ID: 1151714625

View in Genome Browser
Species Human (GRCh38)
Location 17:75825125-75825147
Sequence GGGCCCTTGAAGCTCCTTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151714621_1151714625 -8 Left 1151714621 17:75825110-75825132 CCACTCCTGACACCTGGGCCCTT 0: 1
1: 0
2: 0
3: 31
4: 331
Right 1151714625 17:75825125-75825147 GGGCCCTTGAAGCTCCTTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 151
1151714615_1151714625 12 Left 1151714615 17:75825090-75825112 CCAGTGCTGCAGGGCCAGCCCCA 0: 1
1: 1
2: 3
3: 50
4: 430
Right 1151714625 17:75825125-75825147 GGGCCCTTGAAGCTCCTTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 151
1151714620_1151714625 -7 Left 1151714620 17:75825109-75825131 CCCACTCCTGACACCTGGGCCCT 0: 1
1: 1
2: 2
3: 31
4: 347
Right 1151714625 17:75825125-75825147 GGGCCCTTGAAGCTCCTTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 151
1151714616_1151714625 -2 Left 1151714616 17:75825104-75825126 CCAGCCCCACTCCTGACACCTGG 0: 2
1: 3
2: 4
3: 82
4: 579
Right 1151714625 17:75825125-75825147 GGGCCCTTGAAGCTCCTTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 151
1151714619_1151714625 -6 Left 1151714619 17:75825108-75825130 CCCCACTCCTGACACCTGGGCCC 0: 1
1: 0
2: 3
3: 32
4: 442
Right 1151714625 17:75825125-75825147 GGGCCCTTGAAGCTCCTTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151714625 Original CRISPR GGGCCCTTGAAGCTCCTTGA GGG Exonic
900992528 1:6104517-6104539 GGGCCCATGACCCTCCTTGCTGG + Exonic
902410970 1:16211406-16211428 GGGTTCTGGAAGCTCCTGGAGGG + Intronic
903295102 1:22338731-22338753 GGGACCCTGAAGCTCAGTGAGGG - Intergenic
905242988 1:36593251-36593273 TGGCCCTTGAAACTCATTCAAGG + Intergenic
907240393 1:53077839-53077861 GGGCCCGGGAAGCTCCTTCAGGG + Intronic
907443553 1:54492838-54492860 GTGCCCTTGTAGCTCCTTTCTGG - Intergenic
908239263 1:62175057-62175079 GGGCCCTCTAAGCCACTTGACGG + Intergenic
908279027 1:62509978-62510000 GGGCCAGTGAAGCTACTTGCGGG + Intronic
908902727 1:68974687-68974709 GGGCACTTGACGCTCCCTGCTGG + Intergenic
908930579 1:69312462-69312484 AAGCCCTTGGAGCTCCTTGTGGG - Intergenic
911360985 1:96875940-96875962 GGGCAGTGGAAGCTCCGTGAAGG + Intergenic
911566022 1:99464467-99464489 GGGCCATGGCAGCTCCTTCATGG + Intergenic
913283349 1:117206499-117206521 GGGCAATTGAAGCTCTTGGAGGG + Intronic
915597516 1:156904034-156904056 GGGCCCCTGCTGCACCTTGAGGG + Intronic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
917922935 1:179765979-179766001 GGGCTCTTACAGCTCCATGATGG + Intronic
921286209 1:213611679-213611701 TAGCTCTTGAAGCTCCTTGGCGG + Intergenic
