ID: 1151709216

View in Genome Browser
Species Human (GRCh38)
Location 17:75791501-75791523
Sequence AATGTAGCTCGTTCTCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151709216_1151709217 -5 Left 1151709216 17:75791501-75791523 CCTCAGTGAGAACGAGCTACATT 0: 1
1: 0
2: 1
3: 10
4: 93
Right 1151709217 17:75791519-75791541 ACATTACCAATAAACATTTCTGG 0: 1
1: 0
2: 0
3: 18
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151709216 Original CRISPR AATGTAGCTCGTTCTCACTG AGG (reversed) Intronic
908384832 1:63631637-63631659 GATGTTGCTTGTTCTCACAGTGG + Exonic
909786650 1:79622038-79622060 AAGGTAGCTCTTTCTGGCTGAGG + Intergenic
911366161 1:96940334-96940356 AATGTAACTGGTTTTCCCTGAGG + Intergenic
913394793 1:118354655-118354677 AATATTGCATGTTCTCACTGAGG + Intergenic
920034056 1:203054251-203054273 AGTGTAGCTCCTGCTTACTGAGG + Intronic
920271863 1:204771304-204771326 AACGTAGCTCATTCTCTCTCTGG - Intergenic
921181822 1:212637380-212637402 CATGTAGCTCATTCTCCCTGTGG - Intergenic
1070496212 10:77025892-77025914 AATGTGGCTTGGTCTCAGTGTGG - Intronic
1076200205 10:128551935-128551957 AATGTTGGTCCTTCTGACTGTGG - Intergenic
1081192309 11:40119094-40119116 AATGCAACTATTTCTCACTGGGG - Intronic
1089706016 11:120278402-120278424 AAGGTCACTCGTTCTCACTGGGG - Intronic
1090830090 11:130415222-130415244 ATTCTAGATCCTTCTCACTGAGG - Intronic
1092371318 12:7918668-7918690 AAAATAGCTAGTTCTCAGTGGGG + Intergenic
1093779529 12:23119446-23119468 ACAGTAGCTAGTACTCACTGTGG + Intergenic
1094459820 12:30683657-30683679 AATGTTGCTAGTTGTAACTGAGG - Intronic
1095247062 12:39935529-39935551 AATCTAGCTGGTTCTCCCTGGGG + Intronic
1099156912 12:79188988-79189010 AAAGTAGCTCTTTCTCAGTCAGG + Intronic
1100917692 12:99444959-99444981 AATATAACTCAGTCTCACTGAGG + Intronic
1102389606 12:112538881-112538903 ACTGTAACTCATTCTCACTGAGG + Intergenic
1107846670 13:44521394-44521416 AATACAGCTCATTCTTACTGTGG + Intronic
1109764226 13:66871953-66871975 ATTGTGGCTCATTCTAACTGTGG - Intronic
1126360341 15:47839212-47839234 AATGAAACTTGTTCTCACAGTGG - Intergenic
1127013787 15:54660047-54660069 AATGTAGGCTGTTCTCTCTGTGG + Intergenic
1127665234 15:61139598-61139620 AAGGGACTTCGTTCTCACTGTGG + Intronic
1132417642 15:101634749-101634771 TTTGTAGCTGGTTTTCACTGTGG - Intronic
1139239315 16:65374438-65374460 ATTGTAGCTGTTTCTCACTATGG + Intergenic
1146552375 17:33792388-33792410 TATGTAGCTATTTCTCATTGGGG + Intronic
1147530006 17:41267006-41267028 CATGTAGCTATTACTCACTGAGG - Intergenic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1151709216 17:75791501-75791523 AATGTAGCTCGTTCTCACTGAGG - Intronic
