ID: 1151722995

View in Genome Browser
Species Human (GRCh38)
Location 17:75868792-75868814
Sequence GAAGCCCCTGGTGGTCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151722995_1151723003 20 Left 1151722995 17:75868792-75868814 CCACAAGGACCACCAGGGGCTTC No data
Right 1151723003 17:75868835-75868857 CCAGATCTGACTGTGTGGACGGG No data
1151722995_1151723001 19 Left 1151722995 17:75868792-75868814 CCACAAGGACCACCAGGGGCTTC No data
Right 1151723001 17:75868834-75868856 CCCAGATCTGACTGTGTGGACGG No data
1151722995_1151723004 21 Left 1151722995 17:75868792-75868814 CCACAAGGACCACCAGGGGCTTC No data
Right 1151723004 17:75868836-75868858 CAGATCTGACTGTGTGGACGGGG No data
1151722995_1151722999 15 Left 1151722995 17:75868792-75868814 CCACAAGGACCACCAGGGGCTTC No data
Right 1151722999 17:75868830-75868852 ATCTCCCAGATCTGACTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151722995 Original CRISPR GAAGCCCCTGGTGGTCCTTG TGG (reversed) Intergenic
No off target data available for this crispr