ID: 1151719657

View in Genome Browser
Species Human (GRCh38)
Location 17:75847876-75847898
Sequence GGCTACTCTTACATGCCCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 99}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151719657_1151719668 24 Left 1151719657 17:75847876-75847898 CCGCTGGGCATGTAAGAGTAGCC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1151719668 17:75847923-75847945 TCTGGAGGCTACGAGTACAAGGG 0: 1
1: 0
2: 0
3: 12
4: 81
1151719657_1151719665 9 Left 1151719657 17:75847876-75847898 CCGCTGGGCATGTAAGAGTAGCC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1151719665 17:75847908-75847930 ACTGGGGACTTCACCTCTGGAGG 0: 1
1: 0
2: 2
3: 64
4: 1433
1151719657_1151719669 25 Left 1151719657 17:75847876-75847898 CCGCTGGGCATGTAAGAGTAGCC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1151719669 17:75847924-75847946 CTGGAGGCTACGAGTACAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 83
1151719657_1151719659 -9 Left 1151719657 17:75847876-75847898 CCGCTGGGCATGTAAGAGTAGCC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1151719659 17:75847890-75847912 AGAGTAGCCATAGGCTCCACTGG 0: 1
1: 0
2: 0
3: 6
4: 85
1151719657_1151719667 23 Left 1151719657 17:75847876-75847898 CCGCTGGGCATGTAAGAGTAGCC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1151719667 17:75847922-75847944 CTCTGGAGGCTACGAGTACAAGG 0: 1
1: 0
2: 1
3: 17
4: 291
1151719657_1151719660 -8 Left 1151719657 17:75847876-75847898 CCGCTGGGCATGTAAGAGTAGCC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG 0: 1
1: 0
2: 0
3: 5
4: 58
1151719657_1151719661 -7 Left 1151719657 17:75847876-75847898 CCGCTGGGCATGTAAGAGTAGCC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1151719661 17:75847892-75847914 AGTAGCCATAGGCTCCACTGGGG 0: 1
1: 0
2: 1
3: 7
4: 99
1151719657_1151719663 6 Left 1151719657 17:75847876-75847898 CCGCTGGGCATGTAAGAGTAGCC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1151719663 17:75847905-75847927 TCCACTGGGGACTTCACCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151719657 Original CRISPR GGCTACTCTTACATGCCCAG CGG (reversed) Exonic
900902940 1:5528999-5529021 GGCTCATCTTACATGACCAGAGG - Intergenic
914671982 1:149877812-149877834 GGCTTCTCTCATCTGCCCAGAGG + Intronic
916888308 1:169091841-169091863 TGTTACTCTTGCATCCCCAGTGG - Intergenic
920848234 1:209611285-209611307 GCCGACTCTTACTTGCCCAGGGG + Intronic
924068816 1:240254724-240254746 GGGTGCTCTTAAATGCACAGAGG + Intronic
1063713591 10:8505341-8505363 GGCTAATCTTACAGGCCCCCAGG - Intergenic
1066246197 10:33585514-33585536 GGCCACCCATCCATGCCCAGAGG + Intergenic
1070829358 10:79409213-79409235 AGCCTCTGTTACATGCCCAGAGG - Intronic
1072677768 10:97481128-97481150 GGCTCTGCTTCCATGCCCAGGGG - Intronic
1075191314 10:120311678-120311700 GGCTACTTTTACATGACAATAGG + Intergenic
1075874241 10:125793368-125793390 GACTCCTCCTACAGGCCCAGGGG + Intronic
1079209766 11:18450434-18450456 AGATGCTCTTACATGCCCGGTGG - Intronic
1079210727 11:18458312-18458334 AGATGCTCTTACATGCCCGGTGG - Intronic
1079581082 11:22065673-22065695 GGCTACTGTCACAGGCCCAGAGG - Intergenic
1080801399 11:35613580-35613602 GGCTACTCTTCCTTGCTCATAGG + Intergenic
1086351045 11:85943425-85943447 GGCACCTCTTCCATTCCCAGTGG + Intergenic
1087730149 11:101769159-101769181 GTCTACTCTCACATGGCCATAGG + Intronic
