ID: 1151719651

View in Genome Browser
Species Human (GRCh38)
Location 17:75847843-75847865
Sequence TATCCCCCGCCAGTCGCCAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 26}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151719651_1151719660 25 Left 1151719651 17:75847843-75847865 CCATTGGCGACTGGCGGGGGATA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG 0: 1
1: 0
2: 0
3: 5
4: 58
1151719651_1151719654 -5 Left 1151719651 17:75847843-75847865 CCATTGGCGACTGGCGGGGGATA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1151719654 17:75847861-75847883 GGATAGACATAGGCCCCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 39
1151719651_1151719658 15 Left 1151719651 17:75847843-75847865 CCATTGGCGACTGGCGGGGGATA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1151719658 17:75847881-75847903 GGGCATGTAAGAGTAGCCATAGG 0: 1
1: 0
2: 0
3: 8
4: 84
1151719651_1151719653 -6 Left 1151719651 17:75847843-75847865 CCATTGGCGACTGGCGGGGGATA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1151719653 17:75847860-75847882 GGGATAGACATAGGCCCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 72
1151719651_1151719659 24 Left 1151719651 17:75847843-75847865 CCATTGGCGACTGGCGGGGGATA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1151719659 17:75847890-75847912 AGAGTAGCCATAGGCTCCACTGG 0: 1
1: 0
2: 0
3: 6
4: 85
1151719651_1151719661 26 Left 1151719651 17:75847843-75847865 CCATTGGCGACTGGCGGGGGATA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1151719661 17:75847892-75847914 AGTAGCCATAGGCTCCACTGGGG 0: 1
1: 0
2: 1
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151719651 Original CRISPR TATCCCCCGCCAGTCGCCAA TGG (reversed) Exonic
900203607 1:1421820-1421842 TTGCCCCAGCCAGTCCCCAAAGG - Intergenic
900853842 1:5164841-5164863 TATCCCCCGCCAGCCCCGAGTGG - Intergenic
917211607 1:172637506-172637528 GATGCCCTGCCAGTCCCCAAGGG - Intergenic
1063393557 10:5666163-5666185 TCTCCCCCGCCACTGGGCAACGG + Intronic
1091228485 11:133972517-133972539 TACTCCCCGCCAATGGCCAATGG + Intergenic
1094636041 12:32227692-32227714 TTTCCTCTGCCAGTTGCCAATGG - Intronic
1113589112 13:111485921-111485943 TGTCCCTTGCCACTCGCCAAAGG - Intergenic
1121975999 14:98404675-98404697 CAGCCCCCACCAGTCCCCAAGGG - Intergenic
1144733568 17:17542377-17542399 TATCCCAAGCCAGTCCCCAGAGG - Intronic
1148460799 17:47838102-47838124 TACCCCCCGACATTCCCCAAAGG + Intronic
1150561051 17:66295173-66295195 TATCCCATGCCAATCACCAAAGG + Intergenic
1151719651 17:75847843-75847865 TATCCCCCGCCAGTCGCCAATGG - Exonic
1155362543 18:25016726-25016748 TTTCCCCCGCCAGTCACTAGTGG - Intergenic
1160714771 19:571249-571271 CATCCCCCTCCCGTCGCCACGGG + Intergenic
1166999376 19:46736892-46736914 TCTCACCCGCCAGTCTCCAATGG - Exonic
932764709 2:74462358-74462380 CAGCCCCAGCCAGTGGCCAAGGG + Exonic
1171120962 20:22568549-22568571 TATCCCACCCCAGTCGCCATGGG - Intergenic
1172799784 20:37567751-37567773 TGTCTCCCGCCAGCCGCCAGTGG - Intergenic
1174695552 20:52553029-52553051 TATCCCCAGCCACTAACCAATGG + Intergenic
1175230279 20:57469470-57469492 TCTCCCCAGACAGTCGCCAGTGG + Intergenic
1175485956 20:59346498-59346520 AATCCCACGCCAGTAGCAAACGG + Intergenic
1179976968 21:44873775-44873797 TCTGCCCCGCCCCTCGCCAACGG + Exonic
954589639 3:51771745-51771767 TCACCCCCTCCAGTCTCCAAAGG - Intergenic
955883735 3:63575435-63575457 TAGCCCCCCTCAGTCACCAAGGG + Intronic
996286647 5:121801963-121801985 TGTCCCCTGCCAGTACCCAAGGG - Intergenic
1007672881 6:43570633-43570655 CATCCTCTGCCAGTCGCAAAAGG + Exonic
1019759158 7:2796401-2796423 TATCCACAGCCAGCCGCCAACGG - Intronic
1035341401 7:158164884-158164906 TATTCACCGCCTGTGGCCAAGGG + Intronic
1056022802 9:82458238-82458260 TTTCCCCTGCCAGTGGCAAATGG - Intergenic
1197214938 X:123859301-123859323 TAACCCCCGCCATTCCCCCAGGG + Intergenic