ID: 1151726901

View in Genome Browser
Species Human (GRCh38)
Location 17:75890703-75890725
Sequence GAGCTGCCCAGCTTCAGCTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151726901_1151726907 -2 Left 1151726901 17:75890703-75890725 CCCAAGCTGAAGCTGGGCAGCTC 0: 1
1: 0
2: 2
3: 21
4: 199
Right 1151726907 17:75890724-75890746 TCTTGGGCACATAGGCATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 151
1151726901_1151726909 12 Left 1151726901 17:75890703-75890725 CCCAAGCTGAAGCTGGGCAGCTC 0: 1
1: 0
2: 2
3: 21
4: 199
Right 1151726909 17:75890738-75890760 GCATGGTGGCAGCTATGCCAGGG 0: 1
1: 0
2: 3
3: 18
4: 248
1151726901_1151726905 -10 Left 1151726901 17:75890703-75890725 CCCAAGCTGAAGCTGGGCAGCTC 0: 1
1: 0
2: 2
3: 21
4: 199
Right 1151726905 17:75890716-75890738 TGGGCAGCTCTTGGGCACATAGG 0: 1
1: 0
2: 2
3: 20
4: 141
1151726901_1151726908 11 Left 1151726901 17:75890703-75890725 CCCAAGCTGAAGCTGGGCAGCTC 0: 1
1: 0
2: 2
3: 21
4: 199
Right 1151726908 17:75890737-75890759 GGCATGGTGGCAGCTATGCCAGG 0: 1
1: 0
2: 3
3: 22
4: 227
1151726901_1151726906 -5 Left 1151726901 17:75890703-75890725 CCCAAGCTGAAGCTGGGCAGCTC 0: 1
1: 0
2: 2
3: 21
4: 199
Right 1151726906 17:75890721-75890743 AGCTCTTGGGCACATAGGCATGG 0: 1
1: 0
2: 2
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151726901 Original CRISPR GAGCTGCCCAGCTTCAGCTT GGG (reversed) Exonic
900560776 1:3304964-3304986 GCACTGTCCAGCTTCAGCTGGGG - Intronic
902518409 1:17002170-17002192 GAGCTCCCCACTTTCAGCTGGGG + Intronic
903156339 1:21446120-21446142 AAGCTACCCAGCTGCAGCTGGGG - Intronic
905291591 1:36925423-36925445 AAGCTGCCCAGCTTCTGGTCAGG + Intronic
905770847 1:40636985-40637007 CAGCTGCCAAGCTTCAGCGGGGG - Intronic
906513267 1:46423595-46423617 CAGCTGCCCAGCTGCAGGCTTGG + Intergenic
911466987 1:98267558-98267580 GAGCTGAGCATCTTCAGCTCTGG - Intergenic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
913600989 1:120421024-120421046 AAGCTGCCCAGCTGCAGGTGGGG - Intergenic
914191958 1:145419560-145419582 AAGCTGCCCAGCTGCAGGTGGGG + Intergenic
914589865 1:149097510-149097532 AAGCTGCCCAGCTGCAGGTGGGG + Intronic
914920070 1:151840314-151840336 AAGCAGCCCAGCTTCAGCAGAGG - Exonic
914929329 1:151916546-151916568 GAGTTGTCCAGCTTCAGCTCTGG - Intergenic
919947032 1:202327113-202327135 GAGCTGTCGAGTGTCAGCTTTGG + Intergenic
922857846 1:228790367-228790389 GAGCTGAGCAGCTCCAGCTGGGG + Intergenic
1063002311 10:1936029-1936051 GAGCTGCCCAGCATAAGCTGGGG + Intergenic
1067065198 10:43100569-43100591 GAGGTGCCCAGCTTCCGCCTGGG + Exonic
1067971875 10:50980930-50980952 GAGGTTCACAGTTTCAGCTTGGG + Intergenic
1069212409 10:65779014-65779036 CAGCCGCCCAGCTGCAGCTCTGG + Intergenic
1070567263 10:77613327-77613349 GGACTGACCAGCTTCAGCTCTGG + Intronic
1070602777 10:77877533-77877555 GAGCTGCCGGGCTGCAGGTTGGG + Intronic
