636-21122658 GACCAGCCGGGTCACCCTGGTGG - Intergenic
1181210699 22:21287857-21287879 GACCAGCCGGGTCACCCTGGTGG + Intergenic
1181398811 22:22639031-22639053 GACCAGCCGGGTCACCCTGGTGG - Intergenic
1181501542 22:23318387-23318409 GACCAGCCGGGTCACCCTGGTGG - Intergenic
1181650611 22:24257028-24257050 GACCAGCCGGGTCACCCTGGTGG + Intergenic
1181706770 22:24653710-24653732 GACCAGCCGGGTCACCCTGGTGG - Intergenic
1184153002 22:42649298-42649320 GCTGAGCTGGGCCCCCATGGTGG + Intronic
1203216248 22_KI270731v1_random:7573-7595 GACCAGCCGGGTCACCCTGGTGG - Intergenic
1203274372 22_KI270734v1_random:77816-77838 GACCAGCCGGGTCACCCTGGTGG + Intergenic
950046552 3:9951814-9951836 ACTCAGCTGTGTGACCTTGGGGG - Intronic
950613617 3:14141659-14141681 GGTCAGCAGGGTCAGCGAGGTGG - Exonic
950684073 3:14603868-14603890 GCTCAGCTGCCTCAGCCTGGTGG - Intergenic
954710425 3:52502711-52502733 GCTCACCTTGATCACAGTGGGGG - Exonic
956463920 3:69500134-69500156 GCTGAGCTGGGTCACCACTGTGG + Intronic
961205931 3:125081618-125081640 GCTAAGTTGGGTGACCTTGGAGG - Intergenic
961516735 3:127442677-127442699 GCTCTGCAGTGTCACCTTGGGGG + Intergenic
961781341 3:129322160-129322182 GCTCAGATGTGTCACCGTCCTGG - Intergenic
961877557 3:130035240-130035262 GCTCATCTTGGGGACCGTGGTGG + Intergenic
967830283 3:193912762-193912784 GCTCAGCTGGGTGGGCGAGGAGG - Intergenic
975723569 4:77270908-77270930 GCTCAGTTGGGTCACCTTTGGGG + Intronic
977293291 4:95186364-95186386 GCACAGGTGGGTCGCAGTGGAGG + Intronic
981402470 4:144329578-144329600 GATCTGCTGGGTCACCTTGTTGG - Intergenic
985432296 4:189893062-189893084 GCCCAGCTGGGGGACGGTGGGGG + Intergenic
985634899 5:1031106-1031128 GCTGAGCAGGGTCACCCTCGAGG - Intronic
987091427 5:14511053-14511075 GCTCAGGTGTGGCACTGTGGTGG - Intronic
997013471 5:129904912-129904934 GCTCAGCTCCGCCACCCTGGGGG - Exonic
998508817 5:142694626-142694648 CCCCAGCTTGGTCACCCTGGTGG + Intronic
1001649968 5:173309396-173309418 GCTCAGCAGGGACACCGTCAGGG - Intergenic
1003712014 6:8602842-8602864 GCTCAGCTGGGTCCCCAAGCAGG - Intergenic
1008431535 6:51423502-51423524 TCTCAGCTTGGTCACTGTTGGGG - Intergenic
1013270111 6:108537470-108537492 GCCCAGCTGGGTGACCCTCGGGG + Intergenic
1017690222 6:156956517-156956539 CCTCTGCTGGGTCACCATGGAGG + Intronic
1018710813 6:166497126-166497148 TCTCAGAGGGGTGACCGTGGGGG + Intronic
1018854105 6:167663134-167663156 GCTCTGCGGGGCCACCGTGGGGG + Intergenic
1019170543 6:170131041-170131063 GAGCATCAGGGTCACCGTGGAGG - Intergenic
1019312096 7:367821-367843 GCTCAGCTGGCTGACCGGGCTGG - Intergenic
1028524615 7:91769748-91769770 CCTCAGTTGGGTGACCCTGGGGG - Intronic
1033453037 7:141478439-141478461 CCTCTGCTGGGTCACAGTGATGG + Exonic
1034844382 7:154430838-154430860 GCTCAGCTGGCACATGGTGGAGG + Intronic
1037701051 8:21274029-21274051 GATGGGCTGGGACACCGTGGAGG + Intergenic
1038584445 8:28776629-28776651 GCTCAGCCCGGTCAGCCTGGTGG - Intronic
1043889815 8:85643183-85643205 GCTGACCCGCGTCACCGTGGTGG - Intergenic
1043891352 8:85655091-85655113 GCTGACCCGCGTCACCGTGGTGG - Intergenic
1043892426 8:85661928-85661950 GCTGACCCGCGTCACCGTGGTGG - Intergenic
1043893131 8:85715407-85715429 GCTGACCCGCGTCACCGTGGTGG + Intergenic
1043895818 8:85736861-85736883 GCTGACCCGCGTCACCGTGGTGG + Intergenic
1043896861 8:85744947-85744969 GCTGACCCGCGTCACCGTGGTGG - Intergenic
1043899184 8:85763313-85763335 GCTGACCCGCGTCACCGTGGTGG - Intergenic
1043900795 8:85775508-85775530 GCTGACCCGCGTCACCGTGGTGG - Intergenic
1043902759 8:85790783-85790805 GCTGACCCGCGTCACCGTGGTGG - Intergenic
1043904369 8:85802976-85802998 GCTGACCCGCGTCACCGTGGTGG - Intergenic
1043905981 8:85815170-85815192 GCTGACCCGCGTCACCGTGGTGG - Intergenic
1043907589 8:85827357-85827379 GCTGACCCGCGTCACCGTGGTGG - Intergenic
1048971885 8:139649725-139649747 TCTCAGCTGTGTAACCCTGGGGG + Intronic
1049038939 8:140098127-140098149 GCTCAGCTAGGTCTCAGTGCAGG + Intronic
1051866351 9:21687504-21687526 GAACAGCTGGGTCAATGTGGTGG + Intergenic
1056115511 9:83437672-83437694 TCTCAGCTGGGTCAGAATGGTGG - Intronic
1059448635 9:114356131-114356153 GCTGTGCTGGGGGACCGTGGAGG + Exonic
1061360267 9:130137184-130137206 GCTCGGAAGGGTCTCCGTGGAGG + Exonic
1061574281 9:131496492-131496514 CCTCAGCTGGTTCACCCTTGAGG + Exonic
1062113298 9:134794370-134794392 GCTGAGTTGGGACACGGTGGGGG + Intronic
1062255637 9:135619461-135619483 GGTGAGGTGGGTCACAGTGGAGG - Intergenic
1187258213 X:17660559-17660581 GTTCAGCTGGGTCACTGGGCTGG + Intronic
1199996736 X:153030693-153030715 GGTCATCTGGGTCACCGGGAAGG - Intergenic
1200003734 X:153074454-153074476 GGTCATCTGGGTCACCGGGAAGG - Exonic