ID: 1151712685

View in Genome Browser
Species Human (GRCh38)
Location 17:75815583-75815605
Sequence CAGACATCACTAATGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 12, 3: 41, 4: 172}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151712677_1151712685 3 Left 1151712677 17:75815557-75815579 CCAGCCACCCCATGTCATACCCA 0: 1
1: 0
2: 1
3: 20
4: 285
Right 1151712685 17:75815583-75815605 CAGACATCACTAATGGAACATGG 0: 1
1: 1
2: 12
3: 41
4: 172
1151712679_1151712685 -4 Left 1151712679 17:75815564-75815586 CCCCATGTCATACCCATGACAGA 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1151712685 17:75815583-75815605 CAGACATCACTAATGGAACATGG 0: 1
1: 1
2: 12
3: 41
4: 172
1151712675_1151712685 7 Left 1151712675 17:75815553-75815575 CCCACCAGCCACCCCATGTCATA 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1151712685 17:75815583-75815605 CAGACATCACTAATGGAACATGG 0: 1
1: 1
2: 12
3: 41
4: 172
1151712680_1151712685 -5 Left 1151712680 17:75815565-75815587 CCCATGTCATACCCATGACAGAC 0: 1
1: 0
2: 2
3: 11
4: 112
Right 1151712685 17:75815583-75815605 CAGACATCACTAATGGAACATGG 0: 1
1: 1
2: 12
3: 41
4: 172
1151712674_1151712685 27 Left 1151712674 17:75815533-75815555 CCATGGCTGACTTGGCAAATCCC 0: 1
1: 0
2: 2
3: 34
4: 550
Right 1151712685 17:75815583-75815605 CAGACATCACTAATGGAACATGG 0: 1
1: 1
2: 12
3: 41
4: 172
1151712678_1151712685 -1 Left 1151712678 17:75815561-75815583 CCACCCCATGTCATACCCATGAC 0: 1
1: 0
2: 0
3: 13
4: 126
Right 1151712685 17:75815583-75815605 CAGACATCACTAATGGAACATGG 0: 1
1: 1
2: 12
3: 41
4: 172
1151712676_1151712685 6 Left 1151712676 17:75815554-75815576 CCACCAGCCACCCCATGTCATAC 0: 1
1: 0
2: 4
3: 17
4: 224
Right 1151712685 17:75815583-75815605 CAGACATCACTAATGGAACATGG 0: 1
1: 1
2: 12
3: 41
4: 172
1151712681_1151712685 -6 Left 1151712681 17:75815566-75815588 CCATGTCATACCCATGACAGACA 0: 1
1: 0
2: 3
3: 12
4: 184
Right 1151712685 17:75815583-75815605 CAGACATCACTAATGGAACATGG 0: 1
1: 1
2: 12
3: 41
4: 172
1151712673_1151712685 28 Left 1151712673 17:75815532-75815554 CCCATGGCTGACTTGGCAAATCC 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1151712685 17:75815583-75815605 CAGACATCACTAATGGAACATGG 0: 1
1: 1
2: 12
3: 41
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151712685 Original CRISPR CAGACATCACTAATGGAACA TGG Intronic
901201190 1:7468366-7468388 CAGACATCACAAATCGATTACGG - Intronic
903341978 1:22660452-22660474 CAGACATCCCTAATCAACCATGG - Intronic
904298311 1:29538216-29538238 CAGTCATCACCAGTGGGACAGGG - Intergenic
905319886 1:37108346-37108368 CAGACATCACCAATCAATCATGG + Intergenic
911320736 1:96410638-96410660 CATTCATTACTAATGGAACTTGG - Intergenic
912222135 1:107690278-107690300 CAGAGAACCCTCATGGAACATGG - Intronic
916417687 1:164608088-164608110 CAGAAATCACTAATGGATGAAGG - Intronic
917619445 1:176781125-176781147 AAGACATCAGCAATGGAAAATGG + Intronic
918623927 1:186636443-186636465 CAGAAATCACTAATGTAAATTGG + Intergenic
920924380 1:210328363-210328385 CAGAGATCACTACTGCAAAATGG - Intronic
