ID: 1151719660

View in Genome Browser
Species Human (GRCh38)
Location 17:75847891-75847913
Sequence GAGTAGCCATAGGCTCCACT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151719656_1151719660 -7 Left 1151719656 17:75847875-75847897 CCCGCTGGGCATGTAAGAGTAGC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG 0: 1
1: 0
2: 0
3: 5
4: 58
1151719655_1151719660 -6 Left 1151719655 17:75847874-75847896 CCCCGCTGGGCATGTAAGAGTAG 0: 1
1: 0
2: 0
3: 9
4: 64
Right 1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG 0: 1
1: 0
2: 0
3: 5
4: 58
1151719657_1151719660 -8 Left 1151719657 17:75847876-75847898 CCGCTGGGCATGTAAGAGTAGCC 0: 1
1: 0
2: 1
3: 10
4: 99
Right 1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG 0: 1
1: 0
2: 0
3: 5
4: 58
1151719651_1151719660 25 Left 1151719651 17:75847843-75847865 CCATTGGCGACTGGCGGGGGATA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151719660 Original CRISPR GAGTAGCCATAGGCTCCACT GGG Exonic
901678585 1:10900668-10900690 CAGTGGCCTCAGGCTCCACTGGG - Intergenic
907540791 1:55214629-55214651 GAGAAGCCCCAGGCTCCAGTTGG - Intronic
908027429 1:59967725-59967747 GAGAAGAAATAGGCTGCACTGGG + Intergenic
908184181 1:61636037-61636059 CAGTACCCGTAGGCTCCTCTTGG + Intergenic
908447671 1:64216337-64216359 GAATACCAGTAGGCTCCACTTGG + Intronic
908954116 1:69600349-69600371 TTGTTGCCATAGGCTCCTCTTGG + Intronic
922894522 1:229089870-229089892 CAGTACTCATTGGCTCCACTGGG - Intergenic
1062869305 10:885712-885734 CAGAAGTCATGGGCTCCACTGGG + Exonic
1063680902 10:8186928-8186950 TAGTAGCCATAGTATTCACTTGG - Intergenic
1065179057 10:23106752-23106774 GAGAAGCCATGGCCTCCACTAGG - Intronic
1070504158 10:77098366-77098388 GAGTACCCATTGGCCTCACTTGG - Intronic
1075602633 10:123781590-123781612 GAGTGGCCCTAGGAGCCACTGGG - Intronic
1079209770 11:18450449-18450471 GAGCATCTATAGGCTCCACTGGG + Intronic
1080820130 11:35797765-35797787 AAGTTTCCATAGGCTCCTCTCGG - Intronic
1084288524 11:68146973-68146995 GAGTAGCCCGAGGCTCCAAGTGG - Intergenic
1090923561 11:131230119-131230141 AAGTAGCCTTAGGTTGCACTTGG + Intergenic
1094636046 12:32227740-32227762 GAGTACCCGTAGCCTCCATTGGG + Intronic
1098087627 12:66864130-66864152 GAGAAGCCATGAGATCCACTCGG - Intergenic
1100692955 12:97058454-97058476 GGGTGGCCCTAGGATCCACTGGG - Intergenic
1103150073 12:118629919-118629941 GAGCATCCATAGGGACCACTAGG - Intergenic
1124090518 15:26595644-26595666 GGGTTGCTTTAGGCTCCACTTGG - Intronic
1125430623 15:39589695-39589717 GAGTAGACAGAGGCTCCATTTGG - Intronic
1134245182 16:12534409-12534431 GTGTAGCCAGCGGCTGCACTCGG + Intronic
1139110688 16:63886995-63887017 GAGAAGCCAGTGGCTCCACCAGG - Intergenic
1146006904 17:29166240-29166262 GAGAAGCCAAAGTCTCCAGTGGG + Exonic
