ID: 1151725108

View in Genome Browser
Species Human (GRCh38)
Location 17:75878876-75878898
Sequence CAGAAGGACCAGAGGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151725108_1151725116 -1 Left 1151725108 17:75878876-75878898 CCTCCATCCCTCTGGTCCTTCTG No data
Right 1151725116 17:75878898-75878920 GGGCCAGGCCAGCGCTCCGCAGG No data
1151725108_1151725118 1 Left 1151725108 17:75878876-75878898 CCTCCATCCCTCTGGTCCTTCTG No data
Right 1151725118 17:75878900-75878922 GCCAGGCCAGCGCTCCGCAGGGG No data
1151725108_1151725117 0 Left 1151725108 17:75878876-75878898 CCTCCATCCCTCTGGTCCTTCTG No data
Right 1151725117 17:75878899-75878921 GGCCAGGCCAGCGCTCCGCAGGG No data
1151725108_1151725120 5 Left 1151725108 17:75878876-75878898 CCTCCATCCCTCTGGTCCTTCTG No data
Right 1151725120 17:75878904-75878926 GGCCAGCGCTCCGCAGGGGCTGG No data
1151725108_1151725121 6 Left 1151725108 17:75878876-75878898 CCTCCATCCCTCTGGTCCTTCTG No data
Right 1151725121 17:75878905-75878927 GCCAGCGCTCCGCAGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151725108 Original CRISPR CAGAAGGACCAGAGGGATGG AGG (reversed) Intergenic
No off target data available for this crispr