923221396 1:231897445-231897467 CAGTTATCATTTATGGAACAAGG + Intronic
923625461 1:235610332-235610354 CGAACATCATTAATGGGACAAGG - Intronic
924301556 1:242644230-242644252 GAGACATAAATAATGGAACAGGG + Intergenic
1066024543 10:31341517-31341539 GTGACATCACTAATGGAGGAAGG + Intronic
1067123538 10:43495544-43495566 CACACATCAATAATGTATCATGG - Intergenic
1067662425 10:48246496-48246518 CAGACATCACCAATCAAACATGG - Intronic
1069862084 10:71477927-71477949 CAGACATCACTACTCTATCATGG + Intronic
1069893410 10:71665996-71666018 TAGACATTCCTAATGGATCACGG - Intronic
1070847826 10:79538414-79538436 CAGACATCAGTAATCAATCATGG + Intergenic
1070925954 10:80221719-80221741 CAGACATCAGTAATCAATCATGG - Intergenic
1071375534 10:84998596-84998618 CAGACATTACTCCTGGAGCAGGG + Intergenic
1071598503 10:86944635-86944657 CAGACATGACTAATCAATCATGG + Intronic
1073481823 10:103790780-103790802 CAGACATCACTAATTGATCATGG - Intronic
1077332602 11:1990016-1990038 CAGACATCACTGTTGACACAGGG + Intergenic
1079526200 11:21391634-21391656 CAGAAAGCAATAATGAAACAGGG - Intronic
1079552749 11:21720610-21720632 CAGACATCATAAAAGGAACTAGG + Intergenic
1079877881 11:25883141-25883163 CAGTCATCACTAATGGTATCAGG - Intergenic
1080400252 11:31928185-31928207 CAGACATCACTAATCGATCATGG - Intronic
1081540133 11:44028714-44028736 CAGACAAGACTGATGAAACAAGG - Intergenic
1081596838 11:44465342-44465364 CAGACATCACTAATCCATTATGG - Intergenic
1083505122 11:63149552-63149574 CAGACATCAGCAATGGAGGAAGG + Intronic
1083793042 11:64998349-64998371 CAGGCATCACTAATCGATCATGG - Intergenic
1084646893 11:70464018-70464040 CAGCCAACACTAATGGCTCAAGG - Intergenic
1085545118 11:77311118-77311140 CATATATTACTGATGGAACAGGG - Intergenic
1085804287 11:79620293-79620315 CAGACATTATTAATAGATCATGG - Intergenic
1086347360 11:85910621-85910643 CAGACATAACTAAGAAAACATGG - Intronic
1086843773 11:91721947-91721969 CATACATTACAAATGGAAAATGG - Intergenic
1088112816 11:106281672-106281694 CAGACATCAATAATGAATCATGG - Intergenic
1089363368 11:117905752-117905774 CAGACGTCAGTGAAGGAACAAGG + Intronic
1089703389 11:120259418-120259440 CAGACATCACTAATGGATCCTGG - Intronic
1090886101 11:130878199-130878221 CCAACATCACAAAAGGAACAGGG + Exonic
1091287955 11:134419032-134419054 CAGACATCACTAATTGGTCATGG - Intergenic
1202815584 11_KI270721v1_random:45192-45214 CAGACATCACTGTTGACACAGGG + Intergenic
1095727788 12:45471786-45471808 GAGACAGAACTAATGGAACTTGG + Intergenic
1099066513 12:77986884-77986906 CAGACATCACTAATCAATCATGG - Intronic
1100122580 12:91385906-91385928 CCGACATCGCTAATTGATCATGG + Intergenic
1100712320 12:97271119-97271141 CAGACATCACTAATCAATCATGG + Intergenic
1100798656 12:98208972-98208994 CAGACAGCAATAAGGCAACAAGG + Intergenic
1101157137 12:101938532-101938554 CAGACATCACTAATTGATGGTGG + Intronic
1102737596 12:115176963-115176985 CAGACATCACTAATCAAATGTGG - Intergenic
1102784125 12:115590300-115590322 CAGACATCACTGATCCATCATGG - Intergenic
1102919293 12:116779772-116779794 CAGACATCACTAATCAATCATGG - Intronic
1105980835 13:25514766-25514788 GAGACATCAATGATGGAAAAGGG - Intronic
