ID: 1151719656

View in Genome Browser
Species Human (GRCh38)
Location 17:75847875-75847897
Sequence GCTACTCTTACATGCCCAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 72}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151719656_1151719667 24 Left 1151719656 17:75847875-75847897 CCCGCTGGGCATGTAAGAGTAGC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1151719667 17:75847922-75847944 CTCTGGAGGCTACGAGTACAAGG 0: 1
1: 0
2: 1
3: 17
4: 291
1151719656_1151719668 25 Left 1151719656 17:75847875-75847897 CCCGCTGGGCATGTAAGAGTAGC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1151719668 17:75847923-75847945 TCTGGAGGCTACGAGTACAAGGG 0: 1
1: 0
2: 0
3: 12
4: 81
1151719656_1151719660 -7 Left 1151719656 17:75847875-75847897 CCCGCTGGGCATGTAAGAGTAGC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG 0: 1
1: 0
2: 0
3: 5
4: 58
1151719656_1151719659 -8 Left 1151719656 17:75847875-75847897 CCCGCTGGGCATGTAAGAGTAGC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1151719659 17:75847890-75847912 AGAGTAGCCATAGGCTCCACTGG 0: 1
1: 0
2: 0
3: 6
4: 85
1151719656_1151719661 -6 Left 1151719656 17:75847875-75847897 CCCGCTGGGCATGTAAGAGTAGC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1151719661 17:75847892-75847914 AGTAGCCATAGGCTCCACTGGGG 0: 1
1: 0
2: 1
3: 7
4: 99
1151719656_1151719669 26 Left 1151719656 17:75847875-75847897 CCCGCTGGGCATGTAAGAGTAGC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1151719669 17:75847924-75847946 CTGGAGGCTACGAGTACAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 83
1151719656_1151719663 7 Left 1151719656 17:75847875-75847897 CCCGCTGGGCATGTAAGAGTAGC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1151719663 17:75847905-75847927 TCCACTGGGGACTTCACCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 202
1151719656_1151719665 10 Left 1151719656 17:75847875-75847897 CCCGCTGGGCATGTAAGAGTAGC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1151719665 17:75847908-75847930 ACTGGGGACTTCACCTCTGGAGG 0: 1
1: 0
2: 2
3: 64
4: 1433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151719656 Original CRISPR GCTACTCTTACATGCCCAGC GGG (reversed) Exonic
902281964 1:15381392-15381414 GCTCCTCTTTCCTCCCCAGCTGG - Exonic
907553605 1:55325565-55325587 GCTACACTTAGCTGTCCAGCAGG + Intergenic
910585868 1:88878934-88878956 GCAGATCTTACAGGCCCAGCCGG + Intronic
915025749 1:152827876-152827898 GCCACTCTTGCAGGCCCAGGAGG - Exonic
1065269309 10:24010854-24010876 GCTTCCCTTCCATGACCAGCTGG - Intronic
1066003575 10:31127313-31127335 GCTACTCTAACATGCAAAGAAGG - Intergenic
1066429456 10:35337280-35337302 GCTGCTCTTGCTTGCCCAGCCGG + Intronic
1066594371 10:37033369-37033391 GCTTCTGTTACATGCCCTCCTGG - Intergenic
1075272300 10:121062779-121062801 CCTACTATTTCATGCCCAGCAGG - Intergenic
1079209765 11:18450433-18450455 GATGCTCTTACATGCCCGGTGGG - Intronic
1079210726 11:18458311-18458333 GATGCTCTTACATGCCCGGTGGG - Intronic
1089351416 11:117823684-117823706 GCTACTCTTTCCTGCCCTGCCGG + Intronic
1092089201 12:5790257-5790279 CCCACTCTTACCTGCCCAGCTGG + Intronic
1097456682 12:59806859-59806881 GCAACTCCCCCATGCCCAGCAGG - Intergenic
1099904215 12:88752885-88752907 GCTACTTTTATATGCCCTCCAGG - Intergenic
1101034540 12:100692400-100692422 GTAAGTCTTACATGGCCAGCAGG - Intergenic
1109033664 13:57228008-57228030 GCTACTCTTCCATGAACAGATGG + Intergenic
1113366999 13:109685456-109685478 GCAAGCCTCACATGCCCAGCAGG + Intergenic
1117556130 14:56886076-56886098 GCTTCTCTTACATGCACAGAGGG + Intergenic
1121637889 14:95466110-95466132 GCTTCTCCTTCAGGCCCAGCTGG + Exonic
1128657806 15:69475310-69475332 TTTACTCTTACATTCTCAGCAGG - Intergenic
1134202152 16:12208183-12208205 GCTAGTCATACAGGCCCACCTGG + Intronic
1139458295 16:67102006-67102028 GCTTCCATTTCATGCCCAGCTGG + Intergenic
1141261053 16:82454158-82454180 GCTGTTTTTGCATGCCCAGCTGG - Intergenic
1142963458 17:3565751-3565773 GCTCCTCTTACCTGCCCGGGTGG - Exonic
