ID: 1151713226

View in Genome Browser
Species Human (GRCh38)
Location 17:75818406-75818428
Sequence GCTTCTCTCTTCCCTGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 317}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151713220_1151713226 12 Left 1151713220 17:75818371-75818393 CCTGGAGCCTCTGCACTCTGCCA 0: 1
1: 0
2: 11
3: 48
4: 423
Right 1151713226 17:75818406-75818428 GCTTCTCTCTTCCCTGCTACAGG 0: 1
1: 0
2: 5
3: 31
4: 317
1151713223_1151713226 -8 Left 1151713223 17:75818391-75818413 CCAGGCCCTGTACTCGCTTCTCT 0: 1
1: 0
2: 1
3: 19
4: 223
Right 1151713226 17:75818406-75818428 GCTTCTCTCTTCCCTGCTACAGG 0: 1
1: 0
2: 5
3: 31
4: 317
1151713222_1151713226 5 Left 1151713222 17:75818378-75818400 CCTCTGCACTCTGCCAGGCCCTG 0: 1
1: 0
2: 20
3: 133
4: 1053
Right 1151713226 17:75818406-75818428 GCTTCTCTCTTCCCTGCTACAGG 0: 1
1: 0
2: 5
3: 31
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151713226 Original CRISPR GCTTCTCTCTTCCCTGCTAC AGG Intronic
900702447 1:4056638-4056660 GTCTCTCTCTTCCCTGCGTCCGG + Intergenic
902919290 1:19656844-19656866 GCTTCTCTCTTGCCCTCTGCAGG + Exonic
903803774 1:25989601-25989623 GCTGCTCTCTTCTTTCCTACAGG - Exonic
904463944 1:30697032-30697054 GCTTCTCTCCTCCATCCTCCCGG + Intergenic
905876060 1:41432793-41432815 GCTTTTTTCTGCCCTGCTCCAGG + Intergenic
906274010 1:44502890-44502912 GCTTCTATAGTCCCAGCTACTGG - Intronic
907012545 1:50977621-50977643 GCTTGTCTCTGCCCCCCTACGGG + Intergenic
907092140 1:51735032-51735054 CCTTCTCTCTTCCGTGCTCTAGG + Intronic
907300239 1:53482458-53482480 GCTGCTGCCTTCTCTGCTACAGG + Intergenic
907789993 1:57653737-57653759 GCTCCTGTATTCCCAGCTACTGG - Intronic
913501266 1:119474758-119474780 GCTTCTCTCTGCCCTGCTCAGGG - Intergenic
913509156 1:119546788-119546810 CCTTCTCTCTCCCCTGCTCAGGG - Intergenic
913992082 1:143623272-143623294 GATTCTCTCTTCTCTTCCACTGG + Intergenic
914942972 1:152038725-152038747 GTTTCTGTCTTCTCTGCTAAGGG + Intronic
916236603 1:162595181-162595203 GCTTCTGTTTTCCCTCCTTCAGG + Intronic
916480526 1:165210511-165210533 CCTTCTCTCTCCCCTTCTGCAGG + Intronic
917004559 1:170398781-170398803 GCTTCTCTCTTCTCTGTTCCAGG - Intergenic
917985790 1:180317333-180317355 GCTTCCCTCCTCCCTGCCCCTGG - Intronic
918094299 1:181321977-181321999 CCTTTTCTCTTCCCTTCTACTGG + Intergenic
918605116 1:186415557-186415579 GCTTCTTTCTTCCATCCTAGAGG - Intronic
919865576 1:201780414-201780436 GCTGCTTTCATCCCAGCTACAGG - Exonic
920156368 1:203955320-203955342 GTTTTTCTCATCCCTGCTCCTGG + Intergenic
920897535 1:210070825-210070847 GCTTCTCTCATGACTGCTACTGG - Intronic
921090127 1:211834358-211834380 GCTTCTCTTTTCCCTTCTTAAGG + Intergenic
922744498 1:228036676-228036698 GCTTCTCTGTCCCCTGCCGCAGG + Intronic
923632105 1:235657442-235657464 TGTTCTCTGTTCCCTGCTGCAGG - Intergenic
1064075996 10:12269267-12269289 ACTTCTCTCTTCCCTGCAGTAGG + Intergenic
1065114502 10:22471688-22471710 TCTTCTCTCTTCCCGGCTACAGG + Intergenic
1066045350 10:31589702-31589724 GTTTCCCTCTTCCCACCTACAGG - Intergenic
1068689269 10:59899551-59899573 GCTTCCCCCATCACTGCTACAGG + Intronic
1069595280 10:69666158-69666180 GCTTCTCTCCTGCCTCCTTCAGG - Intergenic
1070236444 10:74632481-74632503 CCTTGTCTCTTCCTAGCTACTGG + Intronic
