ID: 1151727222

View in Genome Browser
Species Human (GRCh38)
Location 17:75892144-75892166
Sequence CAGTGGCCCAAGAGGCCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 1, 2: 7, 3: 22, 4: 317}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151727211_1151727222 12 Left 1151727211 17:75892109-75892131 CCCAGCTGTTGGTCTTCATCCCA 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1151727222 17:75892144-75892166 CAGTGGCCCAAGAGGCCCTGGGG 0: 1
1: 1
2: 7
3: 22
4: 317
1151727218_1151727222 -8 Left 1151727218 17:75892129-75892151 CCACTGCAGAGGGGTCAGTGGCC 0: 1
1: 0
2: 2
3: 27
4: 239
Right 1151727222 17:75892144-75892166 CAGTGGCCCAAGAGGCCCTGGGG 0: 1
1: 1
2: 7
3: 22
4: 317
1151727217_1151727222 -7 Left 1151727217 17:75892128-75892150 CCCACTGCAGAGGGGTCAGTGGC 0: 1
1: 0
2: 0
3: 19
4: 160
Right 1151727222 17:75892144-75892166 CAGTGGCCCAAGAGGCCCTGGGG 0: 1
1: 1
2: 7
3: 22
4: 317
1151727212_1151727222 11 Left 1151727212 17:75892110-75892132 CCAGCTGTTGGTCTTCATCCCAC 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1151727222 17:75892144-75892166 CAGTGGCCCAAGAGGCCCTGGGG 0: 1
1: 1
2: 7
3: 22
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151727222 Original CRISPR CAGTGGCCCAAGAGGCCCTG GGG Exonic
900602660 1:3509707-3509729 CAAGGGCCCAAGAGCCTCTGAGG + Intronic
901497224 1:9629096-9629118 CAGTGGCCCGAGACCCCCAGGGG - Intergenic
901705759 1:11071764-11071786 CAGCGAGCCCAGAGGCCCTGGGG - Intronic
902125729 1:14209337-14209359 GACTGGCCCAAGAGGCCTGGAGG + Intergenic
902184885 1:14717708-14717730 CTGAGGCCCAAGAGGCCCCTGGG + Intronic
903030315 1:20459310-20459332 CATTGGCCCCAGAAGCCCTGGGG - Intergenic
903561782 1:24233508-24233530 CAGTGGCCAAAGAGGCCTTGGGG + Intergenic
903831530 1:26178129-26178151 CAGTAGCCCAAGAGGCCTCTAGG + Intronic
904013833 1:27405654-27405676 CAGTGAGCCGAGAGGCCCTCTGG - Exonic
904597379 1:31655395-31655417 CGGTGGCCCAACAGGCCCCATGG + Exonic
905358525 1:37402098-37402120 CAGTTGCCCAAAAGGGCCAGAGG + Intergenic
906691613 1:47796447-47796469 CAGTGGCTCTAGAAGCCATGTGG - Intronic
908014109 1:59814478-59814500 CAGTGGCCGAAGAGGCAGAGGGG - Intergenic
908516200 1:64895029-64895051 CAGTGGCTCCAGAGGCGCTGTGG - Intronic
908551178 1:65210248-65210270 CAATGGTCACAGAGGCCCTGGGG - Intronic
908682881 1:66682133-66682155 AGGAGGCCCAGGAGGCCCTGGGG - Exonic
912258707 1:108087136-108087158 CAGTGGCCCCAGGATCCCTGGGG - Intergenic
912259876 1:108099786-108099808 CAGAGGCACAAGATGGCCTGCGG + Intergenic
912552539 1:110493486-110493508 CAGTGAGCCCAGAGGCCATGAGG - Intergenic
913960931 1:143337722-143337744 CAGAGGCACAGGAGGCCATGGGG + Intergenic
914055284 1:144163294-144163316 CAGAGGCACAGGAGGCCATGGGG + Intergenic
914123861 1:144803067-144803089 CAGAGGCACAGGAGGCCATGGGG - Intergenic
914490345 1:148147336-148147358 GACTGGCCCATGAGGCCCTGTGG + Intronic
915245396 1:154552653-154552675 AAGGGGCCCAAGAGGTTCTGGGG - Intronic
915841854 1:159219439-159219461 CAGGGGCTCAAAAGGCCCAGAGG + Intergenic
916271855 1:162952009-162952031 CAGTGGCTGAAGTGGCCATGTGG + Intergenic
917351754 1:174085240-174085262 CAGGGGAACAAGAGGCACTGGGG - Intergenic
919702055 1:200641008-200641030 CTGTGGCCCTAGAGCCTCTGAGG + Intronic