922473610 1:225891045-225891067 GGGCCCATGTGGCTCCTTGGTGG + Intronic
922565377 1:226598072-226598094 AGGCCCTTGCATCTCCTTCATGG + Intronic
923113858 1:230915906-230915928 GGGTTCTTGAAGTTCCTTGGGGG - Intronic
1063520128 10:6733960-6733982 GGTCCCTTGAAGAATCTTGATGG - Intergenic
1064340916 10:14484546-14484568 GTGCCATTGAACTTCCTTGAAGG + Intergenic
1067202589 10:44186204-44186226 TGGCCCATGAAGCTCCCTGGTGG + Intergenic
1067683480 10:48454309-48454331 GGGCCCTGGCCACTCCTTGAGGG - Intronic
1067723494 10:48748712-48748734 TGGCCCTTGACCTTCCTTGATGG + Intronic
1069923339 10:71831079-71831101 GGGCCCCAGAAGCACCTTCAAGG + Intronic
1070543310 10:77432956-77432978 GGAGCCTTGAACCTCCCTGAAGG + Intronic
1070761826 10:79028714-79028736 TGGCCATTGCTGCTCCTTGAGGG - Intergenic
1072486746 10:95863274-95863296 GAGCCCCTGTAGGTCCTTGAAGG - Intronic
1075452671 10:122562990-122563012 TGGCCCTTGCTGCTCCTTGCAGG + Intronic
1076367864 10:129933919-129933941 GGGACCGTGAAGCTGCTGGAGGG - Intronic
1077548585 11:3188796-3188818 GGTCCCCTGCAGCTCCCTGAAGG - Intergenic
1077808485 11:5613317-5613339 GGGCACTTGAAGCTCCTTCATGG + Intronic
1079785984 11:24673436-24673458 GGGCCCTAGATGGTCCTTGCAGG + Intronic
1083572715 11:63768811-63768833 GGGCCCCTGGGGCTCCTTTAAGG + Intergenic
1083664384 11:64266641-64266663 AGGCCCTAGAAGAACCTTGAGGG - Intronic
1084062626 11:66686120-66686142 GTGTCCTTGAAGCTGATTGAGGG - Intronic
1085156741 11:74302518-74302540 GGGCCCTTGCTGCTCCCTCAAGG + Exonic
1089392171 11:118109598-118109620 GGGTCCCTAAAGATCCTTGATGG - Intronic
1090036006 11:123250090-123250112 GAGCCCTAGACACTCCTTGAGGG + Intergenic
1090036311 11:123252652-123252674 GGGTCCTGGAAGCTCCTGGAGGG + Intergenic
1092113991 12:5985516-5985538 GGGCCCTTGTTCCTCCATGAAGG + Intronic
1093413715 12:18896196-18896218 AAGCCCTTGGAGCTCCTTGGGGG - Intergenic
1097312287 12:58133290-58133312 GGCACTTTGAAGCTCCTTTATGG - Intergenic
1098845978 12:75536338-75536360 GAGTCCTCGAAGCACCTTGAAGG + Intergenic
1100028081 12:90153343-90153365 AGGCCCTTTGAACTCCTTGAGGG + Intergenic
1101721811 12:107357028-107357050 GGGTCCTCTAAGCTCCTTGAGGG - Intronic
1102020398 12:109678343-109678365 GGGTCCTTGGAGCTTCATGATGG + Intergenic
1102439242 12:112948843-112948865 AGGCCCTGGAAGGTCATTGAAGG - Exonic
1106228030 13:27799784-27799806 GGGCCCTGGAATTTCCTTGGTGG - Intergenic
1106414295 13:29533502-29533524 GGGCCCTAGGAAGTCCTTGAAGG + Intronic
1108016914 13:46086059-46086081 CAGCCATTGAAGCTGCTTGAGGG - Intronic
1114796377 14:25719750-25719772 GGGCCATTGAATTTTCTTGAAGG + Intergenic
1115439275 14:33413336-33413358 GGTCCCTGGAAGCTGCATGAGGG + Intronic
