ID: 1151709417

View in Genome Browser
Species Human (GRCh38)
Location 17:75793656-75793678
Sequence CTGTGAATAAAGAATAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 497}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151709417 Original CRISPR CTGTGAATAAAGAATAAGGA AGG (reversed) Intronic
901592045 1:10352426-10352448 CTTTGAATAAAGAATCAATATGG + Intronic
902385748 1:16074719-16074741 TTTTGAAGAATGAATAAGGAGGG + Intergenic
903274633 1:22212767-22212789 CTGTTAATAAAGAATAATTATGG + Intergenic
903413094 1:23162943-23162965 ATGTTAATAAAGAATAAGGCTGG + Intronic
904590295 1:31610756-31610778 CTGTGACTAAAGATAGAGGAAGG - Intergenic
905682487 1:39884014-39884036 CTGTGAAAGAATAATAGGGACGG - Intergenic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
906633638 1:47393126-47393148 CTGTTAAAAAAAAAAAAGGAAGG - Intergenic
907831898 1:58072175-58072197 GTGTGAAAAAAGTATAAAGAAGG - Intronic
908586371 1:65574433-65574455 CTGTGAATAAAAAATTAGGGGGG + Intronic
909049115 1:70747078-70747100 TTTTGTATAAGGAATAAGGAGGG + Intergenic
909197256 1:72643262-72643284 GTGTGAATAAAGAAAAAAGTAGG - Intergenic
909221421 1:72966720-72966742 CTCTGAATCAAGAATAAGAGTGG + Intergenic
909938864 1:81587810-81587832 CTGTGAAAATAAATTAAGGAGGG + Intronic
911269113 1:95778996-95779018 CTGTGAATAATGAGTTAGAAAGG - Intergenic
911436983 1:97872981-97873003 CTGAAAATAAAGATGAAGGAGGG - Intronic
911443491 1:97961677-97961699 ATATGAATAAAGACTAAGTATGG + Intergenic
911760468 1:101608690-101608712 CTAAGAACAAAAAATAAGGATGG + Intergenic
911844521 1:102733860-102733882 CTCTGAAGAAAAAATTAGGATGG + Intergenic
912156829 1:106931171-106931193 TTCTGAATAAGGTATAAGGAAGG + Intergenic
912162122 1:106997936-106997958 TTCTGAATAAGGTATAAGGAAGG - Intergenic
912279209 1:108295622-108295644 CTGTGAAGATAGAACAAGAAAGG - Intergenic
912289017 1:108398735-108398757 CTGTGAAGATAGAACAAGAAAGG + Intronic
912309711 1:108607838-108607860 CTGTAAATAAAAAATAATGAAGG - Intronic
912423628 1:109566148-109566170 CTGTTCAGAAAGAATGAGGAGGG + Intronic
912590182 1:110810274-110810296 CTGAGAAAAAAGAATAAAGTTGG + Intergenic
913416159 1:118610935-118610957 CTGTGTCTAAAAAAAAAGGAAGG - Intergenic
914082975 1:144426538-144426560 CTGTTTAAAAAGAAAAAGGACGG + Intronic
915107204 1:153542031-153542053 CTGAGAATCAGGAATAGGGAAGG + Intergenic
915197341 1:154199577-154199599 CTAGGAAGAAAGAATAAGAAAGG - Intronic
915609642 1:156981033-156981055 CTGTCTATAAAAAAAAAGGAGGG - Intronic
915630576 1:157151181-157151203 CTGGGAAGGAAGAGTAAGGAAGG + Intergenic
915696733 1:157750731-157750753 CTGTCATTAAAGCATAAGTAAGG + Intronic
915762796 1:158331733-158331755 GTGGGAATAAAGGCTAAGGAAGG - Intergenic
917063133 1:171062781-171062803 CTATTAAGAAAGAAAAAGGAAGG - Intronic
917779957 1:178383741-178383763 CTGTGAATTCTGAATTAGGAGGG - Intronic
918606894 1:186438246-186438268 TTGTGAATAAAAAACATGGAGGG + Intergenic
918690511 1:187473326-187473348 CTGTGATGAAAGAATAAGTGTGG + Intergenic
919275277 1:195406902-195406924 ATCTGAATAAAGAATAATGGAGG - Intergenic
919451482 1:197776777-197776799 CTGTTAGTAAAAAATGAGGACGG + Intergenic
921555809 1:216597417-216597439 CTGTGCATGAAGAAGATGGAAGG + Intronic
922226503 1:223650274-223650296 CTGGGCAGAAAGAATAAGGCAGG - Intronic
922599251 1:226837140-226837162 CTGTGTGTAAGGAAAAAGGATGG - Intergenic
923178532 1:231493310-231493332 ATTTTAATAAAGACTAAGGAAGG + Intergenic
923447705 1:234087915-234087937 CCGTGAACAATGAATAAAGAAGG - Intronic
924401311 1:243685348-243685370 TTGTGCATAAAGTGTAAGGAAGG + Intronic
1063069344 10:2645144-2645166 CTGTAAAGAATGAATCAGGAAGG - Intergenic
1063495967 10:6508645-6508667 TTGTGAATAAGGAGTAAAGATGG + Intronic
1063748454 10:8914185-8914207 TTGAGAATAAAGAATAATTAAGG - Intergenic
1063865457 10:10360447-10360469 ATGTGAAAAAAGAGGAAGGAAGG + Intergenic
1064053387 10:12077679-12077701 ATGTCAATGAAGAATGAGGAGGG + Intronic
1064119431 10:12606072-12606094 CTGTGAAGCAAGCATGAGGAAGG - Intronic
1064204939 10:13314856-13314878 CTGTGAATTCAGGGTAAGGAAGG - Intergenic
1066225529 10:33379182-33379204 CTAAAAATAAAGAATAAAGAAGG - Intergenic
1066613232 10:37272178-37272200 TTTTAAATAAAGTATAAGGAAGG + Intronic
1066761436 10:38757278-38757300 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1066960150 10:42215146-42215168 GTGAGAATGAAGAATAAGGTGGG - Intergenic
1067204878 10:44204061-44204083 CTGAGAATAAAGAATAGAGATGG + Intergenic
1067366322 10:45632367-45632389 AAGTGAATAAATAAAAAGGATGG + Intronic
1068964215 10:62895553-62895575 CTGTAATGAAAGAAGAAGGAGGG + Intronic
1069571489 10:69497039-69497061 CTGTAAAGCAAGAATAAGGATGG - Intronic
1071002727 10:80848881-80848903 CTGTGTAAAAAGAATAAAGCTGG + Intergenic
1071822744 10:89294664-89294686 TTTTGAAAAAAGAATAAGAATGG + Intronic
