ID: 1151718237

View in Genome Browser
Species Human (GRCh38)
Location 17:75842435-75842457
Sequence GATGAAGGTCTCGTCCCAGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151718226_1151718237 25 Left 1151718226 17:75842387-75842409 CCAGGAAAGACCTGGATAGAGTG 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1151718237 17:75842435-75842457 GATGAAGGTCTCGTCCCAGACGG 0: 1
1: 0
2: 0
3: 8
4: 91
1151718225_1151718237 26 Left 1151718225 17:75842386-75842408 CCCAGGAAAGACCTGGATAGAGT 0: 1
1: 0
2: 0
3: 21
4: 168
Right 1151718237 17:75842435-75842457 GATGAAGGTCTCGTCCCAGACGG 0: 1
1: 0
2: 0
3: 8
4: 91
1151718232_1151718237 15 Left 1151718232 17:75842397-75842419 CCTGGATAGAGTGGGGGCTGGAG 0: 1
1: 0
2: 4
3: 34
4: 320
Right 1151718237 17:75842435-75842457 GATGAAGGTCTCGTCCCAGACGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151718237 Original CRISPR GATGAAGGTCTCGTCCCAGA CGG Exonic
900739489 1:4322057-4322079 GTGGAAGGTGTAGTCCCAGAAGG - Intergenic
901445922 1:9308076-9308098 GCTGAAGTTCTGGTCCCAGACGG - Intronic
902166657 1:14577577-14577599 GCTGAAGGGCTGGTTCCAGAAGG - Intergenic
904392804 1:30196955-30196977 GAGGAAGGGCTGATCCCAGAAGG - Intergenic
904611503 1:31728389-31728411 GAACTAGGTCTTGTCCCAGAGGG - Intronic
907138246 1:52159241-52159263 AATGAAGCTCTCATCCCAGGTGG - Intronic
908829236 1:68163306-68163328 GATGAAACCCTCGTCCCGGACGG + Intronic
910202706 1:84715898-84715920 GATGAAAGTCTATTCCCTGAGGG + Intergenic
912270943 1:108208810-108208832 TCTGAAAGTTTCGTCCCAGAGGG + Intergenic
915300538 1:154948915-154948937 GTTGAATGTTTGGTCCCAGAGGG - Intronic
921066110 1:211623036-211623058 GATGGAGGCCTCCTTCCAGAGGG - Intergenic
1063269987 10:4497443-4497465 GATGAAGAGCTCTTCCCAGTGGG - Intergenic
1068703132 10:60041532-60041554 GATGAAGGCCTTATCCAAGAGGG + Intronic
1077116196 11:885680-885702 GGTGGAGGCCTCGGCCCAGAGGG - Intronic
1077784598 11:5369020-5369042 AATGAATATCTAGTCCCAGAAGG - Intronic
1080723577 11:34872730-34872752 GTTGAAGGTTGAGTCCCAGAAGG - Intronic
1081599539 11:44483789-44483811 GATGAATGTCTAGTCCTACAAGG - Intergenic
1083261929 11:61527922-61527944 GAGGAAGGTCTCGTTCCAGTGGG + Exonic
1084932911 11:72571157-72571179 GTTGAAGGTCTCCTCCGAGCAGG - Intergenic
1094623312 12:32100543-32100565 GATGAAGTCCTGGCCCCAGAAGG + Intergenic
1096179930 12:49545033-49545055 GATGAGGGTTTGGTCCCAGAAGG - Intronic
1118917143 14:70117124-70117146 GAAGAAGGTATAGTCCCAAAGGG - Intronic
1125073349 15:35582727-35582749 GATGAACCTCTCCTCCCAAATGG + Intergenic
1125538994 15:40459032-40459054 GATGAAGGTCCCCGCCGAGATGG + Exonic
1128611435 15:69076727-69076749 GATGCAGGACTCATCCCAGATGG + Intergenic
1133101491 16:3482743-3482765 GATGAAGGTCTGGCCCAAGACGG - Intronic
1135186765 16:20322357-20322379 GATGAATTTCTCGTCCCAGGAGG - Intronic
1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150963109 17:69936588-69936610 GATGAAAGTCACGTCTCACATGG - Intergenic
1151324301 17:73369394-73369416 GAGGAAGGCCTCGGCCAAGACGG + Intronic
1151718237 17:75842435-75842457 GATGAAGGTCTCGTCCCAGACGG + Exonic
1152357817 17:79815173-79815195 GATGAATGGCTCTGCCCAGAAGG + Intergenic
1153929522 18:9866385-9866407 GATGTAGGTCTCCTTCCAGGAGG + Intergenic
1157336522 18:46742843-46742865 TTTGAAAGTTTCGTCCCAGAGGG - Intronic
925155757 2:1648031-1648053 GATGAAGGTCAAGTCCATGAAGG - Intronic
929595478 2:43172970-43172992 GATGAAGGTATCCTTGCAGATGG + Intergenic
931969113 2:67566515-67566537 GAAAAAGGTCTCCTCCCAGCTGG - Intergenic