1152085409 17:78214706-78214728 AGTCTGGCTCGTTCTCAGTGGGG - Exonic
1156268105 18:35506546-35506568 ACTGTGGCTTGTTCTCACAGTGG - Intergenic
1158623221 18:59050149-59050171 TATGTAGGACGTTCTCATTGTGG + Intergenic
1159145544 18:64449366-64449388 GGTGTAGCTCGTTCTCTCTTTGG - Intergenic
1159174206 18:64813308-64813330 AATGTAGCTGCTTCATACTGGGG + Intergenic
1162164284 19:8741945-8741967 AATGAAACTCTTTCTCCCTGGGG + Intergenic
1162165357 19:8749413-8749435 AATGAAACTCTTTCTCCCTGGGG + Intergenic
1162166422 19:8756869-8756891 AATGAAACTCTTTCTCCCTGGGG + Intergenic
1162167488 19:8764325-8764347 AATGAAACTCTTTCTCCCTGGGG + Intergenic
1162168426 19:8770623-8770645 AATGAAACTCTTTCTCCCTGGGG + Intergenic
1162169496 19:8778073-8778095 AATGAAACTCTTTCTCCCTGGGG + Intergenic
1162170176 19:8783387-8783409 AATGAAACTCTTTCTCCCTGGGG + Intergenic
925309929 2:2875159-2875181 AGTGTGGCCCGTTCACACTGGGG - Intergenic
925472410 2:4176288-4176310 AATGTAGCTGCTTCATACTGGGG - Intergenic
934019180 2:87926799-87926821 ACTGCAGCTCTTTCTCACTACGG - Intergenic
935321609 2:101895037-101895059 AAAGTAGCTCTTTCTCAGTTTGG + Intergenic
941640356 2:167981296-167981318 AATGTAGCTGGTTGACAATGTGG + Intronic
943516083 2:188888891-188888913 TATGTAGCTCATTATCAGTGAGG - Intergenic
943736532 2:191362459-191362481 AGTGTAGCTCATTCTCCCTAAGG + Intronic
945160575 2:206886039-206886061 TATGTACTTCCTTCTCACTGAGG - Intergenic
946802489 2:223434896-223434918 AATGTAACTCTCTCTCAATGTGG - Intergenic
1169663027 20:8001142-8001164 AAGGTAGCTCATTCTCTCTTGGG + Intronic
1169751205 20:8996536-8996558 GATGTAGCTCCTGCTGACTGGGG - Intergenic
1171208738 20:23301001-23301023 AATGTAGCTGCTTCATACTGGGG - Intergenic
1171750301 20:29042899-29042921 AATGTGGATCTTTTTCACTGGGG - Intergenic
1175391785 20:58632145-58632167 CATGGAGCTCCTTCTCAGTGGGG - Intergenic
1181973784 22:26713795-26713817 TGTGTAGCTGGTTATCACTGGGG + Intergenic
953326783 3:42018317-42018339 AATGTACCTTGTTTTCCCTGAGG + Intronic
953386939 3:42512098-42512120 GATGGAGCTCGTGCTCACTGTGG + Intronic
956719068 3:72102358-72102380 AATGAAGCTCATTCCCACTGGGG + Intergenic
959520935 3:107322219-107322241 AATGGAGCTCATTCTCACTGGGG - Intergenic
959906612 3:111717463-111717485 AAAGTAGCTCCTCTTCACTGTGG + Intronic
962272249 3:133986479-133986501 AATGTTGCTCGTCCTCTGTGGGG - Intronic
963882017 3:150538846-150538868 GAGGTAGCTTGTTCTCACAGAGG - Intergenic
964483806 3:157166596-157166618 AGTGTAGCTCCTTCTAGCTGGGG - Intergenic
969277074 4:6143151-6143173 AACTTAGCTCGTACTCACAGGGG - Intronic
970373624 4:15433940-15433962 AATGCATCTTGTTCTTACTGTGG + Intronic
977470111 4:97432636-97432658 AATTTAGCTGCTTCTCACTTGGG + Intronic