1121339819 14:93098732-93098754 AGGCCCATGAAGCTACTTCAGGG + Intronic
1129231107 15:74197641-74197663 GGGCCCTGGAAGATCCTGGGTGG - Intronic
1131220937 15:90583547-90583569 GAGCCCTTGAACCACCTAGATGG - Intronic
1131869402 15:96745911-96745933 TATCCCTTGAAGCTCATTGAGGG - Intergenic
1132353394 15:101154514-101154536 GGGTCCTTGCAGCTCCCAGAAGG - Intergenic
1135402892 16:22178378-22178400 GGCCCCTTGGAGCTCCTGGCAGG + Intronic
1137583840 16:49651996-49652018 GGGGTCTTGAAGCTCCTTTCAGG - Intronic
1140814862 16:78612246-78612268 GGGCCCTTGAAGGTTTGTGAAGG + Intronic
1147460122 17:40562997-40563019 GGCCCATTGCAGCTCCTTGTTGG + Intronic
1150005988 17:61469354-61469376 GGGCCAGTGAGGCTGCTTGATGG + Intronic
1151714625 17:75825125-75825147 GGGCCCTTGAAGCTCCTTGAGGG + Exonic
1151798381 17:76362284-76362306 AGGCACTAGAAGCCCCTTGAGGG - Intronic
1152265195 17:79290078-79290100 AGGCACTGGAAGCTCCTTGGAGG + Intronic
1152815634 17:82406059-82406081 GGGCCTTTGACGCTCCATGAGGG - Intronic
1152933804 17:83124463-83124485 GGGCCCATGAAGCTCCTCCCTGG + Intergenic
1155704280 18:28789044-28789066 GGAGCCTTGGAGATCCTTGAAGG - Intergenic
1157048241 18:44128910-44128932 GTGCCCTAAAAGCTCCTAGAAGG + Intergenic
1157299732 18:46470971-46470993 GGGACCTTGAAGGCACTTGAAGG - Intergenic
1158695613 18:59700555-59700577 GGGCCCTAAATGCTCCTTGGGGG + Intergenic
1160014742 18:75132006-75132028 GGGCCTTTGAAGCTCGTTCTTGG - Intergenic
1161337032 19:3720249-3720271 GGGCCCTTGGAGACCCTTGAGGG + Intronic
1161522502 19:4732632-4732654 GGGTCCTTGAAGCTCTCTCAGGG + Intergenic
1163292751 19:16391417-16391439 TAGCGCTTGAAGCTCCTTGAAGG - Intronic
1163455780 19:17404965-17404987 GGGGCCTTGAAACTCCTCGTGGG - Intronic
1166170406 19:41024363-41024385 CAGCCCTTGCAGCTCCTTAAAGG + Intergenic
1166178653 19:41091787-41091809 CAGCCCTTGCAGCTCCTTAAAGG - Exonic
925480842 2:4272366-4272388 AGACCCTTGAGCCTCCTTGAGGG - Intergenic
925786243 2:7434002-7434024 AAGCCCTTGTAGCTCCTTGAAGG + Intergenic
925865295 2:8221597-8221619 GGGCCCTTTTAGCTCCCTGAGGG + Intergenic
925921083 2:8638375-8638397 CAGCCTTTGGAGCTCCTTGAGGG - Intergenic
929786489 2:44997060-44997082 GGGTCCTTGAATCTCCCTGTGGG + Intergenic
933279947 2:80322538-80322560 GGGCCCTTGCAGCTCCGGGACGG + Intronic
940662131 2:156559225-156559247 TCTCACTTGAAGCTCCTTGAGGG + Intronic
942327460 2:174788055-174788077 GGGTGCTTGAAGCTCCAGGATGG + Intergenic
946781957 2:223200722-223200744 GAGCCCTTGAAGAACCCTGATGG - Intergenic
948530184 2:238599251-238599273 GGGCCCCTGAGGCTCCTCCACGG - Intergenic
1170293291 20:14795139-14795161 GGGCCCTACAAGGTCCTTCACGG - Intronic