932420505 2:71598633-71598655 GATGAGCGTCTGGTCCCAGGTGG - Exonic
932498412 2:72159279-72159301 GAGCAAGGCCTCGGCCCAGATGG + Intergenic
934035726 2:88087284-88087306 GATGCAGGGCTCATCCCAGTAGG + Intronic
935025015 2:99268593-99268615 GATGGATGGCTAGTCCCAGAAGG - Intronic
945507580 2:210660150-210660172 GATTAAAGTCTAGTCCCTGAAGG - Intronic
945756918 2:213857807-213857829 CATGAAAGTCTCTTTCCAGAAGG - Intronic
1169334983 20:4748626-4748648 GACGAAGGTCCCGGCCCATATGG - Intergenic
1173317832 20:41961078-41961100 CATGAAGATCTCATCCCAGGAGG + Intergenic
1175476763 20:59281155-59281177 GATGAAGGTCTGGTCCCCTCTGG - Intergenic
1175778094 20:61665577-61665599 CATGAAGCTCACGTCCCAGGCGG + Intronic
1176260419 20:64176626-64176648 GAGGATGTTCTCGCCCCAGAAGG + Intronic
1182520937 22:30884246-30884268 GATGAAGGTCTCCTCCCTGCAGG - Intronic
1182540859 22:31040820-31040842 GATGAATGTCTCCTTCCGGATGG + Intergenic
1183964869 22:41435578-41435600 GATGATGGTCTGGGCCTAGAGGG + Exonic
1184391117 22:44204220-44204242 GATGGAGGGCGGGTCCCAGATGG - Intronic
949993749 3:9600710-9600732 AATGAAGGTCACGTGCCCGACGG + Intergenic
950858101 3:16124191-16124213 GATGAAGGTCTCGGCAGAGCTGG - Intergenic
976259108 4:83128833-83128855 GATGGAAGTATCTTCCCAGAAGG + Intronic
979924719 4:126546907-126546929 GAGGAAGGTGTCTTCCCAGAAGG - Intergenic
982587727 4:157263799-157263821 GATGAAGTTCTCTTCCCCAAGGG + Intronic
983222827 4:165059116-165059138 GGTGAAGGTCTCGACCAAGGTGG - Intergenic
984132259 4:175892650-175892672 GGTGAAGGTCATGTGCCAGAGGG - Intronic
985645705 5:1083803-1083825 GATGAAGTACTCGTCACAGGCGG + Exonic
987950318 5:24666130-24666152 GATGAAGGTCTTGACCTAAATGG + Intergenic
988691381 5:33576257-33576279 GCTGGTGGTCTCCTCCCAGAGGG + Exonic
993867080 5:93208870-93208892 GATGAGGGTCTAGTCCTGGAGGG - Intergenic
999276068 5:150330923-150330945 GATGAAGGCCTGGACCCCGATGG + Intronic
999449677 5:151668611-151668633 GATGAAGGTAGCCTCACAGAGGG - Intronic
1000852006 5:166351627-166351649 GATGAAGGTCTTGTCGAAGGTGG + Intergenic
1001663659 5:173414915-173414937 GATTAAGGTTGGGTCCCAGATGG + Intergenic
1004783040 6:18933645-18933667 AATGAAGGTGTGGTCTCAGAAGG - Intergenic
1005515562 6:26550854-26550876 GACGGTGGTCTCCTCCCAGATGG + Intergenic
1006062149 6:31431742-31431764 GCTGGAGGTCTCCTCACAGAAGG - Intergenic
1011063062 6:83293267-83293289 GATGGAGGTCACTTCCAAGATGG - Intronic
1012869920 6:104660083-104660105 GATGAATGGCTAGACCCAGAAGG + Intergenic
1016874435 6:148850825-148850847 GTTGAAGGCCTCGTCCGAGTGGG - Intronic
1023990760 7:45127002-45127024 CAGGAAGGCCTCTTCCCAGAAGG + Intergenic
1029113011 7:98223098-98223120 GATGATGGACACGTCCCTGAGGG + Exonic
1035434363 7:158848514-158848536 GTTAAAGGACTCGCCCCAGAAGG + Intergenic
1037631503 8:20660812-20660834 GATGAGGGGCTTGTCCAAGATGG + Intergenic
1038919141 8:32063299-32063321 GATTGAGGTCTCTTTCCAGATGG - Intronic
1041039400 8:53831591-53831613 GATGAATGGCTAGACCCAGAGGG + Intronic
1044331487 8:90925461-90925483 CATGAAGATCTCTTCCCTGAAGG + Intronic
1060121122 9:120990787-120990809 GCTGAAGTACTGGTCCCAGAAGG - Intronic
1062016317 9:134293041-134293063 GGTGAAGGTCAGGCCCCAGAGGG - Intergenic
1186217648 X:7317138-7317160 GATGATGTTCTCATCACAGAAGG - Intronic
1188638618 X:32468551-32468573 GAAGAAGCTCTCCTCCCAGCTGG - Exonic
1190690130 X:52907206-52907228 CATGGAGGTCTGGTCCCAGCTGG - Exonic
1190695853 X:52948586-52948608 CATGGAGGTCTGGTCCCAGCTGG + Exonic