1070408755 10:76120028-76120050 GCTTCTATCTTCCCAGATGCTGG + Intronic
1070521859 10:77260580-77260602 GCACCTCTATTCCCAGCTACTGG + Intronic
1071735237 10:88291562-88291584 CCTTCTCTCTTCCGTGCCTCAGG + Intronic
1072526304 10:96274743-96274765 GCAACTCTATTCCCAGCTACAGG - Intergenic
1073940034 10:108686478-108686500 GCTTCTAACCACCCTGCTACAGG - Intergenic
1074744145 10:116514777-116514799 GCTGCTCTCTCTCCTGATACAGG - Intergenic
1075602044 10:123777026-123777048 CCTTCCCTCTTCCCTTCTTCTGG - Intronic
1076242891 10:128923233-128923255 GCGTCTCTCTTTCCAGCTGCAGG - Intergenic
1076540948 10:131214335-131214357 GCTCATCTCTTCCCTTCCACAGG + Intronic
1076543679 10:131230004-131230026 GCTGCTCCCTTCCTTGCTTCAGG - Intronic
1076604638 10:131681463-131681485 GGTTCCCTCTTCCCTCCTCCAGG + Intergenic
1076690380 10:132220834-132220856 GCAGCTCTGTTCCCTGCTTCGGG - Intronic
1076739691 10:132477176-132477198 CCTTCCCTCATCCCTGCTCCAGG + Intergenic
1077935204 11:6777016-6777038 GCTTGTCTTTTTCCTGATACTGG + Intergenic
1078445611 11:11402923-11402945 GCTTCTTTCTTCTCTGCCCCAGG + Intronic
1081532197 11:43969708-43969730 GCTTCCCACTTCCCTGGTGCTGG + Intergenic
1081566864 11:44265645-44265667 CCCTCCATCTTCCCTGCTACTGG - Intronic
1081804721 11:45884298-45884320 GCTTCTCTTTTCCCTGTCCCTGG - Intergenic
1082911088 11:58375409-58375431 GCTTATCTCTCCCCTGCAATGGG - Intergenic
1085269498 11:75261961-75261983 GCTTCTCTCCTGCCTGTCACTGG - Intergenic
1085273971 11:75286392-75286414 GCACCTGTATTCCCTGCTACTGG - Intronic
1085832547 11:79916850-79916872 GCTTCACTTTACCCTGCTTCAGG + Intergenic
1086894204 11:92293274-92293296 GCTACTCTCTTACCTTCTGCTGG + Intergenic
1088174833 11:107040701-107040723 GTTTTTCTCATCCCTGCTCCAGG - Intergenic
1088735948 11:112727790-112727812 GCTTCTCTGTTGTCTGCTAGAGG + Intergenic
1089387032 11:118075148-118075170 GCTTCTCACTGCCCTGCTGCTGG + Intergenic
1089422543 11:118342571-118342593 GTTTCTCTCTGGCCTGGTACTGG - Exonic
1089583530 11:119496061-119496083 GAGTCTCTGTTCCCTGCCACGGG + Intergenic
1089637265 11:119823070-119823092 GCTTCCCTCTTCCCTTCCACTGG - Intergenic
1090251832 11:125256819-125256841 GCCTCTCTCTCCCCTGCTCCTGG - Intronic
1090692256 11:129196101-129196123 GCTTCTCTCTTTGCTGCTGTGGG - Intronic
1091607484 12:1967274-1967296 GTCTCTCTCTTCCTTGTTACTGG - Intronic
1091995058 12:4986931-4986953 GCTTCTCACAGCCCTGCTTCAGG - Intergenic
1092456201 12:8645055-8645077 GCTCCTCCCTTCTCTGCTTCAGG - Intronic
1094087374 12:26608529-26608551 GCTCCTCTCTTCCCAGCGAGTGG - Intronic
1094539913 12:31354686-31354708 GCTCCTCTAGTCCCAGCTACTGG + Intergenic
1095951907 12:47786236-47786258 GCTTCTCTCTCCCCTTCCTCTGG + Intronic
1096078843 12:48820548-48820570 GCTCCTCTCTTGCCTGGCACGGG - Intronic
1096884800 12:54706483-54706505 GCTTCTCCTTGCCCTGCTTCAGG + Intergenic
1097851714 12:64417419-64417441 GCTTCTGTATTCCCAGCTACTGG + Intronic
1098784602 12:74735571-74735593 GCTTTTCTCTTACCTCCTATAGG + Intergenic
1099716772 12:86304866-86304888 TCTTCCTTCTTCCCAGCTACTGG - Intronic
1101633739 12:106520232-106520254 GCTCCTCTCTTCCCTAATCCAGG - Intronic
1102162615 12:110781842-110781864 GCTTCCTTCCTCCCCGCTACTGG - Intergenic
1102347162 12:112167620-112167642 ACTTCTCTCCTGCCTGCCACAGG - Intronic