1171956375 20:31466933-31466955 TGACGCTGGAAGCTCCTTGAGGG - Intronic
1172013416 20:31859582-31859604 TGGCTCTTGAAGCATCTTGAAGG + Intronic
1172123095 20:32609881-32609903 GGGCCCTTTAAGGTCTTTCATGG + Intergenic
1176171608 20:63698872-63698894 GGGCCCCTGAAGCTCAGCGAGGG + Exonic
1178680421 21:34669283-34669305 GGGCCCTCTGTGCTCCTTGAAGG - Intergenic
1181159029 22:20945763-20945785 GGACCCATGCAGCTCCGTGAGGG + Intronic
1181668048 22:24411993-24412015 GGGCCCAAGAAGCTCCGTGAAGG + Intronic
1184257790 22:43296908-43296930 GGGAGCCTGAAGGTCCTTGAAGG + Intronic
1184568516 22:45308089-45308111 GGGGCCTGGGAGCTCCATGAGGG + Intergenic
1184813331 22:46852238-46852260 GGTGCCTTGAAGCTCTTTGGAGG + Intronic
949933414 3:9098210-9098232 CTGCACTGGAAGCTCCTTGAGGG + Intronic
953279705 3:41542227-41542249 GGGCTGTTGAATCTTCTTGAAGG + Intronic
954109873 3:48428020-48428042 CTGGACTTGAAGCTCCTTGAAGG + Intronic
955960424 3:64334963-64334985 TGGCACTTGAAGGTCTTTGAAGG - Intronic
956876215 3:73466339-73466361 GGGCCCTTGGAGTTCTTTTATGG + Intronic
961321252 3:126078052-126078074 GGGCCCCTGCAGGTCCTTCAGGG - Intronic
962095941 3:132292701-132292723 GGGCCCCTGAGACTCCTTCAGGG - Intergenic
965539974 3:169862244-169862266 GGCCATTTGCAGCTCCTTGATGG - Intronic
966656686 3:182366279-182366301 GGGTCCTGGAAGCTCCTTGCTGG + Intergenic
970499558 4:16663587-16663609 GTTTCCGTGAAGCTCCTTGAAGG + Intronic
971943191 4:33241420-33241442 GGGACATTGGAGCTTCTTGAGGG - Intergenic
973727243 4:53788904-53788926 GGGGCCTTGAAGGGGCTTGAGGG + Intronic
974581258 4:63804861-63804883 TGGCCCTTGAGGTACCTTGAGGG + Intergenic
975761496 4:77624768-77624790 GGGCCCTGCATGCTCCTTGTAGG - Intergenic
977466820 4:97392741-97392763 GTTCCCTTGATGCTCTTTGATGG - Intronic
981751020 4:148092367-148092389 GCGGCCTGCAAGCTCCTTGATGG + Intronic
989858975 5:46341421-46341443 GGACACTTGAAGCGCTTTGAGGG - Intergenic
989917981 5:49758888-49758910 GGACCCTTGGAGCGCTTTGAGGG + Intergenic
989919641 5:49783258-49783280 GGACCCTTGGAGCGCTTTGAGGG + Intergenic
989920851 5:49800984-49801006 GGACTCTTGGAGCTCTTTGAGGG + Intergenic
989923976 5:49847314-49847336 GGACTCTTGGAGCTCTTTGAGGG + Intergenic
989932010 5:49966375-49966397 GGACTCTTGGAGCTCTTTGAGGG + Intergenic
989934709 5:50006240-50006262 GGACTCTTGGAGCTCTTTGAGGG + Intergenic
991230394 5:64326173-64326195 GGGTCCTTGTATTTCCTTGAGGG - Intronic
992590931 5:78294945-78294967 GGGCTCTGGAAACTCCTTAACGG - Intergenic
993661176 5:90636679-90636701 GGGGCCCTGAATCACCTTGAGGG - Intronic
997695516 5:135857897-135857919 GGGCCCTTTAAGGCCCTTTAAGG - Intronic
997698551 5:135880361-135880383 GGGCTGTTGAAGCTGCTGGAAGG - Intronic