1071998275 10:91168291-91168313 CTGAGAAGAAAGAAGCAGGAGGG + Intronic
1076668351 10:132105338-132105360 ATGGGAATAAAGGAAAAGGATGG + Intronic
1077663936 11:4091959-4091981 CAGTTAATAAATAATAATGAAGG - Exonic
1079696553 11:23489000-23489022 CTGTGTATAAGGTATAAGGAAGG - Intergenic
1080022911 11:27582257-27582279 TTGTGAATAAAGAAAAAAGTAGG - Intergenic
1080210533 11:29780475-29780497 CCGTGAATCAAGAATAAGAGTGG + Intergenic
1080759489 11:35234589-35234611 CTGCAAATTAAGTATAAGGATGG + Intergenic
1081157947 11:39717485-39717507 CTGTGTGTAAAGAATAATAATGG - Intergenic
1081932554 11:46882155-46882177 ATGGGAATAAAGAAAGAGGAGGG + Intronic
1082312438 11:50668796-50668818 CTGTGAAGACATATTAAGGAGGG - Intergenic
1082622527 11:55441411-55441433 TTTTGTATAAAGCATAAGGAAGG + Intergenic
1083157468 11:60833337-60833359 TTGTGACTAAAGAACACGGAAGG + Intergenic
1083162183 11:60861365-60861387 CTGTGAATAGAGCCTAGGGAAGG - Intergenic
1084585702 11:70060833-70060855 CTGTGTGTAAGGAAAAAGGATGG + Intergenic
1085254066 11:75162481-75162503 CTGTGACCTAAGAATGAGGAAGG + Intronic
1085965509 11:81518314-81518336 CTGGGAATACAGGAAAAGGAAGG + Intergenic
1086065593 11:82740387-82740409 CTGTAAAAAAAAAAAAAGGAAGG - Intergenic
1086277548 11:85148919-85148941 TTTTGTATAAAGTATAAGGAAGG + Intronic
1086737971 11:90330161-90330183 ATATGAATAAATAATAAGGCAGG - Intergenic
1087896668 11:103594108-103594130 CTGTGAAGACTGAATAAAGATGG + Intergenic
1087896793 11:103595025-103595047 CTGTGAAGATTGAATAAAGATGG + Intergenic
1088229967 11:107663530-107663552 CTGTAAATATAGGAGAAGGAGGG - Intronic
1089378979 11:118014283-118014305 TTCTGAATAAATGATAAGGAAGG + Intergenic
1090591404 11:128274056-128274078 CTGTGAAAGAACAAAAAGGAAGG + Intergenic
1090793757 11:130116148-130116170 CTTTGAATAAAAGATAAGGTTGG + Intronic
1091301693 11:134512068-134512090 CTCTGAATTAAGAGCAAGGAAGG + Intergenic
1091899847 12:4135847-4135869 ATGTGAATAAAAAACAAGTATGG - Intergenic
1092427712 12:8387690-8387712 CTGCTATTAAAGAATGAGGATGG + Intergenic
1092428982 12:8394671-8394693 CTGCTATTAAAGAATGAGGATGG + Intergenic
1092604351 12:10102229-10102251 GTGTGAATAAAGAATCCAGATGG + Intronic
1093169667 12:15845627-15845649 GTGTTAATAAAAAACAAGGAGGG - Intronic
1093248521 12:16770200-16770222 TTTTGTATAAAGCATAAGGAAGG + Intergenic
1094149273 12:27264347-27264369 GTGAGAATGAAGAATAAGGTGGG + Intronic
1094210576 12:27885756-27885778 CTGGGAACAAAGAAGAAGGGTGG - Intergenic
1094369367 12:29719959-29719981 CTGTCAATAAAGAAAACGTAAGG - Intronic
1094503172 12:31038140-31038162 CTGTGAGTAAACCATCAGGAAGG - Intergenic
1096437918 12:51610902-51610924 CTTTGAAAAAAGAACAAAGATGG - Intronic
1097581118 12:61458192-61458214 TTCTGAGTAAAAAATAAGGAAGG + Intergenic
1097764107 12:63503951-63503973 CTGTTAATCAAGTATAATGAGGG - Intergenic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098170853 12:67745426-67745448 CTGTGAAGGAAGATGAAGGAAGG - Intergenic
1098680041 12:73342175-73342197 CTTTGAATAATGAATCAGAATGG - Intergenic
1100633643 12:96413385-96413407 ATGTGAATAAACAAAAACGAGGG + Intergenic
1100950558 12:99844410-99844432 TTTTGTATAAAGTATAAGGAAGG + Intronic
1101069385 12:101058033-101058055 TTTTGAATAAAGTGTAAGGAAGG + Intronic
1101838109 12:108309247-108309269 CTGTGAATAAAATACAAAGAGGG + Intronic
1103533266 12:121617332-121617354 CTGTGAAAAAAAAAGAAGGAAGG + Intergenic
1103768382 12:123299886-123299908 CTGTGAAAAGAAAAGAAGGAGGG + Intronic
1104913106 12:132249796-132249818 CTGTGATTACAGAAAAAGGTGGG + Intronic
1105433604 13:20359061-20359083 CTGTGAAAAAAAAAAAAGAAAGG - Intergenic
1105540533 13:21312366-21312388 CTGTGAAATAAGAACCAGGAAGG + Intergenic
1105895427 13:24713232-24713254 CTGTCAAGAAAGATTAAGTAAGG - Intergenic
1107303095 13:38986687-38986709 GTGTGCATAGAGAAAAAGGAAGG - Intronic
1108603897 13:52017899-52017921 CAGTGAAAATAGAATAAAGATGG - Intronic
1109620880 13:64903044-64903066 CAGTAAAAAAAGAATAAAGAAGG + Intergenic
1110862368 13:80357227-80357249 CTTTGAATATAGAATAACCAGGG + Intergenic
1112298035 13:98205848-98205870 CAGGAAATAAAGAATAAGGGTGG - Intronic
1112482682 13:99791605-99791627 CTGTAAAATAAGAGTAAGGATGG + Intronic
1112741219 13:102474763-102474785 CTGTGGATATTGAAAAAGGAAGG - Intergenic
1112891190 13:104233678-104233700 CTTTGAATAATGAGTAAGGGAGG + Intergenic
1112938457 13:104830156-104830178 CTGGGTTTAAAGAAGAAGGAAGG - Intergenic
1113098972 13:106696461-106696483 CAATGAATTAAGAAAAAGGAGGG - Intergenic
1113146750 13:107216455-107216477 CTGTGAAGTAAGCTTAAGGATGG + Intronic
1114810077 14:25888575-25888597 CTGTGAAAAAAAAATTAAGATGG - Intergenic
1114856583 14:26453413-26453435 TTGTGAGTCTAGAATAAGGAAGG - Intronic
1116764063 14:49049520-49049542 CTGTGAGAATAAAATAAGGAGGG + Intergenic
1116766681 14:49080435-49080457 CTTTGTAGAAAGAATTAGGAAGG + Intergenic