1103903379 12:124314991-124315013 GTACCTCTCTTCCCTGCTGCTGG + Exonic
1104296710 12:127522016-127522038 TCTTCTCTCTTCCATGATAAGGG + Intergenic
1105864493 13:24447299-24447321 TTTTCTCTCCTTCCTGCTACAGG + Intronic
1107431972 13:40348412-40348434 GGTCCTCTTTTCCCTGCTAATGG - Intergenic
1108164515 13:47678048-47678070 GCTCCTTTCTTGCCTGCTAAGGG - Intergenic
1108713874 13:53059914-53059936 GTTTCTCTCTTCCTTGCTTTTGG + Intergenic
1108773409 13:53733447-53733469 GCTCCTATCTTCCCTGTAACTGG + Intergenic
1108963525 13:56267266-56267288 CCTTCTTTCTTCCCAGCTCCCGG - Intergenic
1109167002 13:59047856-59047878 GCTTCTCTTTTACCTGCAACTGG + Intergenic
1109973069 13:69795796-69795818 GTTTATCTGTTCCCTGCTATGGG - Intronic
1110898754 13:80792861-80792883 GCTTACCTCTTCCCAGCTTCTGG + Intergenic
1111873062 13:93858641-93858663 CCTTCCCTCCTCCGTGCTACAGG - Intronic
1112045535 13:95592728-95592750 GTTTATCTCTTCCCTGCTGATGG - Intronic
1112328258 13:98458437-98458459 GCTTCTCTCTTCGCTACTGAAGG + Intronic
1112389076 13:98966258-98966280 TCTTCTCCCTACCCTGATACCGG + Intronic
1112661681 13:101517067-101517089 GCTTTTCTCTTCACTGATTCTGG + Intronic
1112729444 13:102343792-102343814 GCTTTTCTTTTTCCTGCTAAGGG - Intronic
1113065547 13:106370690-106370712 GCTTCTGTCTTCCCTGCTTCTGG + Intergenic
1114350631 14:21846713-21846735 GCTTCTGTCCTCCCTGCTCAGGG + Intergenic
1115361495 14:32508451-32508473 TCTTCTGTCTTTCCTGCAACCGG - Intronic
1115905509 14:38198944-38198966 GCTTCCCTCTTCCCTACTACAGG - Intergenic
1116189162 14:41640829-41640851 GCTTCTGTCTTGCATGCTTCTGG + Intronic
1118870674 14:69738586-69738608 GCTTCTGTAGTCCCAGCTACTGG - Intronic
1118876682 14:69791704-69791726 GGATCTCTCTTCTCTTCTACGGG - Intronic
1119036228 14:71232097-71232119 GCTCCTCTCTTCTCTGCAGCTGG - Intergenic
1119421332 14:74509512-74509534 GCTTCCCTCTTCTCTGGGACTGG + Intronic
1120327139 14:83044820-83044842 TCTTCTCTCTTACCTCCTTCGGG - Intergenic
1120463548 14:84827071-84827093 GTTTCCCTCTCCCCTGCTGCAGG + Intergenic
1121144581 14:91573413-91573435 GCTTATCTCTCCCCTGCAATAGG - Intergenic
1121432302 14:93896231-93896253 GCTTTTCTTTTCCCTTCCACAGG + Intergenic
1122578149 14:102754940-102754962 GATTCACTCTTCCCTCCTCCAGG + Intergenic
1123410772 15:20056989-20057011 GCTCCTCCCTTCCCTGCCTCTGG - Intergenic
1123520101 15:21063695-21063717 GCTCCTCCCTTCCCTGCCTCTGG - Intergenic
1126453732 15:48839135-48839157 CCTTCTCTCTTTCCTGTTATTGG - Intronic
1126940716 15:53762312-53762334 GATTCTCACTTCCCTCCTGCAGG + Intronic
1127962539 15:63900433-63900455 GCTTGTCTCTGCCCTGCTGGTGG + Intergenic
1128388589 15:67167514-67167536 GCCACTCTCTACCCTGCTGCTGG - Intronic
1128927955 15:71675874-71675896 TCTTCTCACTTCCCAGCCACTGG + Intronic
1129014031 15:72450113-72450135 GCATCTGTAATCCCTGCTACGGG - Intergenic
1129041401 15:72689604-72689626 GCGCCTGTCTTCCCAGCTACTGG + Intronic
1130808558 15:87352885-87352907 GCTTCCTTCTTCCCTACTCCAGG + Intergenic
1131334467 15:91534525-91534547 GCTTCTCTCTTTCTTTCTACTGG - Intergenic
1131355852 15:91745593-91745615 TCTTCTCTCATCCCTTCTCCAGG + Intergenic
1133635531 16:7661507-7661529 GCCTCTCTCGTCTCTGCTGCTGG + Intronic
1135737639 16:24945194-24945216 GCATCTGTATTCCCAGCTACCGG + Intronic
1135905182 16:26505629-26505651 GCCTCTCTCTTCCCTGTCCCTGG + Intergenic