985432217 4:189892533-189892555 AATGTGGATCTTTTTCACTGGGG - Intergenic
986127603 5:4897814-4897836 AATGAAGCCCTTTCTCACAGGGG - Intergenic
988650426 5:33142869-33142891 AATGTAAATGGTTCTGACTGTGG + Intergenic
992191055 5:74292329-74292351 AATGTGGCTGTTTCTCACAGTGG - Intergenic
994814413 5:104567010-104567032 AATGAAGCTCACTCACACTGTGG + Intergenic
999802224 5:155048830-155048852 TATGTAACTCGTTCCCCCTGGGG - Intergenic
1000850765 5:166337522-166337544 AATCTACCTCGATTTCACTGAGG + Intergenic
1005141941 6:22642122-22642144 AAAGTAGCTCATTCTCTCTCTGG + Intergenic
1005198927 6:23321166-23321188 AAAGTAGCTGGTGCTCACTTTGG - Intergenic
1006934770 6:37709799-37709821 GCTGGAGCTCGGTCTCACTGGGG - Intergenic
1012690994 6:102310608-102310630 AAATTAGCTACTTCTCACTGTGG + Intergenic
1021815219 7:24440598-24440620 AATGTAGCTGGGACTCAATGTGG - Intergenic
1022975805 7:35555607-35555629 AATGTAGATCCTGCTCCCTGAGG - Intergenic
1027157249 7:75777397-75777419 ACTGTAGTTCATTCTCACTGCGG - Intronic
1031129783 7:117818889-117818911 AATGCAGCTCGTTGTATCTGTGG - Intronic
1038302866 8:26370840-26370862 AATACAGCTCATTCTTACTGTGG + Exonic
1038513085 8:28159008-28159030 AATGTAGCTCGTAGTCACAGGGG - Intronic
1041480733 8:58317103-58317125 CATGTGCATCGTTCTCACTGTGG + Intergenic
1041524586 8:58790982-58791004 AATATAGGTTCTTCTCACTGGGG - Intergenic
1045259362 8:100559122-100559144 AAAGCAGATCGTTCTCTCTGAGG - Intronic
1046491633 8:114960251-114960273 AATGTCCATCGTCCTCACTGTGG - Intergenic
1046959006 8:120090437-120090459 AATGTATCTCGGTCTCACAGTGG - Intronic
1047010279 8:120664974-120664996 AATGTAGCAGTATCTCACTGTGG + Intronic
1050681059 9:8112034-8112056 AAACTAGCTCTTTCTCAATGGGG - Intergenic
1055972119 9:81921744-81921766 AATGTAGCCCCTTCAAACTGGGG - Intergenic
1055973872 9:81936816-81936838 AATGTAGCCCCTTCAAACTGGGG - Intergenic
1186386436 X:9114908-9114930 AATGAAGCTCATCCACACTGGGG - Intronic
1186979503 X:14944209-14944231 AATGCAGCTCGTTCTCAGGATGG + Intergenic
1189853567 X:45200680-45200702 ATTGTAGCTGGTTCTGACTTGGG + Exonic
1190145801 X:47890672-47890694 AAAGTAGCTAGTTTTCAGTGGGG - Intronic
1192207747 X:69107397-69107419 AATGTTGCCCTTTCTCCCTGGGG + Intergenic
1196048151 X:111277919-111277941 TATGTAGCTGGTTCTAGCTGGGG - Intergenic
1196146386 X:112321963-112321985 AATGTTGCACTTTCTCACTGTGG - Intergenic
1197356308 X:125440134-125440156 AATGTAGCTGTTTCATACTGGGG - Intergenic
1197827966 X:130611113-130611135 AATGATGCTCGCTCACACTGGGG - Intergenic
1199125348 X:144112340-144112362 ACTGCAGCTCTTTCTCACTACGG + Intergenic
1202146604 Y:21805531-21805553 AATGTAGCTGGGGCTCAGTGAGG + Intergenic