1146636894 17:34513240-34513262 CAGCAGCCAAAGGTTCCACTGGG + Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1153675344 18:7451914-7451936 GACTTGCCGTAGGCTCCACCTGG - Intergenic
1157048489 18:44132083-44132105 GAGTTTCCATAGTCTTCACTGGG + Intergenic
1163609641 19:18294262-18294284 GAGCAGTCACAGGCTCCACCTGG - Intergenic
1163692503 19:18745291-18745313 GAGCAGCCCTGGGCTCCACAAGG + Intronic
1165467609 19:35984258-35984280 GAGTAGCCACTGGTGCCACTAGG - Intergenic
1168687726 19:58358512-58358534 GAGGAGCAAGAGGCTCCCCTGGG - Exonic
936684684 2:114814120-114814142 TAATAGGCATAGTCTCCACTTGG + Intronic
947951854 2:234154762-234154784 CAGTGGCCATAGTCTCCACTGGG + Intergenic
1172061360 20:32189459-32189481 GAGTCGCAATAGACACCACTCGG + Intergenic
1172091117 20:32433641-32433663 GAGAAGCCACAGACTCAACTGGG - Exonic
1175930801 20:62492927-62492949 CAGGAGCCAGATGCTCCACTGGG - Intergenic
951891810 3:27574617-27574639 GAGAAGCCATAGGCCCCAGCTGG - Intergenic
961826636 3:129602562-129602584 GAGTTGCCATTGGCTCCCCAGGG + Intronic
965686966 3:171314413-171314435 GATCAGCCATAGGCTCTACATGG - Intronic
971166235 4:24186681-24186703 GAGTACCCATTGGAGCCACTTGG + Intergenic
971704392 4:30020866-30020888 CAGTAGTCATAGTCTACACTAGG + Intergenic
979192033 4:117873513-117873535 GAGTTGCCATGGGCACCATTAGG + Intergenic
983968318 4:173841869-173841891 TAGTTGCCATAGGCACCACGTGG - Intergenic
987074602 5:14369228-14369250 AAGGAGCCATGGGCTCCACCTGG - Intronic
987116744 5:14731785-14731807 GTATAGCCTTAGGCTGCACTAGG + Intronic
994350290 5:98737692-98737714 GAGCTGCCATGGGCTCCACCCGG - Intergenic
997090488 5:130850775-130850797 GTGGAGCCATAGGCTACACTAGG - Intergenic
998332366 5:141340367-141340389 GAGAAGACAGAGGCTCCTCTGGG - Exonic
999056118 5:148578890-148578912 GAGTAGCCATAAGTTGGACTTGG - Intronic
1012684100 6:102221779-102221801 CAGTAGCCATTAGCTACACTTGG + Intergenic
1015420009 6:132996865-132996887 GCTTAGCCAAAGGCTCCCCTGGG - Intergenic
1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG + Exonic
1023374277 7:39540348-39540370 TACTAGACATAGGCTCCACAAGG + Intergenic
1032229574 7:130063012-130063034 AAGTGTCCATAGGCTCCACCAGG + Intergenic
1046584350 8:116133149-116133171 GAGGGGCCATAGGCTCATCTTGG + Intergenic
1047152745 8:122283172-122283194 TAGGAGCCATAAGCTCCACGGGG - Intergenic
1055484039 9:76739599-76739621 GAGCTGCCCTAGGCTTCACTTGG - Intronic
1056760477 9:89411105-89411127 GAGCAGGCAGAGGCTCCAATGGG + Intronic
1189774615 X:44459392-44459414 GAGCAGCCATAGGACCCACCTGG + Intergenic
1194331364 X:92586715-92586737 GAGCAGCCAAAGGATACACTAGG - Intronic
1195319053 X:103706641-103706663 GAACAGTCATAGGCTGCACTGGG - Intergenic
1200640066 Y:5705774-5705796 GAGCAGCCAAAGGATACACTAGG - Intronic