919769406 1:201147699-201147721 CATTGGCCCTAGGGGCTCTGTGG - Intronic
920174359 1:204090882-204090904 CAGAGGCTGAGGAGGCCCTGTGG + Intronic
920694344 1:208170481-208170503 CAGGGGAGCAGGAGGCCCTGTGG + Intronic
921390192 1:214607878-214607900 GCCTGGCCCATGAGGCCCTGTGG - Intronic
922706298 1:227792525-227792547 CAGAGGCCTCAGAGGTCCTGTGG + Intergenic
922724326 1:227915409-227915431 AGGTGGCCCAGGAGGCCCCGGGG - Intergenic
923009214 1:230074898-230074920 CACTGCCTCCAGAGGCCCTGAGG - Intronic
923620534 1:235575729-235575751 CTGTGGCTCATGAGGCTCTGGGG - Intronic
924822320 1:247505163-247505185 CAGTGGCCCAGCAGGGCCTTGGG + Intergenic
1063760258 10:9066941-9066963 CTGTGGCCTATCAGGCCCTGCGG - Intergenic
1064140811 10:12788609-12788631 CAGTGGCCAAACAGGCACAGAGG - Intronic
1069737995 10:70670132-70670154 CAGAGTCCCCAGAGTCCCTGGGG + Intergenic
1071299489 10:84245536-84245558 CAGTCCCCCAAAAGGCTCTGGGG + Intronic
1071597770 10:86940660-86940682 CTATGGCCCAAGAGGCAATGTGG - Intronic
1072438568 10:95435055-95435077 CCTTCTCCCAAGAGGCCCTGTGG - Intronic
1073106764 10:101036679-101036701 CAGTGGCCCTAAGGGCCATGGGG - Intronic
1073119528 10:101113160-101113182 CAGTGGCCACAGGCGCCCTGGGG - Intronic
1073509471 10:104034282-104034304 CTGCGGCCCAGGAGGGCCTGGGG + Exonic
1073509560 10:104034700-104034722 CGGGGGCCCTCGAGGCCCTGGGG + Exonic
1073955214 10:108862803-108862825 CAGAGGACAAAGAGGCCCTGTGG - Intergenic
1074460181 10:113629601-113629623 CAGTGGGCCAAGAAGGCCTATGG - Exonic
1075511894 10:123079210-123079232 ATGTTGCCCAGGAGGCCCTGTGG + Intergenic
1075747736 10:124739639-124739661 CAGATGCCCAAGAGGCAATGTGG + Intronic
1077273285 11:1691821-1691843 CAGTGGCTGCAGGGGCCCTGGGG - Intergenic
1077407029 11:2387260-2387282 CAGTGGCCCCACAGCTCCTGTGG + Intronic
1079010754 11:16826307-16826329 CACTGGCCCAAGAGGCCAGCAGG - Exonic
1083327154 11:61878618-61878640 CAGTGGGCGGAGAAGCCCTGTGG + Exonic
1083609227 11:63997284-63997306 CAGTGGGCCCACAGGGCCTGGGG + Intronic
1083709860 11:64541272-64541294 CAGTCTCCCAAAAGGCTCTGGGG + Intergenic
1084588422 11:70076958-70076980 CTGAGGCCCAGGAGGCTCTGAGG + Intergenic
1084816129 11:71648090-71648112 CAGGGCCCTCAGAGGCCCTGGGG - Intergenic
1084939996 11:72607341-72607363 CAGTGGCCACAGAGGCTCTCGGG + Intronic
1085309359 11:75507063-75507085 CACTGGCGCAAGACTCCCTGGGG + Intronic
1087897215 11:103599874-103599896 CAATGGCCCAAGGGGGCATGTGG - Intergenic
1089124793 11:116169308-116169330 CTGTGGCCCAGGGGGCCTTGGGG - Intergenic
1089397582 11:118146013-118146035 CAGTGGCAGAAGACACCCTGGGG + Intronic
1089556738 11:119319356-119319378 CAGGGCCAGAAGAGGCCCTGGGG + Intronic
1089610590 11:119666507-119666529 CACGGGCCAAAGAGGCCCTAAGG + Intronic
1090853698 11:130593351-130593373 CAGCTCCCAAAGAGGCCCTGTGG + Intergenic
1091169426 11:133507149-133507171 CTGAGGACCAAGAGACCCTGTGG + Intronic
1091227034 11:133963730-133963752 CAGTGGCTCAAGAAGCTGTGAGG + Intergenic
1092228362 12:6763732-6763754 CGTTGGCCCCAGAGGCTCTGAGG + Intronic
1096412551 12:51387834-51387856 GACTGGCCCAAGAGGCCTTCGGG - Intronic
1096977338 12:55707158-55707180 CAGGGGAGCCAGAGGCCCTGGGG + Intronic
1101999055 12:109545319-109545341 CTGGGGCACAGGAGGCCCTGTGG - Intergenic