1088694584 11:112355870-112355892 GGCCACACCTACCTGCCCAGAGG - Intergenic
1101311826 12:103587547-103587569 GTCTCCTCTTACCTGCCCTGTGG - Exonic
1104577779 12:129983613-129983635 AGCGACCCTTACATACCCAGGGG - Intergenic
1104816711 12:131650394-131650416 GGCCACTCCTTCCTGCCCAGAGG + Intergenic
1108473326 13:50788858-50788880 GGCTACTTTCACAGTCCCAGGGG - Intronic
1109624814 13:64960859-64960881 GGCAACTCTTACTTATCCAGAGG - Intergenic
1111075558 13:83230474-83230496 GGTTACTCTTAAATGCCCATGGG + Intergenic
1112521809 13:100102688-100102710 GGTTTCTCTTACATACCAAGGGG + Intronic
1113028752 13:105970830-105970852 GCCTCCTCTTACATAGCCAGGGG - Intergenic
1114487272 14:23070337-23070359 GGCCACTTTTACCTGCTCAGAGG + Intronic
1117556129 14:56886075-56886097 GGCTTCTCTTACATGCACAGAGG + Intergenic
1119020798 14:71111345-71111367 GGCTGCTCCTAAATGCTCAGAGG - Exonic
1120677302 14:87435477-87435499 TGCTACAAATACATGCCCAGGGG - Intergenic
1120852841 14:89186720-89186742 GGCTAATGTCACATGCACAGCGG + Intronic
1127101962 15:55575798-55575820 GGCTGCTCTTCCAAGCCCAGAGG + Intronic
1127887893 15:63219521-63219543 TGTTACTCTTACATGTGCAGTGG - Intronic
1134325116 16:13200527-13200549 GGCTGGCCTGACATGCCCAGGGG + Intronic
1137330185 16:47486661-47486683 GGGTACTCATACATGCACACAGG - Intronic
1138769261 16:59643615-59643637 GGCACATCTTACATGACCAGAGG - Intergenic
1144132253 17:12257913-12257935 TGCTACTCTTACAGAACCAGCGG + Intergenic
1144615229 17:16765025-16765047 GGTTCCTGTTACATGTCCAGGGG - Intronic
1144897472 17:18550631-18550653 GGTTCCTGTTACATGTCCAGGGG + Intergenic
1145134900 17:20395085-20395107 GGTTCCTGTTACATGTCCAGGGG - Intergenic
1151425638 17:74029424-74029446 GGCTCCCCTGAGATGCCCAGGGG - Intergenic
1151719657 17:75847876-75847898 GGCTACTCTTACATGCCCAGCGG - Exonic
1152101983 17:78307184-78307206 GGCTTTGCCTACATGCCCAGAGG + Intergenic
1156663903 18:39382307-39382329 AGCTCCTCTTACCTCCCCAGAGG - Intergenic
1156789406 18:40953522-40953544 GTCTACCCATACAGGCCCAGAGG + Intergenic
1158344524 18:56502718-56502740 GACCTCTCTTACATGGCCAGCGG + Intergenic
1160066121 18:75575796-75575818 GGATACTCTGGAATGCCCAGAGG - Intergenic
1164393085 19:27842543-27842565 GGCTCCTCTTCCAGGCCCACTGG - Intergenic
1165107869 19:33484958-33484980 GCCTACCCTCACAGGCCCAGTGG - Intronic
1166638706 19:44474719-44474741 GCCTAGTCTTACATGGCCAGTGG - Intergenic
1168291494 19:55359726-55359748 CCCTACTCTTCCATCCCCAGGGG - Exonic
1168408532 19:56123573-56123595 GGCCACACTTAGATGCCAAGAGG - Intergenic
928613253 2:33011215-33011237 GCCCACTCCTACATGCCAAGAGG - Intronic
934710323 2:96509936-96509958 GGCTCCCCATTCATGCCCAGTGG - Intergenic
934745686 2:96758043-96758065 GGGTGCTGTTACATGCTCAGGGG + Intergenic
936803563 2:116296653-116296675 GGCTAATTGTTCATGCCCAGGGG - Intergenic
938641898 2:133289868-133289890 GGCACATCTTACATGGCCAGAGG + Intronic
942862537 2:180632833-180632855 GGCCAGTCTTAAATGTCCAGAGG + Intergenic
948220329 2:236264458-236264480 GGCTCCTCTTACAGTCCCTGCGG + Intergenic
1168797764 20:622895-622917 GGGTACTCTTACAGGCACTGGGG - Intergenic
1173978373 20:47204431-47204453 GGCTTCTCTTAGCTGCCCTGGGG - Intergenic
1173978634 20:47206217-47206239 GGCTCCTCTTAGCTGCCCAGTGG - Intergenic
1176181866 20:63753216-63753238 TGCTACCCACACATGCCCAGTGG - Intronic
1179272266 21:39860702-39860724 GGCCAATCTTGCAAGCCCAGAGG + Intergenic