1106524325 13:30526917-30526939 CAGACATTCCTAATGGAGCACGG - Intronic
1106897590 13:34321384-34321406 GAGACTGCACTGATGGAACAGGG + Intergenic
1107438892 13:40406433-40406455 CAGACATCACCAATCAATCATGG - Intergenic
1109696148 13:65961581-65961603 CAGGCTTCACTATTGCAACAAGG + Intergenic
1110767148 13:79293537-79293559 CAGACAGCACGAATGGATCATGG + Intergenic
1112388109 13:98958740-98958762 AACACATCAATAATTGAACATGG - Intronic
1117792212 14:59353098-59353120 CAGACATCACTAATCAATCATGG + Intronic
1117800808 14:59442859-59442881 TGGACATCACTAAGGGAACCAGG + Intronic
1119068053 14:71550753-71550775 TAGACATCACTAATTTAACATGG + Intronic
1119312980 14:73665948-73665970 CAGACATGAATAATTGATCAAGG - Intronic
1121308165 14:92920435-92920457 CAGACATCACTGCTGGGAAATGG + Intergenic
1122051076 14:99060433-99060455 CAGATATTACTAATTGATCATGG - Intergenic
1124008531 15:25814475-25814497 CAGACATCATTGGTGGAACCAGG - Intronic
1125892593 15:43277412-43277434 ATGACATCACTGATGGCACATGG - Intronic
1126620473 15:50634443-50634465 CACACACAACTACTGGAACAGGG + Exonic
1126861069 15:52883760-52883782 CAGGCATCACTAATTAAACATGG - Intergenic
1127702809 15:61517779-61517801 CAAACATCCCTAATATAACATGG - Intergenic
1130885810 15:88091531-88091553 CAGACATCACTAATTGATCATGG - Intronic
1133434913 16:5770836-5770858 CAGACATCACTAGTTGATCACGG + Intergenic
1133843947 16:9437249-9437271 CAGACATCACTAATCAATCATGG + Intergenic
1135173842 16:20210548-20210570 CCGACAACACAAATGGAACTTGG - Intergenic
1136090847 16:27918932-27918954 CAGACATTGCTAATCGATCATGG + Intronic
1137735926 16:50723171-50723193 CAGACATCACTAATTGATTGCGG - Intronic
1137768355 16:50995147-50995169 CAGACATCACTAATGGATCACGG + Intergenic
1138751226 16:59423866-59423888 CAGACATCCCAAATGAAAAATGG - Intergenic
1138956685 16:61979460-61979482 CAGACATCACTGGTTGATCAAGG + Intronic
1139210883 16:65075527-65075549 GAGAAATCCCTAATGGAAGAAGG - Intronic
1139370153 16:66462067-66462089 CAGACATTACTAATTGACCATGG - Intronic
1139523782 16:67500638-67500660 CTGGCATGACTAAAGGAACAGGG + Intergenic
1139790143 16:69427465-69427487 GAGACATCACTAATGTGCCAAGG + Intronic
1142603278 17:1067744-1067766 CAGACATCACTAATCAACTAGGG - Intronic
1145244243 17:21257817-21257839 CAGAAATCCCTTCTGGAACAAGG + Intergenic
1146290856 17:31606060-31606082 CAGACATCATTAATCCATCAAGG - Intergenic
1149601006 17:57892893-57892915 CAGACATCACTAATCCACCCAGG + Intronic
1151133152 17:71919220-71919242 CAGAAAACACTGATGGTACAGGG + Intergenic
1151712685 17:75815583-75815605 CAGACATCACTAATGGAACATGG + Intronic
1152276191 17:79358962-79358984 CAGACACCACGAGTGGCACAGGG + Intronic
1153753176 18:8254284-8254306 CAGAATTAACTAATGGCACAGGG - Intronic
1155062584 18:22241852-22241874 CACAAATCACGGATGGAACAAGG + Intergenic
1156713794 18:39981824-39981846 CATAAACCACAAATGGAACAGGG - Intergenic
1157647466 18:49290608-49290630 CAGAAATCACTAAGTGAAAAAGG + Intronic
1158404418 18:57148127-57148149 CAGACATCTATACTTGAACATGG + Exonic
1159329522 18:66972336-66972358 AAGACATGGCCAATGGAACAAGG + Intergenic