1102025283 12:109711150-109711172 CAGGGGTCCGACAGGCCCTGAGG - Intergenic
1103941060 12:124501474-124501496 CAGAGCCCCCAGAGGCCGTGGGG - Intronic
1103983976 12:124755074-124755096 AAGTGGCCCAAAAGGCCCTGGGG + Intergenic
1104584248 12:130035141-130035163 CTGTGGACCAGGAGCCCCTGGGG + Intergenic
1104631346 12:130405475-130405497 CAGGGTCCTAAGTGGCCCTGTGG + Intronic
1104733767 12:131123450-131123472 CAATGTCCCAAGAGGGCATGAGG - Intronic
1104933610 12:132353154-132353176 CGGTGGCTCAGGAGGCTCTGAGG + Intergenic
1104955869 12:132465549-132465571 CAGGTGGCCGAGAGGCCCTGGGG - Intergenic
1105026638 12:132853465-132853487 CAGGAGCCCCACAGGCCCTGGGG - Exonic
1106477271 13:30109269-30109291 TAGTGGCCCAAGAGGCCAGAAGG + Intergenic
1107376729 13:39811836-39811858 CAGTGGCCCTAGAGGCACAGTGG + Intergenic
1108279175 13:48843861-48843883 CAGAGACCCAAAAGGCCATGGGG + Intergenic
1108570414 13:51744035-51744057 CAGTGGGCCAAGGATCCCTGAGG + Intronic
1108583720 13:51849634-51849656 CAGCGGTCGCAGAGGCCCTGTGG + Intergenic
1109602018 13:64643647-64643669 CACAGCCCCAAGAGGTCCTGAGG - Intergenic
1111146480 13:84187818-84187840 CAATGGCCCAACACTCCCTGTGG + Intergenic
1112122697 13:96430808-96430830 CACTGGCAAAAGAGTCCCTGTGG - Intronic
1112185387 13:97123570-97123592 CAGTTGACCGGGAGGCCCTGAGG + Intergenic
1113120164 13:106917303-106917325 CAGTGGCCGCAGCGGCCATGGGG + Intergenic
1113378252 13:109783403-109783425 CGCTGGCCCAAGAAGCCCTCCGG + Exonic
1113434844 13:110282984-110283006 CAGGTGCCCCTGAGGCCCTGGGG + Intronic
1114259414 14:21025976-21025998 CTGGGACCCAAGAGACCCTGTGG + Intronic
1114493512 14:23117807-23117829 CAGTGGCCAAAGGGGCCTGGAGG + Exonic
1118621433 14:67618036-67618058 CAGTAGCACAGGAAGCCCTGAGG + Intergenic
1119227544 14:72955722-72955744 CACTGGGCCACGAGACCCTGTGG - Intronic
1121114946 14:91336932-91336954 CGGTGGCCTAAGAGGCCTTCTGG + Intronic
1121271596 14:92641520-92641542 CAGCTGCCCAGGACGCCCTGAGG + Intronic
1121429929 14:93879388-93879410 CAGGGGCCACAGAAGCCCTGGGG - Intergenic
1121539065 14:94711555-94711577 CTGTGGCACAAGCAGCCCTGAGG - Intergenic
1122860776 14:104581451-104581473 CAGTGGCCTCAGCGGCCCTGAGG - Intronic
1122863799 14:104594539-104594561 CAGTGGCCCGTGAGGGCCGGAGG - Intronic
1122891543 14:104734361-104734383 CACTGGCACAAGAGGCCCTTGGG + Intronic
1123627934 15:22240037-22240059 CAATGGGCCAACGGGCCCTGAGG - Intergenic
1124291626 15:28457171-28457193 GCCTGGCCCATGAGGCCCTGTGG - Intergenic
1125676253 15:41503977-41503999 CTGAGCCCCAAGGGGCCCTGAGG - Exonic
1127607229 15:60598829-60598851 CATTGGCCTAAGAGGCCCTGTGG + Intronic
1128468663 15:67933811-67933833 CAGTTGCCCAGGAGGCCATCTGG - Intergenic
1128496484 15:68201264-68201286 CAGGGGCCAAAAAGGCCCAGGGG + Intronic
1128530523 15:68442208-68442230 CAGTGGCCCAAGATGCAGAGCGG - Intergenic
1128742800 15:70095704-70095726 AAGTGGCTCTAGAGGCCCTTGGG - Intronic
1129154316 15:73708351-73708373 CATTCCCCCCAGAGGCCCTGTGG + Exonic
1129709424 15:77812966-77812988 CAGTGGCCACAGAGGCCCCAAGG + Intronic
1129866373 15:78911754-78911776 CTGTTTCCCAGGAGGCCCTGTGG + Intergenic
1130991740 15:88879742-88879764 GAGAGGCCCTAGAGGCCGTGGGG + Intronic
1131025744 15:89140045-89140067 CAGTGGCTGAAGAGTCCCTTTGG + Intronic