1136500439 16:30667416-30667438 GCCTCCCTCTTCACTGCGACTGG + Exonic
1137444182 16:48521962-48521984 GCTCCTCACTTCCCTTCTGCAGG - Intergenic
1138107163 16:54294081-54294103 TCTTCTCTCTGCCATGCTTCTGG + Intergenic
1139675533 16:68520663-68520685 GCTTCTCTCTACCCTGAGCCTGG - Intergenic
1140092789 16:71851428-71851450 TCTTCTCTCTGCCCTGCCATCGG + Exonic
1141050219 16:80754856-80754878 CCTGCTCCCTTCCCTGATACAGG - Intronic
1141084126 16:81079264-81079286 TCCTCTTTCTTCCCTGCAACAGG - Intergenic
1141455075 16:84135957-84135979 GCTGCTCTCTTCCCCGATGCCGG - Intronic
1142058575 16:88015584-88015606 GCTTCCCGCTTCCCTGCTTGGGG + Intronic
1142600150 17:1049893-1049915 GGTTCTCCCCTCCCTGCTAGAGG - Intronic
1142805632 17:2369779-2369801 TCTTCTCTCCTGCCTGCTGCAGG + Intronic
1143164105 17:4889437-4889459 GCCTCTCTCGTCACAGCTACCGG + Intronic
1143288372 17:5809473-5809495 GTTTTTCTCATCCCTGCTCCAGG - Intronic
1143844562 17:9764322-9764344 GCTTCTCTCTCACCTTCTACAGG - Intergenic
1144152031 17:12457462-12457484 GCTTCTGTCTAGCCTGCTTCAGG - Intergenic
1145275401 17:21426368-21426390 GCTCCACACTTCCCTGCTGCTGG + Intergenic
1145313253 17:21712262-21712284 GCTCCACACTTCCCTGCTGCTGG + Intergenic
1146373109 17:32277425-32277447 GCTTCTCCCCTCCCAGCTGCAGG - Intronic
1146596685 17:34175571-34175593 GTTGCTTTCTTCTCTGCTACAGG - Intergenic
1148013698 17:44505887-44505909 GTTTCTATCTTTCCTGTTACAGG - Intergenic
1149651555 17:58279336-58279358 GCTTCTCTCTTCCCTACGGCTGG - Exonic
1149883435 17:60316264-60316286 AATTCTCTCTTCCCTGTTACTGG + Intronic
1149896153 17:60429949-60429971 GCATCTCTAATCCCAGCTACTGG - Intronic
1150442564 17:65203151-65203173 GCTTTTCTCTTCAATGCTGCTGG - Intronic
1151713226 17:75818406-75818428 GCTTCTCTCTTCCCTGCTACAGG + Intronic
1153154677 18:2134954-2134976 GGTTCTGTCATCCCTGCTCCTGG + Intergenic
1155658170 18:28215424-28215446 GCCTCTCCCTTCTCTGCTGCGGG - Intergenic
1159877308 18:73827067-73827089 GCTCCTCTGTTCCCTTCTGCTGG - Intergenic
1160098898 18:75902300-75902322 GTTTCTTTCTTCCTTGTTACCGG - Intergenic
1160206110 18:76834187-76834209 CCTTCTCTCTTCCCTGATGGTGG + Intronic
1162492350 19:11000750-11000772 GCTTCTGTAGTCCCAGCTACTGG + Intronic
1164506734 19:28867227-28867249 GCCTCTCTCTTTCCTGCCCCAGG + Intergenic
1164544336 19:29146904-29146926 GATTCTCTCTATCCTGCCACAGG + Intergenic
1164645584 19:29856694-29856716 GCTAGCCTCTTCCCTGCTCCAGG + Intergenic
1164906258 19:31970709-31970731 GCTCCTGTCATCCCAGCTACTGG + Intergenic
1165105120 19:33464630-33464652 GCCTCCCTCTTCTCTGCTCCTGG - Intronic
1166737507 19:45094787-45094809 TCATCTCTCTCACCTGCTACTGG - Intronic
1167135219 19:47611531-47611553 GCTTCTCTCTTCTCTACTTCAGG - Intronic
1167497647 19:49828950-49828972 TCTTCTCTCTTTCCTGGTAGTGG + Exonic
925010497 2:481650-481672 GCTCCTCCCTCCCCTGCTCCAGG - Intergenic
927962252 2:27248332-27248354 CCTTCTCTTTGGCCTGCTACAGG - Intergenic
928217041 2:29370465-29370487 GATTATCTCCTCCTTGCTACAGG - Intronic
928322332 2:30293747-30293769 CCTCCACTCTTCCCTGCTCCAGG + Intronic
928500317 2:31885705-31885727 CATTCTCTTTTCCCTGCTTCTGG + Intronic
930389186 2:50738776-50738798 GCTTTTGTCTTCCCAGGTACAGG - Intronic
931246459 2:60496499-60496521 TCTTCCCTCTTTCCTGCTTCAGG - Intronic