1165247796 19:34507570-34507592 CAGACAAAACTAATGGAACCTGG - Exonic
1167206112 19:48103576-48103598 CAGACATGACTAATCGATCTTGG - Intronic
1167702378 19:51057270-51057292 CAGACATCACTAATCGATCAAGG + Intronic
926659898 2:15453191-15453213 CAGAGAGCACAAAAGGAACAAGG + Intronic
928615710 2:33037642-33037664 CAGAAATCACAAAATGAACAAGG - Intronic
928633741 2:33220938-33220960 CTGTCACCACTAAAGGAACAGGG - Intronic
929268443 2:39944921-39944943 CAGACAGCACTAATCGATTAGGG + Intergenic
932213955 2:69954237-69954259 CAGACATCACTAATCAATCATGG + Intergenic
933077530 2:77948264-77948286 CTGGGATCTCTAATGGAACAAGG + Intergenic
933252161 2:80040931-80040953 TAGAAATTACTAATGGCACAAGG + Intronic
933816952 2:86075947-86075969 CAGACATCACTAATGCATCATGG + Intronic
936943514 2:117910047-117910069 CAGACATGCCTAAAGAAACATGG - Intergenic
942383163 2:175414412-175414434 CAGACATCAGTAATTGATCATGG - Intergenic
942725044 2:178997009-178997031 TAGACATGATTAATAGAACAGGG + Intronic
942742255 2:179194365-179194387 CAGACATTAGGAAGGGAACATGG - Intronic
946381719 2:219353318-219353340 CAGACATCACTAATGGATCGTGG + Intergenic
946445155 2:219733200-219733222 CAGACATCTCTAAAGGAAGAGGG - Intergenic
948090154 2:235286609-235286631 CAGACATCACTAATCAATCACGG + Intergenic
1168958220 20:1849420-1849442 CAGACATCACTAAACGATCAGGG + Intergenic
1169751381 20:8998129-8998151 CAGCCATCACTAACGGCAAAAGG + Intergenic
1171343229 20:24446496-24446518 CAGACAGCACTGATGGTGCAGGG - Intergenic
1172225330 20:33301778-33301800 CAGACATCACTAATCGATCAAGG + Intronic
1172836214 20:37874925-37874947 CACACAAAACTAATGGAAAAGGG - Intergenic
1173026496 20:39312173-39312195 CAGACATCACTATTCAATCATGG + Intergenic
1173853592 20:46234703-46234725 CAGACATTACTAATCCATCATGG + Intronic
1175185778 20:57178861-57178883 CAGACATTGCTAATAGATCATGG - Intronic
1175185781 20:57178902-57178924 CAGACATTGCTAATAGATCATGG - Intronic
1176312888 21:5163355-5163377 CCCACATGACTAATGGCACAGGG + Intergenic
1179590418 21:42404322-42404344 CAGCCAACACAAATTGAACAGGG - Intronic
1179844160 21:44098675-44098697 CCCACATGACTAATGGCACAGGG - Intronic
1181018311 22:20084219-20084241 CAGACATCACACATTTAACAAGG - Intronic
1181406842 22:22690850-22690872 CAGACATCTCTTCTGGAAAAGGG - Intergenic
1181414819 22:22751491-22751513 CAGACATCTCTCCTGGAAAAGGG - Intronic
1181431736 22:22885481-22885503 CAGACATCATTCAGGGCACAAGG - Intronic
1181890400 22:26057944-26057966 CAGACATTACTAATCAATCATGG + Intergenic
1181924080 22:26343957-26343979 CAGGCATCACTAATCAATCATGG - Intronic
1183156431 22:36079180-36079202 CAGACATTACCAATTGAGCATGG - Intergenic
1183213743 22:36466343-36466365 CAGACAGTTCTAATAGAACAGGG + Intergenic
1183410097 22:37649942-37649964 CAGACATCACTAATTAATCAAGG - Intronic
949474311 3:4428652-4428674 CAGACATTAAAAATGGAACAGGG - Intronic
949565365 3:5239855-5239877 CAGACATCATTAATCAATCACGG + Intergenic
950655979 3:14436626-14436648 CAGGCATCACTAATAGATCCTGG + Intronic
950986847 3:17381217-17381239 CATACATCACAAATGGTAGATGG + Intronic