1131329521 15:91484255-91484277 CAGTGGCCCAAGAGGCACAGAGG + Intergenic
1132107748 15:99075928-99075950 CTGTGAGCCATGAGGCCCTGCGG - Intergenic
1132581635 16:687400-687422 CAGTGGCCAACCAGCCCCTGTGG + Exonic
1132794188 16:1710972-1710994 CAGAGGCCGAAGTGGCCCGGAGG + Intronic
1133103680 16:3493906-3493928 CTCAGGCCCAAGAGGTCCTGGGG - Exonic
1134634984 16:15785389-15785411 CAATGGCCCCAGAGGCTGTGTGG - Intronic
1137582875 16:49644760-49644782 CCTGGGCACAAGAGGCCCTGAGG - Intronic
1137948163 16:52755863-52755885 CAGTGGACCAGGTGGGCCTGAGG - Intergenic
1138267024 16:55666911-55666933 CAGTGGCCCAAGGGAACGTGGGG - Intronic
1141217624 16:82039807-82039829 CAGTGGTCCATGAAGCCCTGAGG - Intronic
1141913156 16:87074830-87074852 AGATGGCCCAAGAGGCCCTTTGG + Intergenic
1142564423 17:830523-830545 CTGAGGCCCAAGAGCCCGTGTGG + Intronic
1142869298 17:2809846-2809868 CAGGGGCCCAAGCAGCCCTCAGG + Intronic
1143026782 17:3945653-3945675 GAGTGACCCAGCAGGCCCTGTGG - Intronic
1143107686 17:4537694-4537716 CCTTGGCCCCAGGGGCCCTGCGG - Exonic
1143576681 17:7797944-7797966 CCCTGGCCCCAGATGCCCTGTGG + Intronic
1144380880 17:14696827-14696849 CAGTGTCCCAAGAGAGCTTGGGG + Intergenic
1145190938 17:20841939-20841961 GCCTGGCCCATGAGGCCCTGTGG + Intronic
1145398594 17:22514337-22514359 CTGTGGCCCAGCAGGACCTGGGG - Intergenic
1146125450 17:30227827-30227849 AACTGGCCCAAATGGCCCTGAGG - Intronic
1146352979 17:32111466-32111488 CCGTGGCCCAGGAGGCCCCTGGG + Intergenic
1146610313 17:34299153-34299175 CTGTGGCACAAGAGATCCTGTGG - Intergenic
1147549387 17:41428705-41428727 CTGTGGCTCCAGCGGCCCTGAGG + Intergenic
1148436209 17:47687865-47687887 CAGTGGCCAAAAAGGCCATTAGG + Intergenic
1148478146 17:47942363-47942385 GGGTGGCCCCAGAAGCCCTGAGG - Intronic
1148562973 17:48616727-48616749 CAGTGGCTCAAAAGGTCTTGGGG - Intronic
1148800439 17:50221666-50221688 CAGAGGCTCATGAGGCCCTCAGG - Intergenic
1150617559 17:66784079-66784101 ACATGGCCCAAGAGGGCCTGTGG - Intronic
1151216867 17:72583065-72583087 CAGTGGCCACAGATTCCCTGAGG + Intergenic
1151238550 17:72739546-72739568 CAGTGGCCCAGGAGTCACAGTGG - Intronic
1151702751 17:75752168-75752190 CATGGGCCCAATAGGTCCTGGGG - Exonic
1151727222 17:75892144-75892166 CAGTGGCCCAAGAGGCCCTGGGG + Exonic
1151727504 17:75893284-75893306 CAGTGGCCCAGGAGGCCCTGGGG + Intronic
1151757463 17:76082967-76082989 CCCTGGGCCAAGAGGCACTGAGG + Exonic
1152557854 17:81063469-81063491 TCGAGGCCCAAGGGGCCCTGAGG + Intronic
1152711420 17:81872015-81872037 CAGAGGCCCTAGTGTCCCTGAGG + Intergenic
1152848260 17:82615829-82615851 CCGTGGCCCAGGAGGCCCCTGGG + Exonic
1152887397 17:82860470-82860492 CAGTGGCTCAGGAGATCCTGAGG + Intronic
1156475644 18:37403808-37403830 CACTAGCCCAGGAGGCCCAGTGG - Intronic
1157211573 18:45747169-45747191 CGGTGGCCCAAGTGGCTGTGTGG + Intronic
1157444953 18:47737722-47737744 AAGTGGCCCCAGAGGCCTTGTGG + Intergenic
1157544901 18:48540279-48540301 GAGTGACCCGAGAGGCCGTGGGG + Intronic
1157599466 18:48885283-48885305 CGGTGGCCCCCAAGGCCCTGTGG - Intergenic
1159141577 18:64402056-64402078 CCATGGCCCACGAGGCCCTAAGG + Intergenic
1160075064 18:75666993-75667015 GAGTTCCCCAAGAAGCCCTGGGG - Intergenic
1160425023 18:78773581-78773603 CAGGGGCCCACGAGGCTGTGGGG - Intergenic