932306065 2:70705063-70705085 GCTTCCTTCTTCCCTTTTACAGG - Intronic
932336597 2:70935256-70935278 GCCTCTCTTGTCCCTGCCACTGG - Intergenic
932626213 2:73297893-73297915 TCTTTTCTCTTCCCTGCTCATGG + Intergenic
932819191 2:74885156-74885178 GCTTCTCTCTTCCAAGCTGTAGG + Intronic
935744243 2:106176872-106176894 GCTGCTCTTTTGCCTGCTTCTGG - Intronic
936621607 2:114104836-114104858 CTTTCTCTCTTCTCTGCTTCTGG + Intergenic
936947328 2:117942351-117942373 GCCTCTCTCTTCCCTTTTACAGG + Intronic
937440205 2:121908728-121908750 GCAGCTCTCTTCCCTCCTCCCGG + Intergenic
937993823 2:127678857-127678879 GGACCTCTCTTCCCTGCTCCAGG - Intronic
937994000 2:127679615-127679637 CCTTCTCCCTTCCCTACTCCAGG + Intronic
938096004 2:128464598-128464620 GCTTCTCTGGTCCCTGCCACTGG + Intergenic
938531770 2:132194610-132194632 CCTTCTCTCTTTCCCTCTACAGG + Intronic
941855051 2:170222482-170222504 CTTTGTCTCTTCCCAGCTACTGG + Intronic
942013610 2:171789353-171789375 GCTTCTGTAGTCCCAGCTACTGG - Intronic
943718740 2:191180596-191180618 GGATCTGTCTTCCCTGCCACAGG - Intergenic
945622232 2:212154614-212154636 GCCTGTCTCTTCCCTGCAAGTGG + Intronic
945823939 2:214697732-214697754 GGTTCTCTCTTTCTTGTTACTGG - Intergenic
945978961 2:216293250-216293272 GCTTCTCGCTTCCCTCCTGATGG + Intronic
946122281 2:217526542-217526564 CCTGCTCTCCTCCCTGCTCCAGG - Intronic
946307035 2:218861891-218861913 AGGTCTCTCTTCCCTGCTCCTGG + Intronic
1169262419 20:4148701-4148723 GCTTCTAGCTTCCCGGCTCCCGG + Intronic
1169350542 20:4864723-4864745 GATTTTCTCTTCCCTGCTGCTGG - Intronic
1170957124 20:20991588-20991610 GCTTCTCTCTTCCTTTCTCTGGG + Intergenic
1171203118 20:23257403-23257425 GCTTCTCTCTGGCCTGGCACTGG - Intergenic
1172211577 20:33202490-33202512 CCTTACCTCTTCCCTCCTACAGG + Intergenic
1173162387 20:40662586-40662608 GCTGCTCTCTGCCCTCCTCCTGG + Intergenic
1175081963 20:56428275-56428297 CCTTCTCTCTTTCCTGTCACAGG - Intronic
1175392182 20:58634489-58634511 GCTTTTCTCCTGCCTGCTAAGGG - Intergenic
1177852952 21:26370447-26370469 GCTTCTCTATTTCCTAATACAGG - Intergenic
1178495827 21:33085612-33085634 GCTTGTCTCTTCCCAGTTCCAGG - Intergenic
1179145182 21:38761857-38761879 GCTTCTCTGTTCTCTCCTCCTGG + Intergenic
1179574901 21:42301811-42301833 TCTTATTTCTTCCCTGCTTCTGG - Intergenic
1179842471 21:44086249-44086271 CCTTCTGTCTTCCCTGCAGCAGG + Intronic
1181306927 22:21922441-21922463 GCTGCTCTCTTCCCTGAGCCCGG - Exonic
1181405908 22:22685163-22685185 GCCTCTCTCCTCACTGCTGCTGG - Intergenic
1181408606 22:22702737-22702759 GCCTCTCTCCTCACTGCTCCTGG - Intergenic
1182287889 22:29258919-29258941 GCCTCTCTCGTCCCGGCTCCTGG - Exonic
1182601483 22:31468249-31468271 GCCTCTCTCTACCCAGCTTCAGG - Exonic
1182973902 22:34604402-34604424 GTTGCTCCCTTCCCTGCCACTGG + Intergenic
1184003647 22:41693441-41693463 GCTTCTCTGTTCTCATCTACAGG + Exonic
1184842403 22:47059932-47059954 GCTTCTCTGTTCCAGGGTACAGG + Intronic
1184876166 22:47277127-47277149 GCTCCCCTGTTCCCTGCTGCCGG + Intergenic
1184952319 22:47852497-47852519 GCTTCTGTCTTCACTCCTAAAGG - Intergenic
1185352998 22:50347770-50347792 GCCTCTCTCTGCCCTGCTCTTGG + Intronic
1185411045 22:50683318-50683340 GATTCCCTCTTCCCCGCAACAGG + Intergenic
949926696 3:9047595-9047617 GCCTCTCTGTTCCCTGCGCCGGG - Intronic