1150107375 17:62472356-62472378 CCTCCTCCTCCATGCCCAGCAGG + Intronic
1151676819 17:75602934-75602956 GCTGTTCTTACCTGCCCAGCCGG - Intergenic
1151719656 17:75847875-75847897 GCTACTCTTACATGCCCAGCGGG - Exonic
1158344525 18:56502719-56502741 ACCTCTCTTACATGGCCAGCGGG + Intergenic
1163554040 19:17982644-17982666 GCTAATCTTAAATTCCTAGCGGG - Intronic
1163644464 19:18480550-18480572 CCTGCTCTTACAGGCCCACCTGG - Intronic
1164819903 19:31241732-31241754 GCTACTATTACAACCCCGGCAGG + Intergenic
1166638704 19:44474718-44474740 CCTAGTCTTACATGGCCAGTGGG - Intergenic
926714189 2:15911005-15911027 ACTGCTCTCTCATGCCCAGCTGG - Intergenic
927270164 2:21198891-21198913 CCTGCTCTTCCCTGCCCAGCAGG + Intergenic
935548482 2:104425965-104425987 TCTGCTCTTACATGCACAGTTGG - Intergenic
942967919 2:181919377-181919399 GCTGCTCCTCCAGGCCCAGCAGG - Exonic
945851615 2:215015009-215015031 GCTACCATTACATACCCAGAAGG - Intronic
946151186 2:217772405-217772427 GCTGCTCTGAAATGACCAGCAGG - Intergenic
1172592117 20:36125208-36125230 GCTATTCCTACAGGCCCAGAAGG + Intronic
1173315190 20:41936879-41936901 TCTACTCTGATATCCCCAGCAGG - Intergenic
1173690201 20:44954928-44954950 GCTTCCCCTACATGCCCATCGGG + Intronic
1173978633 20:47206216-47206238 GCTCCTCTTAGCTGCCCAGTGGG - Intergenic
1176181865 20:63753215-63753237 GCTACCCACACATGCCCAGTGGG - Intronic
949508201 3:4746034-4746056 GCTGCTCCTCCATTCCCAGCTGG - Intronic
952225728 3:31373868-31373890 GCTCCTCTTATATGCCCCACAGG + Intergenic
955392226 3:58530283-58530305 ACTCCTCTGACATGCCCAGATGG + Intronic
959667944 3:108942569-108942591 TCTATTCTTACCTGCCCTGCTGG + Intronic
965404245 3:168250016-168250038 GCGCCACTTACATGCCCAGCCGG - Intergenic
967500556 3:190192542-190192564 CCTAGTCCTACTTGCCCAGCTGG - Intergenic
982278119 4:153657724-153657746 TTTACTCTTACATGTACAGCAGG + Intergenic
984551630 4:181166943-181166965 GCTAAATTTACATGCCCATCCGG - Intergenic
985287737 4:188354229-188354251 ACTCCTCTTAAATGCCCAGGTGG + Intergenic
987016277 5:13823030-13823052 GCTACTCGCACATGACTAGCTGG + Intronic
995647753 5:114331907-114331929 GGTTCTCTTACAGCCCCAGCTGG - Intergenic
999082977 5:148861642-148861664 GCTACTATTGGATGCACAGCAGG - Intergenic
1001917985 5:175577405-175577427 GATACTATTTCATGCCCATCAGG + Intergenic
1003852703 6:10241456-10241478 GACACTCTTTGATGCCCAGCTGG - Intergenic
1006960719 6:37927306-37927328 GCTACTCCCAATTGCCCAGCAGG - Intronic
1012167730 6:95979705-95979727 GCTACTCTCACTGGCCCAGGAGG - Intergenic
1013286880 6:108689572-108689594 GCTGCTCTCCCATGCCCGGCTGG - Intergenic
1023028539 7:36073678-36073700 GTTTCTCTTACATGCCCAATGGG + Intergenic
1029111162 7:98213643-98213665 GCTTCTCTCCCATGCCCAGAAGG - Intergenic
1032036421 7:128524894-128524916 CCTCCTCCTCCATGCCCAGCAGG + Intergenic
1032085298 7:128880559-128880581 GCTCCTCCCACATGCCCAGAAGG + Intronic
1032336995 7:131034505-131034527 ACTTCTCTTGCATACCCAGCAGG + Intergenic
1034903461 7:154922674-154922696 GCATGTCTTACATGGCCAGCAGG - Intergenic
1035612965 8:980629-980651 CCTCCTCTTACCTGCCCACCTGG - Intergenic
1044740484 8:95321429-95321451 TCTACTCTTACCTACCCATCTGG + Intergenic
1049001083 8:139826031-139826053 GCTCCTCTTCCTTGCCCACCAGG - Intronic
1049661658 8:143822241-143822263 GCTGCTATCACATGCCCGGCAGG + Intronic
1049671485 8:143872056-143872078 GCGGCTCTTGGATGCCCAGCTGG - Exonic
1052382601 9:27788137-27788159 GCTTGTTTTACATGGCCAGCAGG - Intergenic
1052382869 9:27790150-27790172 GCTTCTTTTACATGGCCAGCAGG - Intergenic
1056630779 9:88291228-88291250 GCTACTGCCACCTGCCCAGCAGG - Intergenic
1057818004 9:98309867-98309889 GGTCCTCTTACATGCCCTTCTGG + Intronic
1058262985 9:102859635-102859657 GCTACTTCTACATGCTCAGGGGG + Intergenic
1058930893 9:109717677-109717699 GCTAGGCTCACAAGCCCAGCAGG + Intronic
1061428006 9:130512888-130512910 GCTACACTGGCATGCCCAGGTGG - Intergenic
1201861010 Y:18597247-18597269 GCTACTCTCACATGCTCTGTTGG + Intergenic
1201872313 Y:18723133-18723155 GCTACTCTCACATGCTCTGTTGG - Intergenic