1184693210 22:46126714-46126736 GGCTGCTCCTCCCTGCCCAGGGG + Intergenic
951931624 3:27973750-27973772 GGGTACTGTAACATGCCCACTGG - Intergenic
952169838 3:30794761-30794783 GTCTGCTCTTACTTTCCCAGGGG + Intronic
952230398 3:31423728-31423750 GTTCACTCTCACATGCCCAGGGG + Intergenic
955567543 3:60264207-60264229 GGCTACTCCTACATACAGAGTGG - Intronic
960062226 3:113335117-113335139 TGTTACTCTCACATGGCCAGAGG - Intronic
961636125 3:128334216-128334238 GGCTCATCTTACTTGCCCATTGG + Intronic
964154010 3:153563259-153563281 GGCATTTCTTACATGGCCAGAGG - Intergenic
964188718 3:153978043-153978065 GGTTTCTCTGACCTGCCCAGGGG + Intergenic
966246403 3:177812811-177812833 GGCTCCTCCTCCCTGCCCAGTGG - Intergenic
985795841 5:1961691-1961713 GGCCTCTCTCACATGCCAAGAGG - Intergenic
987832093 5:23107569-23107591 GGCTACTCTTGCTTGCACATGGG - Intergenic
988298605 5:29394410-29394432 GGCTCCTCTTCCAGGCCCACTGG + Intergenic
996046876 5:118883624-118883646 GGCACCTCTTACATGGCCACAGG + Intronic
998335761 5:141370989-141371011 GGCTGCTCTTCCCTGTCCAGGGG - Exonic
999969771 5:156847652-156847674 GGCTAGTGGTTCATGCCCAGGGG - Intergenic
1000892777 5:166818680-166818702 GGTTGTTCTTACATGCCCACAGG - Intergenic
1002381236 5:178831482-178831504 GCCCACTATTCCATGCCCAGGGG + Intergenic
1005028841 6:21490776-21490798 GGCCCCTCTTTCCTGCCCAGTGG + Intergenic
1006191906 6:32214586-32214608 GGCTACTGTTCCAGGCCCTGGGG - Intronic
1006628589 6:35414981-35415003 CTCTACTCCTACACGCCCAGGGG - Intronic
1007205236 6:40144696-40144718 GGCTACTCTGAGAAGCCTAGTGG + Intergenic
1007407482 6:41643374-41643396 GGTGGCTCTTACATACCCAGAGG - Intronic
1018579879 6:165299525-165299547 GCCTCCTCATACATGGCCAGTGG - Intronic
1018868036 6:167760487-167760509 GCCCACTCTTACATGTCCATGGG - Intergenic
1019156433 6:170042032-170042054 GGCATGTCTCACATGCCCAGAGG - Intergenic
1020100311 7:5390607-5390629 GGCTTCTCCCACCTGCCCAGTGG - Exonic
1021907684 7:25352019-25352041 GACTCCTCTGCCATGCCCAGTGG + Intergenic
1023028538 7:36073677-36073699 AGTTTCTCTTACATGCCCAATGG + Intergenic
1027799126 7:82730529-82730551 GGATACTTTGACATGCTCAGAGG - Intergenic
1031581676 7:123483188-123483210 GGCTTCTCTTCCATCCACAGAGG + Intronic
1031583342 7:123504556-123504578 GGCACATCTTACATGGCCAGAGG + Intronic
1031920825 7:127599558-127599580 GGCTCCTCTTCCCTGCCCAAGGG + Intronic
1032482889 7:132261144-132261166 GCCAAATCTGACATGCCCAGGGG + Intronic
1034491710 7:151396408-151396430 TGCTACAGGTACATGCCCAGGGG - Intronic
1035011033 7:155714971-155714993 TGCTTCTCTGCCATGCCCAGTGG - Intronic
1036594649 8:10200800-10200822 CTCTAGTCATACATGCCCAGGGG - Intronic
1044879874 8:96712736-96712758 CCCTACTATTACAAGCCCAGAGG - Intronic
1055161179 9:73129937-73129959 AGCCACTCTTATATGCCCAGGGG - Intergenic
1055831068 9:80379360-80379382 CGCTACTCTTACATATCCTGAGG - Intergenic
1056028543 9:82526287-82526309 GGCTACTTTTGCAGGCCTAGGGG - Intergenic
1058262984 9:102859634-102859656 GGCTACTTCTACATGCTCAGGGG + Intergenic
1061220361 9:129246984-129247006 GGCAGCTCTTACAGGCTCAGGGG - Intergenic
1196882788 X:120213758-120213780 GGCTACGGGTTCATGCCCAGAGG - Intergenic
1197260618 X:124313249-124313271 GGCTAATGGTTCATGCCCAGGGG - Intronic
1198520898 X:137451406-137451428 GGATGCTCTTTCATGCCCACTGG + Intergenic
1201274201 Y:12283445-12283467 GGCTCCTCTTTCAGGCCCAGTGG - Intergenic