951634200 3:24755366-24755388 ACTTCTGTCTTCTCTGCTTCAGG - Intergenic
953270714 3:41440995-41441017 TCTTCTCTCATTCCTGATACAGG + Intronic
953539859 3:43808130-43808152 GGTTCTCTATTCCGTTCTACTGG - Intergenic
953824104 3:46235007-46235029 GCTTCTCTCCACCCCTCTACTGG + Intronic
954919907 3:54181045-54181067 GCTTCCCTCTTCTCTGTGACTGG + Intronic
955245776 3:57223612-57223634 GCTTCCCCCTACTCTGCTACTGG + Intronic
955371114 3:58352873-58352895 GCTTCTCTTCTCCCTTCTCCGGG - Intronic
956457081 3:69432761-69432783 GCTTCTCTCTTCTGTATTACAGG - Intronic
956672102 3:71700743-71700765 CCTTATCTCTCCCCTGCTAAAGG + Intronic
958898271 3:99854855-99854877 GATTTTATCTTCCCTGCTAGTGG + Intronic
960046137 3:113200340-113200362 GCCTCTCTCCTCCCTGGGACAGG + Intergenic
961083929 3:124050310-124050332 GCTTCTTTGTTCCCTGCTGATGG - Intergenic
961716345 3:128860080-128860102 GCTTTTCTCGTCCCTGCTCTTGG + Intergenic
962258519 3:133887989-133888011 GCTTCCCTCCTCCCTGCTCAGGG + Intronic
962307155 3:134299120-134299142 CCTTCTCTCTTCTCTCCTCCAGG - Intergenic
963199393 3:142570771-142570793 GCTTCTCTCTTTACTGCTACAGG - Intronic
968500182 4:946279-946301 GCTGCCCTCTTCCCTGCTCCGGG + Intronic
969692447 4:8711071-8711093 GCTCCACTCTGCCCTGCTCCTGG - Intergenic
969921215 4:10541396-10541418 CTCTCTCTCTTCCCTGCTAGAGG - Intronic
970229498 4:13894108-13894130 GCCTCTCTCTTCCCTCATAGAGG + Intergenic
971395522 4:26223554-26223576 TCTTCACTCTTCTCTGCTTCTGG - Intronic
972487092 4:39552413-39552435 CCCTCTCTCTTCCATTCTACAGG - Intronic
974384748 4:61189938-61189960 CCTTGTCTCTTCCCAGCTTCTGG - Intergenic
977262977 4:94820167-94820189 CTTTCTCTCTTCCCTTCCACAGG - Intronic
978248731 4:106605174-106605196 CCATCTCTCTTCCATGCTAATGG - Intergenic
980124166 4:128757656-128757678 TCTTCTTTCTTGCCTTCTACAGG - Intergenic
983255678 4:165397498-165397520 GCTCCTCTCTTCCCTTCTTGGGG + Intronic
983519854 4:168696858-168696880 GCTTCTTTCTTCTCTCCTTCTGG - Intronic
983928838 4:173431659-173431681 GTTTCTCTCATCCCTGCCCCAGG + Intergenic
984188832 4:176580130-176580152 GCTTCTCCATTTCCTGCTAATGG - Intergenic
984619362 4:181935518-181935540 GTCTCTCTCTGCCCAGCTACCGG + Intergenic
986230884 5:5864047-5864069 TATTCTCTTCTCCCTGCTACAGG - Intergenic
988087696 5:26492898-26492920 GTTTTTCTCATCCCTGCTCCTGG - Intergenic
988173846 5:27694779-27694801 GGTTCTCTATTCTCTTCTACTGG - Intergenic
988417492 5:30963987-30964009 GTTTCTCTCTTCTCTGAGACTGG - Intergenic
988789962 5:34598671-34598693 GGTTCTGTCTTCCCTGCTGCTGG - Intergenic
989361150 5:40602749-40602771 CTTTCTCTCTCTCCTGCTACAGG - Intergenic
991482790 5:67101203-67101225 GCCTCTCCCTTCCCTCCCACAGG - Intronic
991647772 5:68818531-68818553 GCTTCTCTCTCCTCTGGCACTGG - Intergenic
992748062 5:79838217-79838239 ATTTCTCTCTTCCCTGAGACTGG + Intergenic
994645328 5:102461708-102461730 GCTTCTCTTTTTCCTTCAACAGG - Intronic
995614217 5:113942847-113942869 TCTTTTCTCTTTCCTGCTGCTGG + Intergenic
995912650 5:117205829-117205851 TTTTCTCTCTTTCCTGCAACGGG - Intergenic
997206970 5:132055893-132055915 GCCTTTCTATTCCCTGCTGCAGG - Intergenic
997680202 5:135744913-135744935 GCATCTGTAGTCCCTGCTACTGG + Intergenic
1000040187 5:157479563-157479585 GCTCCTGTCTTCCCTGCAGCAGG - Exonic
1001545933 5:172570649-172570671 TCTTCTCTCTTCCCTGTTAAAGG + Intergenic