1074215725 10:111381848-111381870 GAGCTACCCAGCCTCAGGTAGGG - Intergenic
1074889106 10:117720482-117720504 GAGTTGCCCAGACTCAGCCTGGG - Intergenic
1075572212 10:123554405-123554427 GAGCTGCCCAACTTGATCTCTGG + Intergenic
1076696166 10:132248419-132248441 GAGCTGGCCGCCTACAGCTTGGG + Intronic
1077375799 11:2204611-2204633 GAGCTCCCCTGCTACAGCCTAGG + Intergenic
1078303215 11:10156029-10156051 CAGCCGCCCAGCTGCAGCTCTGG + Intronic
1079131146 11:17747590-17747612 GAGCAGCCCAGCTTCAGAGTGGG - Intronic
1079623047 11:22578549-22578571 GAGGAGCCAAGCTTCAGCCTTGG - Intergenic
1080643929 11:34174578-34174600 GAGCGGCTCAGATTCAGCTGGGG + Intronic
1081773007 11:45661296-45661318 GGGCTGCCAAGCCTCAGCATTGG + Intronic
1082792715 11:57358203-57358225 GAGCAGCCCAAATTTAGCTTTGG - Intronic
1083290850 11:61689177-61689199 CAGCTGCCCCGCTGCAGTTTTGG + Intronic
1083452043 11:62752759-62752781 GACCAGCTCAGCTTCAGCTGGGG + Exonic
1083800997 11:65046188-65046210 GAGCAGCACAGCATCAGCCTGGG - Exonic
1084223073 11:67696808-67696830 GAGGTGCCCAGGTGCAGCCTGGG - Intergenic
1086947160 11:92854343-92854365 CAGCTGCCCAGCCACAGCTCTGG - Intronic
1090463783 11:126914590-126914612 GAGCTGCAAATCTTCAGCTCAGG - Intronic
1091802007 12:3330333-3330355 TAGCTGCCCATCTGCAGCTCAGG - Intergenic
1093275121 12:17116464-17116486 GCCCTGCCCTGCTTCAGCTCAGG - Intergenic
1096202576 12:49695891-49695913 GAGCTTCCCAGCATCTGCCTGGG - Intronic
1096386136 12:51196634-51196656 CCCCTGCCCAGCTTCAGCATCGG + Intronic
1096898493 12:54849989-54850011 CTGCAGACCAGCTTCAGCTTGGG + Intronic
1101330699 12:103755541-103755563 GGGCTGCACTGCTTCTGCTTGGG - Intronic
1101635914 12:106541208-106541230 AAGGTGCCCAGATACAGCTTAGG - Intronic
1101737858 12:107476342-107476364 GAGATGCTCACCTTCGGCTTTGG - Intronic
1104040833 12:125129483-125129505 GAGCTGGCCAGCCTCTGCCTTGG + Intronic
1104430655 12:128713385-128713407 GAGCTGCCCATCCTGAGCTGGGG - Intergenic
1105899880 13:24745163-24745185 GACTTTCCCAGCTTCGGCTTCGG + Intergenic
1110436963 13:75486164-75486186 GAGCAGCACAGCTTCTGCTCTGG - Intergenic
1116457261 14:45134195-45134217 GAGAGGCCCAGCTTGTGCTTTGG - Intronic
1118259609 14:64234933-64234955 GAGCTGCTCTGCTTGGGCTTGGG - Intronic
1121781969 14:96627814-96627836 GAGCTGCCCACCTGCACCTGGGG - Intergenic
1122133041 14:99617041-99617063 AAGCTCCCCAGCTTCTGCTCTGG - Intergenic
1128053762 15:64684812-64684834 TAGCTGCCCAGTTGCATCTTGGG - Exonic
1128976166 15:72155371-72155393 GAGCAGCCCAGGTTTGGCTTTGG + Intergenic
1130665984 15:85870475-85870497 CAGCTGCCCACCTGCTGCTTTGG + Intergenic
1130894570 15:88160158-88160180 GGGTTCCCCAGCTCCAGCTTTGG - Intronic
1132064591 15:98720242-98720264 GAGCAGCCCAGCTTCATGATCGG + Intronic
1132921296 16:2395880-2395902 GAGCTGGGCATCTCCAGCTTTGG + Intergenic
1133167333 16:3957606-3957628 GCTCAGCCCAGCTCCAGCTTTGG - Intronic