998019524 5:138757692-138757714 GAGCCTTGTAAGCTCCTTGAAGG + Intronic
999149657 5:149418276-149418298 GGGCCCTTGAGGCTCAGAGAGGG + Intergenic
999152104 5:149433058-149433080 TGTCCCTTGAAGCTCAGTGAGGG + Intergenic
999229389 5:150052690-150052712 GGGCTCTTGATTCTCCCTGAAGG + Exonic
1000111642 5:158113725-158113747 GGGCACTTCAAGCTGTTTGAAGG - Intergenic
1001318252 5:170659901-170659923 GGCCCCTTGGAGCTCCTTCCAGG + Intronic
1001664391 5:173420626-173420648 GGGCCCAAGCAGCTCCTTTAGGG + Intergenic
1003571572 6:7259620-7259642 GAGCCGTTGAAGGTTCTTGAGGG + Intergenic
1004521471 6:16364877-16364899 GTGGACTGGAAGCTCCTTGAAGG - Intronic
1005766214 6:29014798-29014820 GAGCTCTCTAAGCTCCTTGAAGG - Intergenic
1009952444 6:70413315-70413337 GGGCAGTTGAAGCTCCTGAAGGG + Exonic
1014084730 6:117329998-117330020 AAGCCCTTTGAGCTCCTTGAGGG + Intronic
1017892345 6:158649302-158649324 GAGCCATGGAAGATCCTTGATGG - Intergenic
1017908162 6:158770966-158770988 GGGTACTTGAAGCTCCAGGATGG + Intronic
1020117116 7:5482078-5482100 GGGCCCTTGAGGCACTTAGAGGG - Intronic
1024609740 7:51054390-51054412 GGCCTCTTCACGCTCCTTGAAGG + Intronic
1027680012 7:81208547-81208569 GGGTCTTTGAAGCTCCTTAGTGG - Intergenic
1028517822 7:91697823-91697845 GGTCCCTGGAAGCACCATGAAGG - Intronic
1029844788 7:103401766-103401788 GGGCTGTTGAATTTCCTTGAAGG + Intronic
1029903847 7:104071258-104071280 GGGCCATGGAAGGACCTTGAGGG - Intergenic
1032286750 7:130543416-130543438 GCTTCCTTAAAGCTCCTTGAGGG + Intronic
1035337727 7:158140837-158140859 GGGCCCATGAACCTTCTTTAGGG - Intronic
1036707199 8:11054809-11054831 GGGCCCTGGGAGCTCCTGGGAGG + Intronic
1040625114 8:49138658-49138680 GTGACCTTGAGGCTCCATGAAGG + Intergenic
1043875033 8:85476131-85476153 GGACCTTTGAACCTCCTTGCAGG - Intronic
1048027430 8:130599469-130599491 GAGCCCTTGGAGACCCTTGAAGG + Intergenic
1048587749 8:135790807-135790829 GAGCCATTTAAGCTCCTTGGAGG - Intergenic
1049538287 8:143193160-143193182 CGGCTCTTGAAGCTGCATGAGGG + Intergenic
1049697399 8:143990768-143990790 GGCCCCTTAAAGCTGCTTAAGGG + Intronic
1056604686 9:88076791-88076813 GGGCCCTGGAAGCTCCAGGCGGG - Intergenic
1059726595 9:117014452-117014474 GGACTCTTGAAGATCCTTGTAGG - Intronic
1061574083 9:131495354-131495376 GGGCACTTGGATCTACTTGAAGG + Intronic
1062287607 9:135780042-135780064 CTGCCCTTGGAGCTCCATGAAGG + Intronic
1062454149 9:136627855-136627877 GTGCCCTTGAGGCGCCTCGACGG + Intergenic
1187258157 X:17660043-17660065 GTGACCTTGAAGATCCATGAGGG + Intronic
1200072556 X:153536354-153536376 GGCCCCTCGCAGCTCCATGAGGG - Exonic
1200266555 X:154649274-154649296 GGGCCCTTGAGGCCACTTGAGGG + Intergenic