1003669961 6:8148069-8148091 GCTTCTCCCATCCCTCCTACAGG - Intergenic
1004145368 6:13061036-13061058 GCCTCTCTCCTCCCTGCCAGTGG + Intronic
1005778167 6:29160248-29160270 ACTTCTCTCTTCCCACATACAGG - Intergenic
1006106814 6:31721786-31721808 GCTCCTCCCTTCCCTGCCTCTGG + Exonic
1006336040 6:33420885-33420907 TCTTCTCTCTTCCCTCCATCTGG - Intronic
1006640322 6:35486218-35486240 CCTCCTCTCCTCCCCGCTACCGG - Intronic
1006795862 6:36731956-36731978 GCCTCTCTCTCACCTCCTACGGG - Intronic
1007071767 6:39043240-39043262 CCCTCTATCTTCCCTGCTGCGGG - Intergenic
1007333462 6:41133412-41133434 GCTTAGCTCTTCCCTTCTTCAGG + Intergenic
1007608265 6:43131884-43131906 CCTTCTCTCTGCCCTGTTCCTGG + Intronic
1007610458 6:43145593-43145615 GCTTCTGCCTTCCCTGCTCTTGG + Intronic
1008442909 6:51553618-51553640 GCTTGTCTCTCCTCTGCTACAGG + Intergenic
1009497117 6:64364530-64364552 CCCTTTCTCTTCCCTGCTAATGG + Intronic
1010658748 6:78544111-78544133 CCTTTTCTCTTCCTTGCTGCTGG - Intergenic
1011131142 6:84052833-84052855 GCTCCTCTCTTCCCACCTTCAGG + Intronic
1011700672 6:89951492-89951514 GCTTCTTCCTTCTCTGCTACGGG + Exonic
1012202773 6:96426309-96426331 GATTCTCTATTCCATTCTACTGG + Intergenic
1012260795 6:97085266-97085288 GCTTCCCTATTGCCTGCTTCAGG + Exonic
1012518696 6:100093666-100093688 GCTTCTCTCTGCCCAGCTCCAGG + Intergenic
1012667932 6:102000735-102000757 ACTTCTCGCATTCCTGCTACTGG + Intronic
1013030360 6:106326448-106326470 GCTTCTGTAGTCCCAGCTACTGG + Intergenic
1013845115 6:114441046-114441068 ACTTATCTCTTCTCTGCAACAGG + Intergenic
1014095689 6:117458052-117458074 CCTGCTCTCTTTCCAGCTACAGG + Intronic
1014359016 6:120451982-120452004 GTTTCTCTCTTCCCTGGAAGTGG - Intergenic
1014760043 6:125346267-125346289 GCTTGTCTATTTTCTGCTACAGG - Intergenic
1017151519 6:151284676-151284698 ATTTCTCTCTTCCCTGCCATTGG + Intronic
1017890756 6:158636897-158636919 GCTGCTCTCTTCCCTCCCGCAGG - Exonic
1018041172 6:159923299-159923321 CCTTGTCTCTTCCCAGCTCCTGG - Intergenic
1018356351 6:163021525-163021547 GCTTGTCTCTTCCCAGCTCATGG + Intronic
1020100312 7:5390628-5390650 GCTTTTCTCTTTTCTGTTACAGG - Exonic
1020758068 7:12230089-12230111 GCACCTCTCTTCCCACCTACTGG + Intronic
1021106598 7:16645710-16645732 GCTTCTCTCCTCCCTCCCGCGGG + Exonic
1021172078 7:17411080-17411102 GGCTCTCTCTTCACTTCTACTGG - Intergenic
1022178580 7:27896074-27896096 GCTGCTCTCTTCCCTTCTTCTGG - Intronic
1022320423 7:29283024-29283046 GCTTCTCTTTTCTCTCCTACTGG - Intronic
1022334751 7:29411768-29411790 GCTTCTCTCTCCCCATCTCCAGG - Intronic
1024096237 7:45985044-45985066 TCTCCTCTCCTCCCTGCTCCCGG + Intergenic
1025036343 7:55594574-55594596 GCTTCTCCGTGCCCTGCTACAGG - Intergenic
1025225224 7:57153227-57153249 TCTTCTCTCTTTTCTGCTTCTGG + Intergenic
1025823190 7:64990756-64990778 GTTTTTCTCATCCCTGCTCCTGG + Exonic
1027193320 7:76010721-76010743 GCTGCTCTCTTCCCCTCTTCTGG - Intronic
1027467129 7:78529640-78529662 GCTTTTCTTTTCCTTGCTAAAGG + Intronic
1028941255 7:96524485-96524507 GCTACTCTATTCCATGCCACAGG + Intronic
1030470175 7:109953611-109953633 TCTTCTCTCTTGGCTGTTACTGG - Intergenic
1032339040 7:131054014-131054036 GCTTCTCTCTCACCTGCCCCAGG + Intergenic
1033156903 7:138964728-138964750 GCTTCTCTCCTCCATAATACAGG - Intronic