1138222803 16:55267268-55267290 GAGCAGCCCAGCTGCAGCCCAGG + Intergenic
1140912508 16:79467026-79467048 GATCTTTCCAGTTTCAGCTTAGG - Intergenic
1141635806 16:85313260-85313282 GACCTGCCCTGCTTCTCCTTGGG + Intergenic
1141877078 16:86833213-86833235 GGGCTGCCCAGCTCCAGGCTTGG + Intergenic
1142173731 16:88635501-88635523 AACCTGCCCAGCTGCGGCTTGGG - Intergenic
1142643329 17:1297288-1297310 GGGGTGCCCAACTTGAGCTTGGG + Intronic
1147919398 17:43906954-43906976 GACCCGCCCCGCTACAGCTTGGG + Intronic
1148393006 17:47286895-47286917 GAACTGGAAAGCTTCAGCTTCGG + Intronic
1148624164 17:49056183-49056205 GAGATGCTCAGCCTCAGCATGGG + Intergenic
1151557135 17:74852226-74852248 GTGCTGCCCAGCGCCAGGTTGGG + Exonic
1151726901 17:75890703-75890725 GAGCTGCCCAGCTTCAGCTTGGG - Exonic
1152112211 17:78363235-78363257 GAGCTGAGCTGCTGCAGCTTGGG + Intergenic
1153596685 18:6732553-6732575 GAGCAGCTCAGCTTCAGCTAGGG - Intronic
1153608056 18:6854760-6854782 CAGCTGCCCACCTGCAGCTCTGG + Intronic
1154217188 18:12423761-12423783 GAGCTGCCCAGGTACCGGTTCGG - Intronic
1156308923 18:35904958-35904980 GGGCTGCCCAGCTTCTGCTTGGG + Intergenic
1158668410 18:59453345-59453367 GATATCCCCAGCTTGAGCTTAGG - Intronic
1160552646 18:79704866-79704888 GAGCTGCACGTCTTCACCTTCGG + Exonic
1162617623 19:11814652-11814674 GAGCTGCCCAGATTAGGCTCCGG - Intronic
1167302186 19:48684502-48684524 CAGCTTGCCAGCTTCTGCTTGGG - Intergenic
1167665498 19:50820993-50821015 GAGCGGCTCAGCTGCAGCTGGGG + Intronic
926207215 2:10842333-10842355 GCCCTGCCCAGCTCCAGTTTAGG + Intergenic
926349168 2:11979949-11979971 GAGCTGCCCATGGTCTGCTTAGG - Intergenic
926939548 2:18120272-18120294 GAGCTTCCCAGTGTCAGCTCTGG - Intronic
928399600 2:30968357-30968379 GAGCTGCCCTGCTTCAGTGAGGG - Intronic
929847254 2:45542392-45542414 CAGCTGCCCAGCTACAGCTCTGG - Intronic
931776017 2:65541059-65541081 GAGTTCCCCACCTTCAACTTGGG - Intergenic
931912899 2:66921647-66921669 CAGCTGCCATGCTTCACCTTGGG - Intergenic
937555024 2:123143420-123143442 GAACTGCCCTGCTTTGGCTTGGG + Intergenic
939125375 2:138171938-138171960 AAGCGGCCCAGGTACAGCTTGGG + Intergenic
939494048 2:142907154-142907176 GAGCAGCCCACCATCATCTTGGG - Intronic
940115661 2:150205510-150205532 GAGGTGTCCAGTTTCAACTTTGG + Intergenic
940582723 2:155601430-155601452 CAGCTGCCCAGCCACAGCTTCGG - Intergenic
941479457 2:165988256-165988278 GATGTGCCTTGCTTCAGCTTGGG - Intergenic
943013015 2:182474801-182474823 GAGCTTTACAGCATCAGCTTGGG - Intronic
943226417 2:185184967-185184989 CAGCTGCCCAGTTGCAGCTCTGG + Intergenic
945246373 2:207720990-207721012 GAGCTGCCCTGCCTCATCTGAGG - Intronic
947267866 2:228302745-228302767 GCCCTTCCCAGCTTGAGCTTAGG + Intergenic
948805436 2:240451890-240451912 AAGCTGCCCAGATCCTGCTTGGG - Intronic
1168763909 20:368896-368918 GGGAAGCCCAGGTTCAGCTTTGG - Intronic
1174485926 20:50861272-50861294 GGGCTGACCAGCTGCAGCATCGG + Intronic