1117025188 14:51612194-51612216 TTGTTAATACAAAATAAGGATGG - Intronic
1118211403 14:63769249-63769271 CTAAGAATAGAGAATCAGGAAGG + Intergenic
1118482618 14:66182239-66182261 CTGAGAGAAAAGAAAAAGGAAGG + Intergenic
1118659800 14:67996018-67996040 CTGTGAAAAAAGAAAAAGTAGGG + Intronic
1120099914 14:80433245-80433267 TTGTGAACAAAAGATAAGGAAGG + Intergenic
1120183479 14:81368809-81368831 CTGGGACTAGAGAATGAGGAGGG - Intronic
1120604993 14:86563766-86563788 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1121071172 14:91023133-91023155 CTGAGACTAAGGAACAAGGATGG - Intronic
1121086685 14:91151936-91151958 CTGTCTATAAAGAAAAAAGAAGG - Intronic
1122333051 14:100939756-100939778 CAATGAATGAAGAATAAGAAAGG + Intergenic
1122334550 14:100962039-100962061 ATGTGAAAAAAGGCTAAGGAAGG + Intergenic
1123139802 14:106063906-106063928 CTCTGATTAAATAAGAAGGAGGG - Intergenic
1123188329 14:106541301-106541323 CTCTGATTAAATAAGAAGGAGGG - Intergenic
1202932145 14_KI270725v1_random:47560-47582 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1124813195 15:32962312-32962334 CTTTGTATAAAGTGTAAGGAAGG - Intronic
1124914268 15:33953609-33953631 TTTTGTATAAAGTATAAGGAAGG - Intronic
1125202479 15:37112011-37112033 CTGTGAATGAAGAAAAGGAATGG - Intergenic
1125986081 15:44053591-44053613 ATATGAAACAAGAATAAGGATGG + Intronic
1125987494 15:44068879-44068901 CTGTGAATAAGGTATTGGGAAGG + Intronic
1126394654 15:48201750-48201772 CAATGAATAGAGCATAAGGATGG + Exonic
1126884642 15:53136615-53136637 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1127407322 15:58664640-58664662 CTATGACTAAAGAAAAAGGAAGG + Intronic
1127764131 15:62168038-62168060 GTGTGATTTAAGAATATGGAAGG - Intergenic
1129514147 15:76146683-76146705 CTGGGGACAAAGAAAAAGGAGGG + Intronic
1129894827 15:79095331-79095353 CTGTAGATAAAGAATCAAGAAGG + Intergenic
1130199859 15:81814992-81815014 CTGTGAAAAAAGAAAAAAAAGGG + Intergenic
1130648157 15:85746476-85746498 CTTTGATTAAAGAATGAGGCGGG - Intronic
1130689163 15:86065466-86065488 CTGTGAATAACTAATAAAGCAGG - Intergenic
1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG + Intergenic
1131199708 15:90386655-90386677 CTGTGAATAGAGAATATAGCAGG + Intergenic
1131775461 15:95792130-95792152 ATGTGAATAAAGAATAAATACGG + Intergenic
1133556493 16:6910898-6910920 CTGTTAGTAAAGAGGAAGGAGGG + Intronic
1133837790 16:9381916-9381938 CTGGGTATAAGGAAAAAGGAGGG - Intergenic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134136594 16:11680462-11680484 CTGAGAGCACAGAATAAGGAAGG + Intronic
1134206120 16:12239152-12239174 CTGTGATGAAGGAAGAAGGAGGG + Intronic
1134248359 16:12556731-12556753 ATGTGAATAAAGAAAAATTAAGG + Intronic
1135206707 16:20491309-20491331 CTGTGGGTAAAGAATATGGAAGG + Intergenic
1135212178 16:20532323-20532345 CTGTGGGTAAAGAATATGGAAGG - Intergenic
1136503884 16:30690012-30690034 GTGTGAATATAAAATAATGATGG - Intergenic
1137045138 16:35648924-35648946 TTGTGTATAAAGTGTAAGGAAGG - Intergenic
1137071210 16:35906410-35906432 CTGTGAATAAAGCATACAGTTGG + Intergenic
1137977209 16:53042041-53042063 CGGTGAGGAAAAAATAAGGAAGG - Intergenic
1138030162 16:53553431-53553453 CTGAGAGTAACGAATAAGGCAGG + Intergenic
1138206969 16:55132516-55132538 CTGTGGGTAAAGAACAAGGCTGG - Intergenic
1138869044 16:60858615-60858637 CTGGGAATAAAGAGTAAGCAAGG + Intergenic
1139874423 16:70134032-70134054 AGGTGAATAAAGAATAAGCAGGG - Intronic
1140345627 16:74210273-74210295 ATATAAATAAAGAATAGGGAGGG + Intergenic
1140361357 16:74347105-74347127 AGGTGAATAAAGAATAAGCAGGG + Intergenic
1141283330 16:82648588-82648610 CTCTAAATAAAGAAAAAGAAGGG + Intronic
1142335247 16:89485152-89485174 CTGTGAATAAAGGGTTAAGAGGG - Intronic
1143652711 17:8273756-8273778 TTGTGGATAAAGAAGAAAGATGG - Intergenic
1143702274 17:8669893-8669915 CTGCGAATAAAAAATAGGGAGGG - Intergenic
1144009449 17:11132721-11132743 ATGTGAATAAAAATCAAGGAAGG - Intergenic
1148202919 17:45761812-45761834 CTGGGAAGAAAGAATCAGCAAGG + Intergenic
1149605245 17:57920053-57920075 CTGTGGATCAGGAATAAGAATGG - Intronic
1149979096 17:61295274-61295296 TTGAGAATAAAGTTTAAGGAAGG - Intronic
1150378326 17:64700713-64700735 CTGTGAAAACAGAGTAGGGATGG + Intergenic
1151709417 17:75793656-75793678 CTGTGAATAAAGAATAAGGAAGG - Intronic
1152253418 17:79223665-79223687 CTATGAATAAATAATGATGAAGG + Intronic
1153340024 18:3963856-3963878 CTTTGTACAAAGAAAAAGGAAGG + Intronic
1154097993 18:11438293-11438315 CTGAGAATAAAGAATAAAGCTGG + Intergenic
1154192927 18:12245591-12245613 CTGTCAAAAAAAAAAAAGGAAGG + Intergenic
1154229155 18:12538821-12538843 ATGGGAATAAAGAATAATCAAGG - Intronic
1156285576 18:35691773-35691795 CAGTAACTAAAAAATAAGGATGG - Intronic
1156992028 18:43420443-43420465 AGGGGAATAAAGAAAAAGGAAGG - Intergenic
1157649594 18:49314132-49314154 CTGTGTGTAAAGAAAAGGGAGGG - Intronic