1160762263 19:791672-791694 CCGTCCCCTAAGAGGCCCTGTGG - Intergenic
1160995265 19:1879484-1879506 GACTGGCCCATGAGGCCCTGTGG - Intronic
1161309381 19:3585608-3585630 CAGCGGCCCGGGAGGCCCGGGGG + Exonic
1161356765 19:3823387-3823409 CTGTGGCTCAGGAGGCCCTGAGG + Exonic
1161605762 19:5214065-5214087 AAGTGGGCAAAGAGGACCTGGGG + Intronic
1162321484 19:9973497-9973519 AAGTGGCCCAAGATGCCCAGGGG + Intronic
1162725434 19:12687670-12687692 CCCTGCCCCAGGAGGCCCTGTGG - Intergenic
1163646622 19:18493275-18493297 CAGTGGCCCACCAGGCCAGGGGG + Intronic
1164618660 19:29681157-29681179 CTGTGCCCCCAGAGGCCCGGTGG + Intergenic
1165178731 19:33949277-33949299 ACGGGGCCCATGAGGCCCTGAGG + Intergenic
1166855891 19:45782476-45782498 AAGTGGCCAGAGAGGCCCAGGGG - Intronic
1167101617 19:47407327-47407349 GAGTGGCCCAGGAGGGCCCGCGG - Intronic
1167612134 19:50512706-50512728 TTGTGGCCCGAGGGGCCCTGTGG - Exonic
1168393913 19:56032484-56032506 CGGTGGCTTTAGAGGCCCTGAGG - Intronic
1168410816 19:56139261-56139283 CAGTGTCTAAAGAGGCCATGGGG + Intronic
1168467861 19:56618683-56618705 CAGTGGATGCAGAGGCCCTGAGG + Intronic
1202694767 1_KI270712v1_random:115971-115993 CAGAGGCACAGGAGGCCATGGGG + Intergenic
924971162 2:128198-128220 CAGGGGCAGCAGAGGCCCTGGGG + Intergenic
925078470 2:1040231-1040253 CAGTGACACCAGAGTCCCTGTGG + Intronic
925169161 2:1740472-1740494 CAGAGCCCCCAGAGGGCCTGGGG + Intronic
925360649 2:3278160-3278182 CACAGGCCCCAGAGGCCCAGGGG + Intronic
926018594 2:9475020-9475042 CTGTGTCCCAGGAGGCCCCGCGG + Intronic
926203430 2:10817714-10817736 CAGTGGCCCCAAGGTCCCTGTGG - Intronic
926753100 2:16214889-16214911 CACTGGACCAAGAGTCCATGTGG + Intergenic
927937614 2:27084436-27084458 CTGCAGCCCAGGAGGCCCTGGGG - Exonic
928114211 2:28535377-28535399 CACTTACCCCAGAGGCCCTGTGG + Intronic
928396681 2:30947990-30948012 CAGTGGCCCAAGAGCCCCAGAGG - Intronic
928403530 2:30996589-30996611 CATGGGCCCAAGAGGGCCCGAGG + Intronic
933162413 2:79040107-79040129 CAGAGGCCCAGGAGCCCATGAGG - Intergenic
933899537 2:86839760-86839782 CAGTGGGACAAGAGGCCTTGTGG + Intronic
934275939 2:91573020-91573042 CAGAGGCACAGGAGGCCATGGGG + Intergenic
935781021 2:106509466-106509488 CAGTGGGACAAGGGGCCTTGTGG - Intergenic
936072628 2:109381475-109381497 GGATGGCCCAAGATGCCCTGCGG - Intronic
936075886 2:109401633-109401655 CTGTGTCCCAAGAGGGCCAGGGG + Intronic
939956860 2:148534492-148534514 CGGTGCCCCAGGAGGCCATGTGG + Intergenic
941477981 2:165971711-165971733 CAGTAGCCAAGGAAGCCCTGAGG + Intergenic
944882085 2:204023629-204023651 CTGTGGGCTAAGAGACCCTGGGG - Intergenic
946163323 2:217848854-217848876 CAGTGGCACTGGAGGCCCCGGGG + Exonic
946223023 2:218245456-218245478 CTGTGGCTAAAGAGGACCTGTGG - Exonic
948080748 2:235203277-235203299 CTGTGGCCCAGGTGGACCTGGGG - Intergenic
948353610 2:237360307-237360329 CAGGGGCCCAAGAGGCTCCCTGG - Intronic
948484243 2:238270592-238270614 CTGGGGCACAGGAGGCCCTGAGG + Intronic
948769943 2:240246578-240246600 CAGCAGCCAAAGAGACCCTGTGG + Intergenic
948831619 2:240601121-240601143 CAGTGGCTCCTGAGGGCCTGGGG - Intronic
948942605 2:241203781-241203803 CACTGGCCCATGAGGCCCTGGGG + Intronic
1169267196 20:4174011-4174033 CAGTGGACCAAGAGGACCCATGG - Intronic