1175213751 20:57378516-57378538 GTCCTGCCCAGCATCAGCGTGGG + Exonic
1176843187 21:13856699-13856721 AAGATGCACAGCTACAGCTTGGG - Intergenic
1176845875 21:13876045-13876067 AAGATGCACAGCTACAGCTTGGG - Intergenic
1176848610 21:13895600-13895622 AAGATGCACAGCTACAGCTTGGG - Intergenic
1177890586 21:26799520-26799542 GAGCTGCCACGCTTAACCTTCGG - Intergenic
1179311544 21:40200261-40200283 GAGTTGCCAAGTTTCAGGTTGGG - Intronic
1179507995 21:41854577-41854599 GAGCCGGCCTGCTTCAGCATGGG + Exonic
1179615331 21:42579765-42579787 GAGCTGCCCAGGGTCAGCTACGG + Exonic
1180787132 22:18553433-18553455 CAGCTGGCCAGCTGCAGCCTAGG - Intergenic
1180905013 22:19404258-19404280 GAGTTGACCACCTTCAGCTGGGG - Intronic
1181141633 22:20809770-20809792 GAACTGCCCAGATGCAACTTGGG + Intronic
1181234608 22:21441873-21441895 CAGCTGGCCAGCTGCAGCCTAGG + Intronic
1181244041 22:21492958-21492980 CAGCTGGCCAGCTGCAGCCTAGG - Intergenic
1181860398 22:25813498-25813520 GAGCTGACCACCCTCAACTTTGG - Intronic
1182081777 22:27534396-27534418 GAGCTGCTCTGCTCCAGCCTAGG - Intergenic
1183107876 22:35627734-35627756 GAGCTCCCCAGCTTCCCCTAAGG - Intronic
1185266468 22:49906770-49906792 GAGCTGGCCAGCCTCAGCCCTGG + Intronic
1185338298 22:50280486-50280508 CACCTGCGCAGCATCAGCTTGGG + Exonic
950021809 3:9792789-9792811 GTACAGCCCAGCTTCAGATTGGG - Intronic
950094479 3:10320941-10320963 GAGCTGAACGGCTCCAGCTTGGG + Intronic
950521761 3:13501697-13501719 GAGCTGTGCAGCTCCAGCTGTGG - Intronic
953778431 3:45843090-45843112 GGTATGCCCAACTTCAGCTTTGG + Intronic
953871747 3:46633035-46633057 GAGCTGCCCCTCTCCAGCCTTGG + Intergenic
954106508 3:48412439-48412461 GACCTGCGCAGCATCAGCTTGGG + Exonic
954145401 3:48631952-48631974 GACCTGCACAGCTGCAGCTGTGG + Exonic
956867445 3:73383993-73384015 GCGCTGCCCAGCTTCTGGCTGGG + Exonic
960150639 3:114245589-114245611 GAGGTGCCCAGGTACAGCTTGGG + Intergenic
960690454 3:120341767-120341789 GAGCTCCCCAGGTGCAGCTGTGG + Intronic
961027144 3:123568330-123568352 GAGCTGTCCAGAGGCAGCTTGGG - Intronic
962196096 3:133364978-133365000 GAGCTGCCTTGCTTCAATTTGGG - Intronic
962270390 3:133973929-133973951 GGGCTGCCCAGTGTCAGCTGGGG + Intronic
962763935 3:138543542-138543564 CATCTGCCCAGCCACAGCTTGGG - Intronic
965693856 3:171386050-171386072 ATGGAGCCCAGCTTCAGCTTTGG - Intronic
967979410 3:195056663-195056685 GAGCTCCCCAGCCTCAGATACGG - Intergenic
968583302 4:1404737-1404759 GAGCTGCCCAGCGGCAGCCGCGG + Intronic
969099351 4:4757191-4757213 CAGCTGCCCAGATTCAACCTGGG - Intergenic
971196879 4:24478266-24478288 GAGGTGTCTAGCTTCAGGTTGGG - Intergenic
973613962 4:52660705-52660727 GGGCTGCCCAGCCTCAGGCTGGG - Intergenic
974614467 4:64264478-64264500 TAGCTGCCAAGCTACAGCATTGG + Intergenic
975715271 4:77199485-77199507 GCCCAGCCCAGCTTCAGCCTGGG - Intronic