1158531066 18:58262148-58262170 CTCTGAATAAAAAATTAAGAAGG + Intronic
1158821298 18:61162210-61162232 GTGTGAATAAACAGAAAGGAAGG - Intergenic
1159594944 18:70373913-70373935 CAGTGAATCAGGAAGAAGGAAGG - Intergenic
1159639408 18:70845916-70845938 CTGTAATTAAAGAATAAAAATGG - Intergenic
1164195534 19:22954484-22954506 TTTTGTATAAAGTATAAGGAAGG - Intergenic
1164259019 19:23553125-23553147 CTGTGTGTAAGGAAAAAGGATGG - Intronic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1167853321 19:52218228-52218250 CTGTGTATAAAAAAGAAAGAAGG - Intronic
1168301829 19:55409117-55409139 TTCTGAAGAAGGAATAAGGAAGG + Intergenic
926712207 2:15890718-15890740 CTCTGAATAAAGACCAAGGAAGG + Intergenic
926897439 2:17709711-17709733 CAGAGAATAAAGAAAAAGAAGGG + Intronic
928316567 2:30251023-30251045 CTGACAATAAAAAATAAGAATGG - Intronic
929022524 2:37567732-37567754 ATGTGAATAAAGAATAAATAGGG + Intergenic
929023177 2:37574519-37574541 ATGTGAATAAAGAATAAATAGGG + Intergenic
929166879 2:38891408-38891430 CTGTCATTAAAGAAAAAGAAAGG - Intronic
930158187 2:48126864-48126886 ATGAGAATAAGGAATAAGCAAGG - Intergenic
930485061 2:52001184-52001206 TTGTGAATAGAGAGAAAGGAAGG - Intergenic
930975529 2:57454950-57454972 CTGTGTATAAAGAATGGGGGTGG - Intergenic
931010005 2:57899933-57899955 CTGTGAATAATTAAAAAGCAGGG - Intergenic
931588468 2:63854664-63854686 TAGTGATTAAAGAATCAGGAAGG - Intronic
931655053 2:64503144-64503166 CTTGGAAGAAAGAATGAGGAAGG + Intergenic
933046555 2:77545163-77545185 TTTTGTATAAAGTATAAGGAAGG - Intronic
934324750 2:92001952-92001974 GTGAGAATGAAGAATAAGGTGGG + Intergenic
934463128 2:94232657-94232679 GTGAGAATGAAGAATAAGGTGGG + Intergenic
935109752 2:100081587-100081609 CTGTGAATATAGAACATGGGTGG - Intronic
935405235 2:102702412-102702434 TCGTGAAGAAAAAATAAGGAAGG + Exonic
936125222 2:109783622-109783644 CTGTGAATATAGAACATGGGTGG + Intergenic
936219471 2:110587846-110587868 CTGTGAATATAGAACATGGGTGG - Intergenic
940201013 2:151150787-151150809 CTTTGAATAATGATTAAGAAGGG + Intergenic
940256633 2:151737880-151737902 CTATGAATGAAAAATCAGGAAGG - Intergenic
940696927 2:156991498-156991520 TTGTGAATAAAGAACTAGGGAGG - Intergenic
940997444 2:160164999-160165021 CTGGGAACAAAGACTGAGGAGGG - Intronic
941483817 2:166053259-166053281 ATGTGAACAAAGATTAATGATGG - Intronic
941841226 2:170086838-170086860 CCCTGAAATAAGAATAAGGAGGG + Intergenic
943321936 2:186455365-186455387 AGGTGAATAAAGAAGAGGGAGGG - Intergenic
943954457 2:194170281-194170303 CTGTGTAGAAAGAATAAAAATGG - Intergenic
944199885 2:197095305-197095327 CAGTGAGAAAAGAATAAAGATGG + Intronic
944358063 2:198816915-198816937 CTAAGAAGAAAGAATAAGGAAGG - Intergenic
945597003 2:211808297-211808319 TTTTGAATAAAGTGTAAGGAAGG + Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
947431378 2:230031162-230031184 TTGTTAAGAAAGAATAAGGCTGG - Intergenic
1169350527 20:4864533-4864555 CTGTTACTATGGAATAAGGAAGG + Intronic
1169499702 20:6147717-6147739 CTGGGGATAATGAATAAGGAAGG + Intergenic
1170084711 20:12515617-12515639 CTAAGAATAAAGAATCTGGAGGG - Intergenic
1170227577 20:14008941-14008963 CTGTGTATAAGGTGTAAGGAAGG - Intronic
1170530119 20:17282746-17282768 CTGTGAAAAAAAAAAAAGAAAGG + Intronic
1170975679 20:21161815-21161837 CTGTGTATAAACAATTAGGTGGG - Intronic
1171370950 20:24661586-24661608 ATGGGAATAAAAAGTAAGGAAGG + Intronic
1172301998 20:33856887-33856909 CTGTTAACAAGGAAGAAGGAGGG + Intergenic
1172503545 20:35444269-35444291 CTGTGAAGAAAAATTAAGCAGGG + Intronic
1172549784 20:35789858-35789880 CTGTGTATAAAAAAAAAGGGGGG - Intronic
1173381547 20:42548813-42548835 CAGTCAATAAAGAAGAGGGAAGG + Intronic
1173796899 20:45867381-45867403 GTGTTAATAAAGCCTAAGGAAGG + Intronic
1174091035 20:48047789-48047811 CAGTTAATAAGGAAGAAGGAAGG + Intergenic
1174582524 20:51582174-51582196 CTCTGGATTAGGAATAAGGATGG - Intergenic
1174761713 20:53212963-53212985 CTGTGGATCAAAAGTAAGGAGGG + Intronic
1174820439 20:53722240-53722262 CTGTTCACAAAGAATAGGGATGG - Intergenic
1174877460 20:54242966-54242988 TTTTGTATAAGGAATAAGGAAGG - Intergenic
1175055572 20:56194415-56194437 CTGAGAAAAAAGAAAAAAGAGGG - Intergenic
1176155612 20:63618673-63618695 CTGGGGAGGAAGAATAAGGATGG + Intronic
1176594174 21:8675698-8675720 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1177118349 21:17111746-17111768 TTTTGAATAAGGTATAAGGAAGG - Intergenic
1177474971 21:21608364-21608386 CTGTGAATGAAGATTCAGGAAGG - Intergenic
1178171395 21:30044311-30044333 CTGTCAATAATAAATAAGGCTGG - Intergenic
1178716911 21:34973327-34973349 CTGTGAATGGAGAAGAACGAGGG + Intronic
1179528494 21:42000626-42000648 CTTTGAATAATGCATAAAGAAGG - Intronic