1033186695 7:139232332-139232354 GGTTTTCTCTTCCTTTCTACTGG - Intronic
1033284996 7:140033683-140033705 GTTTCTCTCCTCCCTTCTAGGGG + Intronic
1033414445 7:141149756-141149778 CCTTGTCTCTTCCCAGCTTCTGG - Intronic
1034411298 7:150943589-150943611 CCTTCTCTCCTCCCTGCTCTGGG + Intergenic
1034782012 7:153889023-153889045 GCTTCTCTCTGCCAGGCAACAGG - Intronic
1034962210 7:155369970-155369992 GTTTGTCTCTTCCCTGCTGTAGG - Intergenic
1036157519 8:6356564-6356586 GCTTCTCTCTCCCCTTTTTCTGG - Intergenic
1038400355 8:27279816-27279838 GCTTCTGTCTTCCCTGGTACTGG + Intergenic
1039339460 8:36630975-36630997 GCATCTCTAGTCCCAGCTACTGG - Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1040046295 8:42967314-42967336 GCCTCTTTCTTCGCTGCTATAGG - Intronic
1041163663 8:55070535-55070557 TCTCCTCTCTTCCCTCCAACAGG - Intergenic
1043170448 8:76959308-76959330 ACCTCTCTCTTCACTGCTGCAGG + Intergenic
1043318321 8:78948789-78948811 GGTTATCTCTTCCCTGTCACAGG - Intergenic
1045493215 8:102686196-102686218 GCTTCTCTTTTCCTTTCTACAGG + Intergenic
1045863021 8:106834404-106834426 TCTTCTCCCTGCACTGCTACTGG - Intergenic
1046949787 8:120008890-120008912 GTTTCTCTCTTCCCTGCCAGGGG - Intronic
1047434863 8:124827684-124827706 GTTTCTGTTTTCCCTGCTCCTGG - Intergenic
1048953322 8:139513970-139513992 GTGTCTCCCTTCACTGCTACAGG - Intergenic
1048953408 8:139514527-139514549 GCCTCTCTCCTTCCTGGTACTGG + Intergenic
1049436945 8:142590803-142590825 TCTTCTCTCTTCCTTGCTTCAGG - Intergenic
1050336850 9:4597712-4597734 TCTTCTCTCTTCCCTTGTGCTGG - Intronic
1051615377 9:19000570-19000592 GCTTCTCTCTTCCCAGATGGTGG - Intronic
1054104233 9:60982040-60982062 ACCTTTCTCTTTCCTGCTACTGG + Intergenic
1055356841 9:75446462-75446484 GTCTCTCTCTTCCCTGATAAGGG - Intergenic
1057371508 9:94478863-94478885 GCTTCTCTGTGCACTGCTACAGG - Intergenic
1058529143 9:105888892-105888914 GATTTTCTCTTGCATGCTACAGG + Intergenic
1059407239 9:114108747-114108769 GCTTCTCTCTTCCTGTCTGCTGG + Intergenic
1059723463 9:116984186-116984208 CCATCTCTCTTCTCTGCCACTGG + Intronic
1060747520 9:126147339-126147361 CACTCTCTCTTCTCTGCTACTGG + Intergenic
1061791429 9:133061273-133061295 CCTTCTCCCTTCCCTCCCACTGG + Intergenic
1062312208 9:135944897-135944919 GCTTCTCTCTCTCCTGGGACAGG + Intronic
1186467515 X:9795561-9795583 GCTGCTTTCTTCCCTGTTAGAGG + Intronic
1187701818 X:21970257-21970279 GGTTCTCTATTCCCTGCCCCCGG + Intronic
1187720839 X:22149302-22149324 GCTTCACTCTGCCCTGGAACAGG - Intronic
1189113595 X:38320730-38320752 TCTTCTCTCTTCCTTACTAAGGG - Intronic
1189847330 X:45149497-45149519 GTTTGTCTCTTGACTGCTACGGG - Exonic
1190737064 X:53262593-53262615 CCTCCTCTCTCCCCTGCCACTGG - Intronic
1193663770 X:84289799-84289821 GGTTCTCTCTTCTCTTCCACTGG + Intergenic
1195318828 X:103704797-103704819 GCATCTCCCTTCCCTGCTTGGGG + Intergenic
1196968679 X:121085492-121085514 GTTTTTCTCTTCCCTGCTCTGGG - Intergenic
1197026462 X:121755933-121755955 GTTTTTCTCATCCCTGCTCCTGG + Intergenic
1199169113 X:144715580-144715602 GATTCTCACTTCCCTGTGACTGG + Intergenic
1199256936 X:145728013-145728035 TCGTCTCTTTTCCCGGCTACAGG - Intergenic
1199503913 X:148540247-148540269 GCTTCTCTAATCCCTCCTTCTGG - Intronic
1200022147 X:153220937-153220959 GCTTCTGTCTTCACTCCTAAAGG + Intergenic