1169367153 20:5001186-5001208 CCGGGGCCCAAGATGCCCGGCGG - Intronic
1171236282 20:23527719-23527741 CAAAGGCCCAAGAGGCCCTGGGG - Intergenic
1172304685 20:33872423-33872445 GAGATGCCCAGGAGGCCCTGTGG + Intergenic
1172440760 20:34964810-34964832 CAGTGGCCTAAGTGACCCTTAGG + Intergenic
1172485760 20:35297008-35297030 CAGTGGCACAATAGCCCATGGGG - Intergenic
1173083644 20:39893545-39893567 CAGAGGCCAAAGTGGGCCTGAGG - Intergenic
1173903098 20:46605357-46605379 CAGTGGCCCAAGAGACCACATGG + Intronic
1173954206 20:47018186-47018208 CTGTGGCCTCAGAAGCCCTGAGG - Intronic
1174090098 20:48039814-48039836 CAGCGGCCCATGAGGCTTTGTGG - Intergenic
1174253837 20:49239276-49239298 CAGTGGTCCAAGAGCCCGAGAGG + Exonic
1174441605 20:50560017-50560039 CAGCCTCCCTAGAGGCCCTGAGG - Intronic
1174567193 20:51473829-51473851 CACTGGCCCAAGATGACCAGAGG - Intronic
1175125639 20:56749409-56749431 CTGAGGCCAAAGAGGCCCTGGGG + Intergenic
1175325969 20:58128839-58128861 CAGGGGCCCCTGAGGCCCTGTGG - Intergenic
1175690985 20:61065878-61065900 CATTGCCCCACGAGGCCTTGAGG - Intergenic
1176235600 20:64052146-64052168 CAGTGGCCAGAGAAGCCTTGGGG - Intronic
1180195704 21:46192258-46192280 CAGAGGCCCATGAGGACCAGTGG - Intronic
1181003387 22:19998387-19998409 CTGTGGCCAAAGGGCCCCTGGGG + Intronic
1181121343 22:20670024-20670046 GCCTGGCCCATGAGGCCCTGTGG - Intergenic
1181165570 22:20981216-20981238 CAGTGGCAGCAGAGGCCTTGAGG - Exonic
1181334300 22:22117049-22117071 GCCTGGCCCACGAGGCCCTGTGG - Intergenic
1182027600 22:27132745-27132767 CAGAGGCCCAGCAGGCCCAGCGG + Intergenic
1182285815 22:29246244-29246266 CAGAGGCCAAAGAGGCCTTCAGG + Intronic
1182736722 22:32536119-32536141 GAGTGGCTCAGGAGGCACTGGGG + Intronic
1182771688 22:32801379-32801401 CAGTGGCCCAGGTGGGCGTGGGG + Intronic
1184253144 22:43272202-43272224 CAGGACCCCAAGAGGCTCTGGGG - Intronic
1184261210 22:43317630-43317652 CAGTGGCAAAAGAGGGCCTTGGG + Intronic
1184583860 22:45434651-45434673 CACCTGCCCAAGAGGCCCAGTGG - Intergenic
1185214780 22:49592376-49592398 CACAGTCTCAAGAGGCCCTGAGG - Intronic
1185265792 22:49903407-49903429 AGGTGCCCCAAGAGGCCCTCGGG + Exonic
950473307 3:13199676-13199698 GAGTGGCCCCTGAGGCCCTTAGG + Intergenic
950708340 3:14797690-14797712 CTGTGGCCCAAGGGGCTCTACGG + Intergenic
952809284 3:37387063-37387085 CAGTGGGCCAAGGGGCCTGGGGG - Intronic
954103840 3:48398487-48398509 CACAGGCTCTAGAGGCCCTGAGG + Intronic
954136477 3:48584349-48584371 CAGTGGTCCACGAGGTCCAGGGG + Exonic
954292749 3:49658297-49658319 CTCTGGCCCCAGAGGCCCAGGGG + Intronic
954306109 3:49726340-49726362 CAGAGCCACCAGAGGCCCTGAGG + Exonic
954630524 3:52045415-52045437 CCCTGGCCCATGACGCCCTGTGG + Intergenic
962849713 3:139299315-139299337 CAGGGGCCGCAGAGGCCCTCAGG - Intronic
963751059 3:149180431-149180453 CAGTTGCACAGGAAGCCCTGAGG - Intronic
966200867 3:177358896-177358918 CACTGGGGCCAGAGGCCCTGTGG - Intergenic
968946823 4:3669234-3669256 CAGCGGCACAAGGGGGCCTGGGG + Intergenic
969286622 4:6206441-6206463 CACTGGCCCATGAGCCCTTGGGG - Intergenic
969335124 4:6503252-6503274 CAGTGGCTGCAAAGGCCCTGAGG - Intronic
972562835 4:40243761-40243783 CATTGACGCAGGAGGCCCTGTGG - Exonic
979228395 4:118318434-118318456 CAGTGTCCAAAGAGCTCCTGGGG - Exonic