1180277027 22:10652828-10652850 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1180507494 22:16027675-16027697 CTGTGAAAAAACAAAAAGGCTGG + Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1184553908 22:45222115-45222137 CTGAGGAAAAAGAATAAGGTTGG + Intronic
949314323 3:2734726-2734748 CTGAGAAAAAAGAATAAAGTTGG - Intronic
949379846 3:3432319-3432341 TTGTGAAACAAGAATAAGGGAGG - Intergenic
950298393 3:11851912-11851934 CTGGGACTAAAGGATGAGGAAGG - Intergenic
950740950 3:15051584-15051606 CTATGAGGAAAGAACAAGGAAGG + Exonic
950885394 3:16358048-16358070 CTGTGGAAAAAGAAAAAGGCGGG + Intronic
951114231 3:18840940-18840962 TTGTGAAGAAAGAATAGGGCTGG - Intergenic
952275690 3:31873689-31873711 CTGAGAATAAAGAAGAAACACGG + Intronic
952470493 3:33645245-33645267 CTGGGTATAAGGAATAAGGCAGG - Intronic
952471894 3:33663516-33663538 CTGGGAATAAAGAATAAATTGGG + Intronic
953117968 3:40011326-40011348 CTGTCATTAAAGAAGAAGGGAGG + Intronic
953840905 3:46389598-46389620 CTGTGTGTAAGGAAAAAGGATGG + Intergenic
955783990 3:62516826-62516848 GTGTGAATAATGACTAAAGAGGG + Intronic
955878174 3:63515619-63515641 CTGAGAAAAAAGAACAGGGAAGG + Intronic
955929682 3:64044212-64044234 CATAGAATAAAGAACAAGGAAGG - Intergenic
956863698 3:73349132-73349154 CAGTGAAGAAAGAAGTAGGATGG + Intergenic
958064523 3:88526338-88526360 CTGTGATCAAAGAATATGGTTGG + Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959027873 3:101262033-101262055 CTGAGGAGAAAGAATAAGAAAGG - Intronic
959935000 3:112020117-112020139 CTGTGTAAAAGGAATAAAGATGG + Intergenic
959979588 3:112500824-112500846 CTGTGAACACAGGAAAAGGAAGG - Intergenic
960421007 3:117445150-117445172 CTGTAAAAATAGATTAAGGATGG - Intergenic
960484804 3:118238923-118238945 ACGTGAATAAAGAAAAAGGATGG + Intergenic
960598201 3:119427153-119427175 CTCTGAAAAAAAAATAAAGAAGG - Intergenic
962522741 3:136212235-136212257 CTGTTATTAAGGAACAAGGAGGG + Intergenic
962553629 3:136523765-136523787 TTTTGTATAAAGTATAAGGAAGG + Intronic
962833716 3:139167640-139167662 TTTTGTATAAAGTATAAGGAAGG + Intronic
962861741 3:139409555-139409577 CTGTGTATAAGGTGTAAGGAAGG - Intergenic
962997442 3:140644784-140644806 TTGTGTATAAGGTATAAGGAAGG + Intergenic
964361629 3:155904142-155904164 ATGTTAATAGGGAATAAGGAAGG + Intronic
964688169 3:159420507-159420529 TTATGAATTAAAAATAAGGAGGG - Intronic
964818671 3:160745562-160745584 CTGTGATTGAAGAGTCAGGAAGG + Intergenic
964966822 3:162504466-162504488 TTTTGTATAAAGTATAAGGAAGG - Intergenic
965020746 3:163227106-163227128 CTAAGAAGAAAGAATAAAGAAGG - Intergenic
965210450 3:165780230-165780252 CTTTGTATAAAGTGTAAGGAAGG - Intronic
965217714 3:165884715-165884737 GTGTGAGTAAAGAGAAAGGATGG - Intergenic
965391298 3:168107659-168107681 CTGTAAATGACTAATAAGGATGG + Intergenic
965857546 3:173106415-173106437 CTGTAACTAAAGAATAAATAAGG + Intronic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
966292100 3:178371512-178371534 CAGTAAATAATGAATAATGAAGG - Intergenic
967202186 3:187081869-187081891 ATGTTAATAAAAACTAAGGATGG - Intergenic
968144847 3:196289375-196289397 CTGTGGACAAAGAAAATGGATGG + Intronic
969625296 4:8301088-8301110 GTGTGAATCAATAATAAAGATGG - Intronic
969693502 4:8721546-8721568 CTGGGAGTAAAGAATACTGAGGG - Intergenic
970206011 4:13656129-13656151 CAGTGAAGGAAGAACAAGGAAGG + Intergenic
970630046 4:17931352-17931374 ATCCGAATAAAGAACAAGGAAGG - Intronic
970969746 4:21968153-21968175 TTTTGAATATAGCATAAGGAAGG - Intergenic
971178483 4:24304869-24304891 CTTTTAAGAAAGAATAAAGAAGG + Intergenic
971885072 4:32434446-32434468 CTGTGGTAAAAGAATAAAGAAGG - Intergenic
972046784 4:34675412-34675434 CTCTGAATAAAAAATAAGTCAGG - Intergenic
972910229 4:43806960-43806982 GTGTAAATAAAGTATAAAGAGGG - Intergenic
973133673 4:46678877-46678899 TTTTGTATAAAGTATAAGGAAGG - Intergenic
974444106 4:61956707-61956729 TTGTGTATAAGGTATAAGGAAGG + Intronic
974937460 4:68425146-68425168 TTTTGTATAAAGTATAAGGAAGG - Intergenic
974938643 4:68437774-68437796 TTTTGTATAAAGTATAAGGAAGG + Intergenic
975958748 4:79875016-79875038 CTGTAAATAAGGAATAATAATGG + Intergenic
976081367 4:81358868-81358890 TTAGGCATAAAGAATAAGGAGGG + Intergenic
976709029 4:88049530-88049552 TTGTTTATAAAGAACAAGGAAGG + Intronic
976779445 4:88742242-88742264 TTTTGAACAAAGAGTAAGGAAGG - Intronic
976961170 4:90976692-90976714 CTGTAAATAAATAAAAATGAAGG + Intronic
978049740 4:104183691-104183713 TTTTGTATAAAGTATAAGGAAGG - Intergenic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978806008 4:112801103-112801125 GTGTGAATTCAGAATGAGGAGGG + Intergenic
978980267 4:114936481-114936503 ATATGAATAATGAATTAGGAAGG + Intronic
979132166 4:117060804-117060826 CTGTGCAAACAGAATAAGGTAGG + Intergenic
980057371 4:128091320-128091342 ATGTGAATAAAGAAAAAGAAAGG - Intronic
980589137 4:134861078-134861100 CTGTGAGAAAAGATTAAAGAAGG - Intergenic
981131047 4:141158849-141158871 CTGTGAATAAATTGGAAGGATGG - Intronic