976721999 4:88178123-88178145 GAGCTGCACTGCCTGAGCTTGGG - Intronic
976821685 4:89214115-89214137 GGGCTGCCAGGCTTCAGGTTTGG - Intergenic
980448102 4:132938158-132938180 GAAGTGTGCAGCTTCAGCTTGGG - Intergenic
981286093 4:143020564-143020586 GTGGTGCACAGCTTCAGCTCAGG + Intergenic
981647497 4:147017234-147017256 GAGCTGTCCAGATTGAGCCTTGG - Intergenic
981718254 4:147773463-147773485 CAGCTGCCCAGAGACAGCTTGGG + Intronic
983412889 4:167421310-167421332 GCCCTTCCCAGCTTGAGCTTAGG - Intergenic
989261222 5:39422142-39422164 CAGCGGCACAGCTTCAACTTTGG + Intronic
990417582 5:55600979-55601001 GGGCTGGCCAGCATCATCTTTGG - Intergenic
994247034 5:97489508-97489530 CAGCTGCCCAGCCACAGCTCTGG - Intergenic
995145917 5:108787078-108787100 CAGCTGCCCAGCTGCAGCTTGGG + Intronic
996550932 5:124729263-124729285 GAGCTTCACAGCTGCAGTTTGGG + Intronic
1001156866 5:169280119-169280141 AAGCTGCCCAGCTTCCGCTGGGG + Intronic
1001702721 5:173719006-173719028 GAACAGCCCAGCTTCGGCTTGGG - Intergenic
1002081038 5:176737639-176737661 GAGCCGTCCAGCTTCAGGTACGG + Intergenic
1002640654 5:180629124-180629146 GAGCTGCCCAGCTCCTGCACCGG - Intronic
1002688955 5:181037268-181037290 GAGCTCCCCGGGTGCAGCTTCGG + Intergenic
1004306984 6:14509868-14509890 GGGCTGCCCAGGTTTAGCTGGGG + Intergenic
1005493966 6:26372811-26372833 GAGCTGAGCAGCTAAAGCTTGGG + Intronic
1005497385 6:26399942-26399964 GAGGTGCTAAGCTTCAGATTAGG - Intergenic
1005502167 6:26438440-26438462 GAGGTGCTAAGCTTCAGATTAGG - Intergenic
1006868853 6:37232024-37232046 CAGCTGCCCAGTTTCAGGTAAGG - Intronic
1007593241 6:43036062-43036084 GAGCTGCCCTGCTTCAGCAGGGG + Intergenic
1008069510 6:47085428-47085450 GAGCTGCCCGACTGCAGCATAGG - Intergenic
1008405815 6:51117506-51117528 GAGCTAGCCAGCTTCAACTTGGG - Intergenic
1009684178 6:66935733-66935755 CAGCTGCCCAGCTGCAGCTCCGG + Intergenic
1010292342 6:74152028-74152050 GAGCTTCCAAGTTTCAGCTAAGG + Intergenic
1012051391 6:94349597-94349619 GAGGTTCCCAGCTGCAGATTGGG + Intergenic
1012357695 6:98336586-98336608 GGGCTGGCAAGCTTCAGGTTAGG - Intergenic
1015378517 6:132538306-132538328 CAGCTCCACAGCCTCAGCTTGGG - Exonic
1019642107 7:2109070-2109092 GAGCTGCTCACCCTCAGCTCTGG + Intronic
1019820094 7:3236206-3236228 AAGCTGTCCAGCTTCTGCTTGGG + Intergenic
1021343225 7:19489553-19489575 CAGCTGCCCAGCCACAGCTGTGG - Intergenic
1022242934 7:28530387-28530409 GAGCTGCTCAGGGGCAGCTTGGG + Intronic
1022980662 7:35602040-35602062 GAGCTACCCAACTTCAGGTAGGG - Intergenic
1023264867 7:38394023-38394045 GAGCTCCTCTGCTTCAGGTTGGG + Exonic
1023609178 7:41956876-41956898 GAGCTGGCCAGCCTCACCCTGGG - Intergenic
1027924738 7:84446940-84446962 CAGCTGCCCAGCCACAGCTGGGG + Intronic
1028136658 7:87230174-87230196 CAGCTGCCCAGCTGCAGCTGTGG + Intergenic
1028146997 7:87329709-87329731 GAGCTGCCCACCACCATCTTGGG - Intergenic
1029422230 7:100477632-100477654 GAGCTGGCCAGCCTCGGCCTGGG - Exonic