979495461 4:121378307-121378329 CAGTGCCCAAATAAGCCCTGAGG + Intronic
982061051 4:151604372-151604394 CAGTGCACCAAGGAGCCCTGGGG + Intronic
983859946 4:172693542-172693564 ATGTGGCCCAAGAGGCAGTGGGG - Intronic
985591118 5:766046-766068 CAGTGACCCTAGGGGGCCTGGGG + Intronic
985747717 5:1656495-1656517 CACTTGCCCAGGAGGCGCTGTGG + Intergenic
986196064 5:5537171-5537193 CAGTGTCCCTAAAGGCCCTGGGG - Intergenic
988230828 5:28477061-28477083 CAGTGGCTCTAGGGGCCATGAGG + Intergenic
992496926 5:77302814-77302836 AAGGGGCCCAGGATGCCCTGTGG + Intronic
992639982 5:78760950-78760972 CAGTGCCCCTAGAGGCCAAGAGG - Intronic
995058166 5:107785666-107785688 CAGTGTGCCAATAGGGCCTGTGG - Intergenic
997377072 5:133404940-133404962 CAGTGCCCCAAGTGGCAGTGAGG + Intronic
998159293 5:139803981-139804003 CAGTGGCCTAGCAGGTCCTGTGG + Intronic
998716516 5:144890173-144890195 CAGTGACCCAAGCACCCCTGTGG - Intergenic
1002443157 5:179274706-179274728 CAGCCGCCCAGCAGGCCCTGGGG - Intronic
1003984233 6:11419484-11419506 CAGTGGCCCCAGTGGCCCCAAGG + Intergenic
1004315389 6:14582281-14582303 CAATGGCCCAAGAGAGCCTCTGG - Intergenic
1006095884 6:31656475-31656497 CACTGGCCCAAGTGGACCTCTGG - Exonic
1006298558 6:33180963-33180985 CCCTGGCCCAGAAGGCCCTGCGG - Exonic
1007357052 6:41328713-41328735 CAGTGGCCCTAGAGGGTCTTGGG + Intergenic
1007483690 6:42166457-42166479 CAGTCACCCAACAGACCCTGTGG + Intronic
1010070527 6:71738951-71738973 CAGTGGTCCTATAGGTCCTGTGG - Intergenic
1013289480 6:108708195-108708217 AAGTGGCTCCAGAGCCCCTGAGG - Intergenic
1017817897 6:158028328-158028350 CAGTGGCTGAGGAGGCACTGGGG + Intronic
1018838084 6:167500091-167500113 CAAGGGGCCCAGAGGCCCTGAGG + Intergenic
1019223431 6:170492959-170492981 CAGGGCCCCAAGGGGCCCAGAGG + Intergenic
1019859003 7:3639333-3639355 CAGGACCCTAAGAGGCCCTGGGG + Intronic
1020004039 7:4772229-4772251 CAGTTGCCCAGGAGCCACTGGGG - Intronic
1020098441 7:5381137-5381159 CTGTGGCCCTTGAGGCCCTGAGG - Intronic
1021434389 7:20597830-20597852 CTGTGGCCCTAGATGACCTGGGG + Intergenic
1024232172 7:47370961-47370983 CAGAGTCCCAAGGGGTCCTGGGG + Intronic
1026472757 7:70708268-70708290 CAGAAGCCCAAGAGGTCCTGCGG - Intronic
1027049533 7:75013170-75013192 GAGTGGCAGAAGAGGCCCTTTGG - Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028157682 7:87450018-87450040 CCGTGGCAGAAGAGGCTCTGGGG - Exonic
1029383493 7:100228482-100228504 GAGTGGCAGAAGAGGCCCTTTGG + Intronic
1029600168 7:101558679-101558701 CCCTGGCCCCAGAGGCCTTGAGG - Exonic
1031231513 7:119113876-119113898 GAGTGACACAAGTGGCCCTGTGG + Intergenic
1032439654 7:131932676-131932698 CTGTCCCCCAAGAGGGCCTGAGG - Intergenic
1033195331 7:139322516-139322538 AAGTGGGCCAAGAGGGCCAGGGG - Intergenic
1034531403 7:151698205-151698227 CATTAGCCCAGGTGGCCCTGTGG - Intronic
1035269188 7:157710009-157710031 CAGAGGCCCAGGTGGCTCTGTGG + Intronic
1035763791 8:2088977-2088999 CTGAGGCCCATGACGCCCTGGGG + Intronic
1035877744 8:3210115-3210137 CAGTGGAGCAAAAGGCCCCGAGG + Intronic
1036243867 8:7100676-7100698 CAGGGCCCTCAGAGGCCCTGGGG - Intergenic
1036256923 8:7213375-7213397 CAGGGCCCTCAGAGGCCCTGGGG + Intergenic
1036308973 8:7671974-7671996 CAGGGCCCTCAGAGGCCCTGGGG + Intergenic
1036360561 8:8074138-8074160 CAGGGCCCTCAGAGGCCCTGGGG - Intergenic