951604580 3:24419004-24419026 CAGACATCACTAATAAATCATGG + Intronic
953118640 3:40017213-40017235 CAAACATTACTAATCAAACAAGG + Intronic
955037396 3:55282525-55282547 CAGACATCACTAATCAATCAGGG - Intergenic
956661146 3:71599177-71599199 CAAACATCAATAATCGATCATGG - Intergenic
956985622 3:74696460-74696482 CATACATCACAAATGGAATTGGG - Intergenic
958655148 3:96991824-96991846 CACACAACACACATGGAACAGGG + Intronic
961206608 3:125087468-125087490 CAGACATTGCTAGTGGATCATGG - Intronic
961609618 3:128126249-128126271 CAAACATCACTGATGGGCCAGGG + Intronic
961795008 3:129403018-129403040 CAGACATCACTAATCGTTCACGG + Intronic
962741525 3:138365809-138365831 CAGACAACACTGATGGATCATGG - Intronic
963086605 3:141442855-141442877 CAGCCATCACTAATGGGCCAAGG + Exonic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
967295401 3:187959309-187959331 CAGGCATCACTTCTTGAACATGG - Intergenic
970323564 4:14899644-14899666 CAGACATAACTAATCCATCATGG + Intergenic
971235213 4:24835438-24835460 CAGACATCACTAATTGATCATGG - Intronic
971761398 4:30770768-30770790 CAGTTATAACAAATGGAACACGG - Intronic
976329247 4:83810086-83810108 CTGACATCACTAATGTGAAAAGG + Intergenic
978002066 4:103568070-103568092 CAGTCATCTCAAATGTAACATGG - Intergenic
983111331 4:163753899-163753921 CAGACATCACTTAGGGGACCTGG + Intronic
983980845 4:173995152-173995174 CAGAGATCTCAAATGGAAGAAGG + Intergenic
985769979 5:1803404-1803426 TAGACATCACTAATCAATCATGG - Intronic
986896393 5:12375322-12375344 CAGAAATTAATAATGCAACAGGG + Intergenic
987114703 5:14717017-14717039 CAGACATGGCTAATGGACCAGGG - Intronic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
990462458 5:56042045-56042067 CAGACATAGCTAATTGACCATGG + Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
995794008 5:115923208-115923230 TAGACATGTTTAATGGAACATGG + Intergenic
1000693972 5:164357605-164357627 CAGAGATCACTCATGTAAGAAGG + Intergenic
1001013058 5:168115886-168115908 CAGACATCACTAATTGATCACGG - Intronic
1001239088 5:170054509-170054531 CAGGCATCACTAATCCACCATGG + Intronic
1001696943 5:173677468-173677490 CAGACATCACTAATGGATTATGG - Intergenic
1002931421 6:1637580-1637602 CACACATAAATAATGGCACAAGG + Intronic
1003132633 6:3408543-3408565 CAGACATGGCTAATGGATCAAGG + Intronic
1003158810 6:3618321-3618343 CAGACATCACCAGTGGGTCATGG - Intergenic
1003699556 6:8446800-8446822 CAGAGATCTCCAATGGAACGGGG - Intergenic
1003747461 6:9018793-9018815 CAGACATCAGTGATGAAGCAAGG + Intergenic
1003760737 6:9176073-9176095 CACACATCATTAGTGAAACATGG - Intergenic
1004311994 6:14554070-14554092 CAGGCATCACACTTGGAACAGGG - Intergenic
1007294822 6:40813878-40813900 CAGCCATCACTACTGGGACTAGG + Intergenic
1009551771 6:65105696-65105718 CAGACATCATTCACGGAATAGGG - Intronic
1009638179 6:66294649-66294671 CAGAGATCACCAATAGATCATGG - Intergenic
1010400013 6:75437656-75437678 AATGCATCTCTAATGGAACAAGG + Intronic
1012239321 6:96854234-96854256 CAGTGATGACTAATGGATCATGG - Intergenic
1012839982 6:104317920-104317942 CAGACATCCCTAATTAAACAAGG + Intergenic
1014975157 6:127871633-127871655 CAGACATCAAAAATGTAATAAGG + Intronic