1030243700 7:107359114-107359136 CAGCTGCCCAGCCACAGCTGTGG + Intronic
1031026697 7:116686877-116686899 GAGCTGCTCAGGTGCAGCTGAGG - Intronic
1031472060 7:122177543-122177565 GAGCTGCCCACCACCATCTTGGG + Intergenic
1034853931 7:154522769-154522791 GAGCTTCCCAGCGTCTGCTCAGG + Intronic
1036167006 8:6444869-6444891 GACCTGCACAGCTGCAGCCTCGG - Exonic
1036559077 8:9886155-9886177 GAGCTGCCAAGCTTGACCTTGGG - Intergenic
1036755163 8:11466694-11466716 GCGCTGCCCGGCCTCAGCTCAGG + Exonic
1040743185 8:50605189-50605211 GAGCTGCACAGCCTGAGGTTAGG + Intronic
1043881894 8:85553546-85553568 GAGCTGCTCAGCTTCTGGTGAGG + Intergenic
1044754580 8:95447833-95447855 GAGCTGCCCAGCTTCTGGTGAGG - Intergenic
1046988817 8:120425318-120425340 CAGCTGCTCAGCTTCACCTGAGG - Exonic
1047114968 8:121831254-121831276 CAGCTGACCAGCATCAGCGTGGG + Intergenic
1047785875 8:128153434-128153456 GGGCTGTCCAGCTGCAGCCTGGG + Intergenic
1054863589 9:69977268-69977290 AAGGTGCCCAGCTCCATCTTGGG - Intergenic
1057047791 9:91899293-91899315 CAACTGCCCAGCCTCAGCTGTGG - Intronic
1057502827 9:95609494-95609516 GAGCTGGCCAGCTTAGGTTTGGG - Intergenic
1058931807 9:109727798-109727820 GAGATGCCCAGCTTCATGCTTGG + Intronic
1059769754 9:117414496-117414518 GAGCTGCCCTTCTTCACCCTGGG - Exonic
1059772237 9:117438103-117438125 GAGCTTCCCATCTGAAGCTTGGG + Intergenic
1060618730 9:125043933-125043955 CAGCTACCCAGCTGCAGCTTTGG + Intronic
1060824222 9:126678447-126678469 CAAATGCCCAGCTTCAGCTGGGG - Intronic
1061790898 9:133058291-133058313 CAGCTGCCCAGCTCCACCTCCGG - Exonic
1062589360 9:137266551-137266573 GAGCTGCCCACCTTCCTTTTGGG + Intronic
1186521893 X:10213632-10213654 GAGCTGCCCGGCTTGCACTTTGG + Intronic
1188158903 X:26776343-26776365 GAGGTGCCAAGGTACAGCTTGGG + Intergenic
1188881663 X:35498584-35498606 GAGCTACCTAGCTTCAGGTAGGG - Intergenic
1190881678 X:54496113-54496135 GTCCTCCCCAGCTTCAGCCTGGG + Exonic
1191664130 X:63680949-63680971 GAGCTGCCCAACTGCTGCTGTGG + Intronic
1192060143 X:67816380-67816402 GAGCTGTGCAGCCTGAGCTTAGG - Intergenic
1193652015 X:84148079-84148101 GAGCTGCCCAGCATCAGGACCGG + Exonic
1194182043 X:90723606-90723628 GAGCTGGCAAACTCCAGCTTGGG + Intergenic
1196099096 X:111829623-111829645 AAGGTGCCCAGGTACAGCTTGGG + Intronic
1196258087 X:113546741-113546763 GAGCTGCCCACCACCATCTTGGG - Intergenic
1196258098 X:113546785-113546807 GAGCTGCCCACCGCCATCTTGGG - Intergenic
1196258108 X:113546829-113546851 GAGCTGCCCACCACCATCTTGGG - Intergenic
1198524235 X:137484286-137484308 GAGCTGCCTGTCATCAGCTTTGG - Intergenic
1199188092 X:144939858-144939880 CAGCTGCCCTGCTACAGCTGTGG - Intergenic
1199677641 X:150201223-150201245 GAGCTGCCCATCCTCAGCTGTGG - Intergenic
1200215955 X:154368387-154368409 GAGCTGCCCATCTGCAGGCTGGG - Intronic
1200528675 Y:4305516-4305538 GAGCTGGCAAACTCCAGCTTGGG + Intergenic