1037816068 8:22112683-22112705 CAGAGGCCCAAGGGTCTCTGAGG + Intergenic
1038751936 8:30303999-30304021 AAGTGGCCCGTGAGACCCTGAGG + Intergenic
1039392330 8:37191412-37191434 CAGTGGCCTAAGGGACACTGTGG - Intergenic
1040018772 8:42721810-42721832 CAGTGGTCTCAGAAGCCCTGTGG + Intronic
1045504913 8:102771524-102771546 CAGTGGGCCAGGAGCCTCTGGGG + Intergenic
1047217053 8:122884729-122884751 CAGTGGGCCAAGCAGACCTGTGG + Intronic
1049328699 8:142038397-142038419 CAGTGGTCCCAAAGGCCCTTTGG + Intergenic
1049624958 8:143615765-143615787 CAGAGGCTCCAGAGGCCCTGGGG + Intronic
1049661753 8:143822629-143822651 CTGGGGACCAAGAGGCCCTTGGG + Intronic
1052810286 9:33052415-33052437 CAGTGGCCCAAAAGATACTGCGG + Intronic
1053290893 9:36879109-36879131 CAGAGTCCCATGGGGCCCTGGGG + Intronic
1053752301 9:41269132-41269154 CAGTGGCTCTAGAGGCCCCTTGG - Intergenic
1054257828 9:62833464-62833486 CAGTGGCTCTAGAGGCCCCCTGG - Intergenic
1056973952 9:91233409-91233431 CATGGGCCCAAAAGGACCTGGGG + Intronic
1058193997 9:101952172-101952194 CAGGGGACTAAGAGGCTCTGAGG - Intergenic
1059215857 9:112561483-112561505 CAGTGGGCCACTAGGCACTGGGG - Intronic
1059468952 9:114488967-114488989 CACAGGCCCAAGATGCACTGTGG - Intronic
1059529398 9:115022105-115022127 CAGTGGGGCAAGGGGCCATGTGG - Intronic
1060055539 9:120409771-120409793 CAGAGGCACAAGAGACACTGTGG + Intronic
1060059197 9:120444028-120444050 CAGTTGCCCAGGAGACCCTAGGG - Intronic
1060497531 9:124129468-124129490 CAGGGGCCCAGGAGGCTGTGAGG + Intergenic
1060530938 9:124346699-124346721 CAGGGGCCACAGTGGCCCTGAGG - Intronic
1060861347 9:126957251-126957273 CAGTGACAGAAGAGGGCCTGAGG + Intronic
1061011792 9:127960299-127960321 CAGTGGCTGAAGAGGAGCTGGGG + Intronic
1061422681 9:130480679-130480701 GAGAGGCCCAGGAGGGCCTGGGG + Intronic
1061918291 9:133768645-133768667 CAGTGATCCAGGAGGCCCTTGGG + Intronic
1062046444 9:134426682-134426704 CACTGCCCCGAGAGCCCCTGAGG - Intronic
1062115261 9:134805193-134805215 CCCTGGCCCACCAGGCCCTGCGG + Exonic
1062268360 9:135697706-135697728 CAGTGACCCTCCAGGCCCTGGGG - Intronic
1187064204 X:15816998-15817020 CACTGGCCGAGGAGGCCATGTGG + Intronic
1189374387 X:40455341-40455363 CAGCAGCCAATGAGGCCCTGAGG - Intergenic
1190217484 X:48489501-48489523 CCGTGGCCCACGAGGCCCTCCGG - Intergenic
1190221506 X:48515152-48515174 CCATGGCCCATGAGGCCCTCCGG - Intronic
1190232157 X:48590515-48590537 CCGTGGCCCACGAGGCCCTCCGG - Intronic
1190263562 X:48814727-48814749 CAGTCGCCCTCGAGGTCCTGGGG + Exonic
1190614710 X:52218047-52218069 GAGTGACACAAGATGCCCTGTGG - Intergenic
1192207988 X:69108757-69108779 ATGTCTCCCAAGAGGCCCTGGGG - Intergenic
1192325392 X:70127947-70127969 CAGTGGGCCAAGCAGCACTGAGG - Intergenic
1192860030 X:75057884-75057906 CAGTGGCACAAGAGGGTCTGTGG + Intronic
1198996114 X:142576637-142576659 GAGTGGCCCAAGCACCCCTGTGG + Intergenic
1200980822 Y:9261794-9261816 ATATGGCCCAAGGGGCCCTGAGG + Intergenic
1202332424 Y:23768860-23768882 CACTTGTCCCAGAGGCCCTGAGG + Intergenic
1202349471 Y:23972432-23972454 CACTTGTCCCAGAGGCCCTGAGG + Intergenic
1202521304 Y:25697672-25697694 CACTTGTCCCAGAGGCCCTGAGG - Intergenic
1202538345 Y:25901203-25901225 CACTTGTCCCAGAGGCCCTGAGG - Intergenic