1015006943 6:128294507-128294529 CAGACTTCACTAATTGTAAATGG - Intronic
1018614116 6:165669860-165669882 AAGACACCACTAATGTAACAAGG + Intronic
1019217307 6:170452203-170452225 CAACCAGCACTGATGGAACATGG + Intergenic
1021118788 7:16773571-16773593 AAGACATCCCTATTAGAACAGGG - Intronic
1023120954 7:36907788-36907810 CAGACATCACTAATCTATCACGG + Intronic
1024644177 7:51357329-51357351 CAGTCAACACTAAGGGAACTTGG - Intergenic
1026349859 7:69506360-69506382 TAGACATCACGAATTGATCAAGG + Intergenic
1028590738 7:92491367-92491389 CGGACATCTCTAAAGAAACAAGG + Exonic
1028947954 7:96602063-96602085 CAGACATTGTTAATGTAACATGG - Intronic
1030382809 7:108832009-108832031 CAGACAACAGTAATGGGATAAGG - Intergenic
1034351830 7:150421002-150421024 CTGTCATCTCTAATGGAAAATGG + Intergenic
1037067824 8:14604355-14604377 CAGACATCAATAATTGATCTTGG - Intronic
1038446245 8:27606210-27606232 CAGACATTACCAATGGAGCATGG + Intronic
1039731998 8:40290054-40290076 CAGACATCAGTAATCAACCACGG + Intergenic
1044249163 8:89986021-89986043 ATGACATCAGTAATGAAACAAGG + Intronic
1045719208 8:105087382-105087404 CAGACATCACTAGTCAATCATGG + Intronic
1046664872 8:116989948-116989970 CAGACACCACTAATCAATCAAGG - Intronic
1048510416 8:135056819-135056841 CAAACGTCACTAAAGAAACATGG + Intergenic
1048582561 8:135742109-135742131 CAGACATCACTAATCACTCAAGG + Intergenic
1048761250 8:137798115-137798137 CAGACATCACTAATTCATCACGG - Intergenic
1050155681 9:2664235-2664257 CAGACATTACTGAAGGATCAGGG - Intergenic
1051074843 9:13220950-13220972 GACCCATCACTAAAGGAACAAGG + Intronic
1055025421 9:71714516-71714538 CAGAAATAACTACTGGAAAAAGG - Intronic
1055226924 9:74008261-74008283 CAGCCATCACTGAAGGGACAGGG + Intergenic
1055258262 9:74399511-74399533 CAGACATTGCTAATCAAACACGG + Intergenic
1056102121 9:83309813-83309835 CAGATATCACTAATGTATCTAGG + Intronic
1056203874 9:84301760-84301782 CAGACATTACTGATTGATCATGG + Intronic
1056495253 9:87149225-87149247 CAGACATTACTTATGGATGAAGG - Intronic
1057534176 9:95882634-95882656 CAGACACCAATGATGGAATAAGG + Intronic
1057803589 9:98204887-98204909 CAGACATAACTAACTGATCATGG + Intronic
1057962929 9:99474197-99474219 CAGATATTAATAATGGAACTTGG - Intergenic
1059376348 9:113884572-113884594 CAGACATCACTAATTGACCATGG + Intronic
1059948265 9:119435330-119435352 CAGACATTACTAATAGATCATGG - Intergenic
1187938346 X:24357655-24357677 CACAAATAATTAATGGAACAAGG + Intergenic
1188728534 X:33615709-33615731 CAGAAATCACTAATGGAAAGAGG + Intergenic
1192278278 X:69655867-69655889 GAGACATGAATAATGGGACAGGG - Intronic
1193908684 X:87275940-87275962 TAGACATCTCAAATTGAACACGG + Intergenic
1194049024 X:89045255-89045277 AATACATCAGTAATGAAACAGGG - Intergenic
1195862096 X:109393686-109393708 CAGACATCTCTAAGGCATCAGGG - Intronic
1196912489 X:120498173-120498195 CAGACCGCAGTAATGGAAAATGG + Intergenic
1199078827 X:143553935-143553957 CAGTCATCACTAGTGGTACATGG - Intergenic
1201798270 Y:17925279-17925301 CAGGCATTACTTAAGGAACAAGG - Intergenic
1201803283 Y:17980678-17980700 CAGGCATTACTTAAGGAACAAGG + Intergenic