981752420 4:148105178-148105200 GTGTGAATAAAAAATAATAAAGG + Intronic
982328997 4:154160517-154160539 CTAAGAATAAAGAATAATCACGG + Intergenic
982596374 4:157389887-157389909 ATGCCAATAAAGAATAAGAAAGG - Intergenic
982892790 4:160877091-160877113 ATATGAACAAAGAAAAAGGAAGG - Intergenic
983107351 4:163704358-163704380 TTGTAAATAAAAAATAAGCAAGG + Intronic
983565133 4:169142533-169142555 TTTTGCATAAAGAATAAGGTCGG + Intronic
983970769 4:173870291-173870313 CTGTCATTGAAGAATAATGAAGG + Intergenic
984008455 4:174342302-174342324 CTGTATAGAAAAAATAAGGAAGG + Intergenic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
985380057 4:189384038-189384060 CTGTGAAGAGAGAGTAAAGATGG - Intergenic
987162967 5:15163939-15163961 CCATGAACTAAGAATAAGGATGG + Intergenic
987610149 5:20192521-20192543 TTTTGAATAAGGAGTAAGGAAGG + Intronic
987625981 5:20400956-20400978 GTATGAGTAAAGAATAAGTAAGG - Intronic
988450930 5:31342422-31342444 GTGAGAATAAAAAATAGGGAAGG + Intergenic
989062377 5:37422080-37422102 CTGAGGGTAAAGGATAAGGATGG + Intronic
989612624 5:43309960-43309982 CTTTGAATCAAGGCTAAGGAGGG - Intronic
990603828 5:57387403-57387425 CTGTGACTAATTAATAAGAAGGG + Intergenic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
990727287 5:58770068-58770090 GTATTATTAAAGAATAAGGAGGG + Intronic
990742977 5:58931156-58931178 CTGTGAATATAAAATAAAGGGGG + Intergenic
990756404 5:59076042-59076064 CTTTGAATAAACCAGAAGGAAGG + Intronic
991322435 5:65389246-65389268 CTTGGAATAAAGAAAAATGATGG + Intronic
992197719 5:74356297-74356319 CAGAGAATAAAGAAAAAAGAAGG + Intergenic
992837817 5:80657607-80657629 CTGAGGATAATGAATAAAGATGG - Intronic
993014498 5:82520240-82520262 GTGAGAATAAAGAAGATGGATGG + Intergenic
993390139 5:87310520-87310542 CTTTGCATAAAGAAGTAGGAAGG + Intronic
993644452 5:90445395-90445417 ATCTGAAGAAAGAAGAAGGAAGG - Intergenic
995671036 5:114603140-114603162 TTTTGTATAAAGTATAAGGAAGG - Intergenic
995744218 5:115387008-115387030 ATGTGAATTAAGAATAAGAGAGG + Intergenic
996095477 5:119394476-119394498 CTGTGTATAAATAATAAAGTAGG + Intronic
996109326 5:119546512-119546534 CTGTCAGTAAAGAACAATGATGG + Intronic
996215898 5:120865124-120865146 CTGTGAATACAGAAAGAGAATGG - Intergenic
996252618 5:121355087-121355109 CTGTGAATCAGAAATAATGAGGG - Intergenic
996822162 5:127641905-127641927 ATGGGACTATAGAATAAGGAAGG + Intergenic
997224008 5:132195240-132195262 CTGTGAAGAAAGGACAGGGAGGG - Intronic
998427642 5:142042600-142042622 TTTTGTATAAAGTATAAGGAAGG + Intergenic
998456490 5:142277857-142277879 CTGTGAATGAAGAACAAAGAGGG - Intergenic
998769855 5:145530571-145530593 TGGAGAAGAAAGAATAAGGAGGG + Intronic
999501903 5:152155474-152155496 TTTTGAATAAAGTGTAAGGAAGG + Intergenic
1000353815 5:160374000-160374022 CAGTGATGAATGAATAAGGAAGG + Intergenic
1000704534 5:164494246-164494268 TTGTGCATAGAGAAGAAGGAAGG + Intergenic
1000855022 5:166387514-166387536 CTGTGACAAAATAATAAGGTAGG + Intergenic
1001665121 5:173426435-173426457 CTGGGACTCAAGAACAAGGAGGG + Intergenic
1001866310 5:175108715-175108737 CTGACAATAAATAATAAGAAAGG - Intergenic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1003412681 6:5879452-5879474 CTGTGAAATAAGAACCAGGAAGG - Intergenic
1003686005 6:8302877-8302899 CTGGGAATCAAGGATAAGGAAGG - Intergenic
1003707031 6:8544035-8544057 ATATTAATAAAGAAAAAGGAGGG - Intergenic
1003841197 6:10121770-10121792 CTGTGAATGAAGAATAATAAAGG + Intronic
1003918201 6:10807103-10807125 CAGTGCAGAATGAATAAGGAGGG - Intronic
1004465225 6:15878953-15878975 CTGTGAGTAACTACTAAGGAAGG - Intergenic
1004649169 6:17591989-17592011 CTCTGAAGAAAGAGTAATGATGG + Intergenic
1005436731 6:25820052-25820074 GTGTGATAAAAGAATAAAGAAGG - Intronic
1005476908 6:26216919-26216941 CACTGAATAAAGAAAAAGAATGG - Intergenic
1006079569 6:31557675-31557697 ATGGGAATAAAGAATAAGGATGG + Exonic
1008138368 6:47803105-47803127 CTGTGGATAAAATAGAAGGAAGG + Intronic
1008711839 6:54237026-54237048 CTGTGAATAATCAATAATGAGGG + Intronic
1009612118 6:65959171-65959193 CTGGGAATAAATTATAAAGAAGG - Intergenic
1009715668 6:67391592-67391614 CTGTGAAAAAACAAAAAGGCTGG - Intergenic
1011235032 6:85206961-85206983 TTTTGTATAAAGTATAAGGAAGG - Intergenic
1011995214 6:93578124-93578146 CTGTGAAAAGTGAAAAAGGAAGG + Intergenic
1012381909 6:98630293-98630315 CTTTGAATGAATAATAAGGGTGG + Intergenic
1012644186 6:101659183-101659205 TTTTGTATAAAGAATAAGGAAGG + Intronic
1012878867 6:104761518-104761540 TTTTGTATAAAGTATAAGGAAGG - Intronic
1013580478 6:111529387-111529409 CTTTGAGTAGAGAATCAGGAAGG - Intergenic
1014249734 6:119102943-119102965 CTGTTAAGAAAGAATAAGAAGGG - Intronic
1014409512 6:121097017-121097039 TTTTGTATAAAGTATAAGGAAGG - Intronic
1014502561 6:122210570-122210592 GTCTCAATAAAGAATAAGAAAGG + Intergenic
1014784970 6:125608471-125608493 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1014845463 6:126270328-126270350 ATGCAAATATAGAATAAGGATGG + Intergenic
1015361991 6:132350649-132350671 CTGTGAAGAAAGAATGATGGTGG + Intronic
1015464542 6:133534026-133534048 ATGGAAATAAAGAACAAGGATGG + Intergenic
1015486208 6:133772851-133772873 CTGTGGTTAAAGAAAAAAGATGG + Intergenic
1015728284 6:136322007-136322029 GTGTGAATAAGGACTAAGCAAGG - Intergenic
1016811466 6:148265303-148265325 CTGCCAAGAAAGAAAAAGGAGGG + Intergenic
1016834769 6:148466163-148466185 CTGTGAATACAGAACATGTAAGG - Intronic
1018102943 6:160457365-160457387 CTGTTGAGAAAGAATAAGAAAGG - Intergenic
1020484774 7:8707884-8707906 ATGAAAATAAAGAATAAGAAAGG - Intronic
1020568445 7:9826038-9826060 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1020681604 7:11244112-11244134 CTGTAAATAAAAAATAGCGAAGG + Intergenic
1021064827 7:16160338-16160360 TTTTGAATAAGGTATAAGGAAGG + Intronic
1021094453 7:16519679-16519701 CTGTGAATAATCATTAAGGAAGG + Intronic
1021348552 7:19558725-19558747 GGGTGGATAAAGAATAATGATGG - Intergenic
1021615814 7:22501423-22501445 CTGTGAATAAAAAACAATCATGG - Intronic
1022144701 7:27525335-27525357 ATGGGAATAAAGAGAAAGGAGGG - Intergenic
1023798971 7:43816628-43816650 CTTTGAAAAAAAAATAAGCAGGG + Intergenic
1024386333 7:48755959-48755981 CTATCTATAAAGAGTAAGGAAGG + Intergenic
1024732718 7:52271171-52271193 CTGAGAATAAAGCATGAGGCAGG - Intergenic
1024947668 7:54826983-54827005 TTTTGAATACAGTATAAGGAAGG - Intergenic
1025121702 7:56309726-56309748 TTGTGTATAAAGTGTAAGGAAGG + Intergenic
1025138934 7:56446738-56446760 CTATGAATAACGAATAAGGAAGG + Intergenic
1025286487 7:57666611-57666633 CTGTGAAAAAAGAAAAATGGTGG - Intergenic
1025843628 7:65175591-65175613 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1025894023 7:65682213-65682235 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1026395603 7:69950739-69950761 GTGTGAATAAAGAAGAGGAATGG + Intronic
1026429721 7:70332784-70332806 TTTTGTATAAAGTATAAGGAAGG - Intronic
1027004606 7:74682225-74682247 TTGAGAATAAAGGATATGGAAGG + Intronic
1028808693 7:95059406-95059428 ATGTGAATAAAGAAAAAGTGGGG - Intronic
1029074678 7:97926341-97926363 CTGCTATTAAAGAATGAGGATGG + Intergenic
1030227997 7:107173515-107173537 CTGTGAATAAAGTATTATTATGG - Intronic
1030257002 7:107521114-107521136 TTTTGAATAAGGTATAAGGAAGG - Intronic
1030552554 7:110981808-110981830 CTGTGGAGCAAAAATAAGGAAGG - Intronic
1031623495 7:123965472-123965494 TTTTGTATAAAGTATAAGGAAGG + Intronic
1032731736 7:134649838-134649860 CTGGGAATAAAGTAAAATGAAGG - Intronic
1032976985 7:137236451-137236473 CTGTAAATAACAAATAAGGATGG - Intronic
1033211705 7:139464633-139464655 CTGTGTATAATGAAAAAGGTTGG - Intronic
1033655533 7:143371308-143371330 CTATGAAGAAAAATTAAGGAAGG + Intergenic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1035842779 8:2830380-2830402 TTCTGAATGCAGAATAAGGAGGG + Intergenic
1035920407 8:3669885-3669907 ATGTTAAGAAAGAAGAAGGAAGG - Intronic
1036257766 8:7219120-7219142 CTGTTATTAAAGAACGAGGATGG + Intergenic
1036259015 8:7226117-7226139 CTGTTATTAAAGAACGAGGATGG + Intergenic
1036307606 8:7613394-7613416 CTGTTATTAAAGAACGAGGATGG - Intergenic
1036309814 8:7677716-7677738 CTGTTATTAAAGAACGAGGATGG + Intergenic
1036311068 8:7684713-7684735 CTGTTATTAAAGAACGAGGATGG + Intergenic
1036358458 8:8061395-8061417 CTGTTATTAAAGAACGAGGATGG - Intergenic
1036359720 8:8068403-8068425 CTGTTATTAAAGAACGAGGATGG - Intergenic
1036577592 8:10042849-10042871 CTCTGAATAAAGATTAAAGTAGG + Intergenic
1036891238 8:12598567-12598589 CTGTTATTAAAGAACGAGGATGG + Intergenic
1036892497 8:12605557-12605579 CTGTTATTAAAGAACGAGGATGG + Intergenic
1037497507 8:19453988-19454010 ATGTGATTAAAGACTAATGAAGG + Intronic
1037622160 8:20574052-20574074 CTGTGAAGAAAAAGGAAGGAGGG - Intergenic
1037705964 8:21315399-21315421 CTTTGAATTCAGAAAAAGGAGGG - Intergenic
1038117172 8:24570390-24570412 CTGTCAATAAATAAAAGGGAAGG - Intergenic
1038880018 8:31599243-31599265 ATATGAAAAAAGAATAAGGAAGG - Intergenic
1038988291 8:32837408-32837430 ATGTAAATAAGTAATAAGGACGG - Intergenic
1039627500 8:39069025-39069047 CTGGCTATAGAGAATAAGGAGGG - Intronic
1039741442 8:40386660-40386682 CAGAGAATAAAGGACAAGGAGGG - Intergenic
1039842665 8:41304832-41304854 GTGTCAATAAAAACTAAGGATGG - Intronic
1041425326 8:57714218-57714240 TTTTGTATAAAGTATAAGGAAGG - Intergenic
1041428445 8:57750116-57750138 GTGTAAATAAATAATGAGGAAGG + Intergenic
1041596809 8:59664709-59664731 CTGTGAAGAAAGAAAAAAAATGG + Intergenic
1041678579 8:60562488-60562510 CTGTTATTAAAGAACAAAGATGG + Intronic
1042553084 8:70011625-70011647 TTTTAAATAAAGAATAAGGCTGG - Intergenic
1042929081 8:73995919-73995941 CTGTGAAAGAAAAATAAGGCTGG + Intronic
1043089271 8:75876877-75876899 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1043309115 8:78836222-78836244 TTTTGTATAAAGTATAAGGAAGG - Intergenic
1044431816 8:92116433-92116455 CTGAGAAAAAAGAATAAAGGTGG - Intergenic
1044937125 8:97303874-97303896 GGGTGTATAAAGAATAGGGAGGG + Intergenic
1045082452 8:98642360-98642382 ATGTGAATAAGAGATAAGGATGG - Intronic
1045483260 8:102609979-102610001 CTGTTAACAAAGAACAGGGAAGG + Intergenic
1045641173 8:104252651-104252673 CTATGATTAAAGAATAAACATGG - Intronic
1046387815 8:113526255-113526277 CTCAGAAGAAACAATAAGGATGG + Intergenic
1046597803 8:116281905-116281927 ATATGAATAAAGAAAAATGAAGG - Intergenic
1046840846 8:118855315-118855337 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1046895747 8:119470525-119470547 CTGTGAATAAGGAATTTAGAAGG - Intergenic
1050623957 9:7483852-7483874 CTTTGTATAAGGTATAAGGAAGG - Intergenic
1050791340 9:9474383-9474405 CTGTGTAAAAAGAATAAAGCTGG - Intronic
1050856697 9:10366308-10366330 CTATGTATACAGAATACGGAAGG + Intronic
1051023322 9:12572494-12572516 GAGTGACTAAAAAATAAGGAGGG + Intergenic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051994624 9:23200334-23200356 CTGTGGAAAAAGGATAATGAGGG + Intergenic
1052212354 9:25920614-25920636 CTGAGAACAAAGAATAATGCGGG + Intergenic
1052288717 9:26818323-26818345 CTATGAATCAAGAATTGGGATGG - Intergenic
1052497634 9:29247470-29247492 TTTTTAATAAAGAATAAGAAAGG + Intergenic
1054954526 9:70893393-70893415 AAGTGAATAAAGAATATGAATGG + Intronic
1056718221 9:89051472-89051494 CTGTGAAGTAGGAATAAGAATGG - Intronic
1057691437 9:97290163-97290185 CTGTCAAAAAAAAAGAAGGAAGG + Intergenic
1058603827 9:106699572-106699594 CTGTGAATCACGAAGCAGGAGGG - Intergenic
1058930448 9:109714082-109714104 CAGTGAATAAACAATCAGGCTGG - Intronic
1059054329 9:110962947-110962969 CTGTGAATACACACTAAGGTGGG - Intronic
1059058128 9:111005732-111005754 TTGTGAAAACAGAATATGGAAGG - Intronic
1059564800 9:115373247-115373269 GTGTGAATTAAGAGAAAGGAGGG + Intronic
1059764864 9:117374573-117374595 CAGTAAACAAAGAATAATGATGG + Intronic
1060231427 9:121828113-121828135 CTGTGGACAAAGAGTAAGGGTGG - Intronic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1203356487 Un_KI270442v1:153491-153513 TTTTGTATAAAGCATAAGGAAGG - Intergenic
1203624309 Un_KI270749v1:155932-155954 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1185616693 X:1426337-1426359 CAGTGAATAAGGAATAAAGGTGG - Intronic
1185789142 X:2915443-2915465 CTTGCAATAAAGAATAAGGGCGG - Intronic
1186014588 X:5176624-5176646 AAGTGAAACAAGAATAAGGAAGG + Intergenic
1186829646 X:13377944-13377966 CTGAGAATAAAGAAGAATAAAGG - Intergenic
1187372574 X:18722782-18722804 CTATGGAGAAAAAATAAGGAAGG + Intronic
1187584240 X:20642254-20642276 AAGTGAAAAAAGAGTAAGGAAGG + Intergenic
1188472503 X:30556177-30556199 CTGTGTATTAAGCATATGGAGGG - Intergenic
1188582650 X:31733999-31734021 CAGTGAATAAAGAACAAAAAAGG - Intronic
1188622928 X:32248130-32248152 CTACGAAGAAAGATTAAGGAAGG + Intronic
1190534266 X:51409846-51409868 GTGTGAATAAAGCATGAGCAGGG - Intergenic
1191701923 X:64051855-64051877 CTGTGAAAGAAGAATAAAGTTGG + Intergenic
1191810217 X:65178233-65178255 CTTTGTATAAGGTATAAGGAAGG - Intergenic
1192785476 X:74330939-74330961 TTCTGAATAAAGAAAAAGTAGGG + Intergenic
1192922019 X:75716821-75716843 TTTTGTATAAAGAGTAAGGAAGG + Intergenic
1193083631 X:77428778-77428800 CTGAGAATAAAGAAGTAAGAAGG + Intergenic
1193710194 X:84870267-84870289 CTTTGTATAAGGTATAAGGAAGG - Intergenic
1193980471 X:88175992-88176014 GGTTGAATAAAGAATGAGGAGGG - Intergenic
1194005569 X:88487520-88487542 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1194192353 X:90853335-90853357 CTGAGAATAAAGAACAAAAACGG - Intergenic
1194385650 X:93251078-93251100 CTCTCAATATAGAAGAAGGATGG - Intergenic
1194966489 X:100294345-100294367 CACTGAATAAGAAATAAGGATGG + Exonic
1196119763 X:112037263-112037285 CTGTGAAAAAAGGATAAGTAGGG - Intronic
1198241830 X:134795557-134795579 CAGTGAATAAAAAAGAAGGGTGG - Intronic
1198246227 X:134834680-134834702 TTTTGTATAAAGTATAAGGAAGG + Intronic
1198322973 X:135537609-135537631 CAGTGAATTAAGAATTAGAAGGG - Intronic
1198342198 X:135725657-135725679 TTTTGTATAAAGTATAAGGAAGG + Intergenic
1198345792 X:135757638-135757660 TTTTGTATAAAGTATAAGGAAGG - Intergenic
1199146064 X:144368574-144368596 TCATGAAAAAAGAATAAGGAAGG + Intergenic
1199608064 X:149592479-149592501 CTGCAAAGAAAGAAAAAGGATGG + Intergenic
1199631056 X:149776881-149776903 CTGCAAAGAAAGAAAAAGGATGG - Intergenic
1200007548 X:153097831-153097853 CTGTGTGTAAGGAAAAAGGATGG + Intergenic
1200176287 X:154118824-154118846 CTGTAAAAAAAGGAAAAGGAAGG - Intergenic
1200378376 X:155808389-155808411 TTGTGTATATAGCATAAGGAAGG + Intergenic
1201638598 Y:16153760-16153782 TTGTGGATAAAGAAGAAGGCAGG - Intergenic